Compositions and methods for capturing and releasing cells containing CD44 antigen.

By employing an electrochemical method using lipid bilayer membrane-modified electrodes and bleomycin-ferrous complexes, the complexities of mesenchymal stem cell capture and release have been resolved, enabling efficient and sensitive cell detection and quantitative analysis.

CN116242894BActive Publication Date: 2026-03-10章毅 +7
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202210800698.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-07-06
Publication Date
2026-03-10
Estimated Expiration
2042-07-06

AI Technical Summary

Technical Problem

Existing technologies for the capture, release, and quantitative analysis of mesenchymal stem cells are cumbersome and complex, making it difficult to achieve efficient and sensitive cell detection.

Method used

A lipid bilayer membrane-modified electrode, combined with cholesterol-aptamer and bleomycin-ferrous complex, was used to capture, release, and quantify mesenchymal stem cells containing CD44 antigen via an electrochemical method. The high biocompatibility of the lipid bilayer membrane and the cleavage activity of the bleomycin-ferrous complex enabled the specific capture and release of cells.

Benefits of technology

It achieves efficient capture and release of mesenchymal stem cells, avoids non-specific adsorption, has high biocompatibility and stability, can perform quantitative analysis, and is simple to operate and easy to automate.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116242894B_ABST
    Figure CN116242894B_ABST
Patent Text Reader

Abstract

A composition and method for capturing and releasing cells containing CD44 antigen, comprising cholesterol-aptamers, silver nanoparticle-modified aptamers, and bleomycin-ferrous ion complexes, exhibits higher biocompatibility and stability, facilitating the formation of a biointerface for the efficient capture and release of mesenchymal stem cells. Applying the composition of this invention to the electrochemical detection of cell capture and release offers advantages such as mild reaction conditions, simplicity, speed, and sensitivity, making it easy to integrate with other automated reaction interfaces for commercial development. Furthermore, it can be combined with electrochemical biochip sensor arrays to achieve even more convenient capture, detection, and release of mesenchymal stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a detection composition of cell-derived substances, in particular to a composition and method for qualitative and quantitative detection of biological substances such as stem cells by electrochemical method. BACKGROUND

[0002] Mesenchymal stem cells are multipotent stem cells that share all the common properties of stem cells, i.e. self-renewal and multi-differentiation capacity. In recent years, mesenchymal stem cells (MSCs) have attracted much attention due to their great potential in cell therapy. In fact, they secrete a variety of immune modulatory factors of interest for the treatment of immune-related diseases and inflammatory diseases. MSCs can be extracted from multiple tissues of the human body. However, several factors can limit their application in clinical applications, such as the need for invasive procedures for isolation, limited quantity, and heterogeneity according to the source or donor tissue. Since mesenchymal stem cell therapy still faces many challenges in the process of clinical application, it is particularly important to establish an efficient and sensitive method for capturing, releasing and quantitative analysis of mesenchymal stem cells to further carry out more in-depth biological research.

[0003] Among many non-biological fouling materials that can strongly resist protein adsorption, lipid-based materials are considered to be the closest to biological systems, which create a cell membrane simulation environment for cell-cell and cell-biomaterial interactions. Due to their non-polar and inert chemical properties, these lipid-based materials can effectively avoid the adsorption of various non-interesting substances in solution, thus achieving strong anti-fouling. In recent years, electrochemical technology combined with self-assembled monolayers, lipid bilayers, Langmuir-Blodgett layers and supported lipid bilayers has produced a variety of electrochemical biosensing technologies, and techniques for separating cells using the excellent properties of lipid bilayers have also been reported, providing a theoretical basis for the development of new strategies for cell capture and release. SUMMARY

[0004] It is an object of the present application to provide a composition for capturing and releasing cells containing CD44 antigen, which is applied to the capture and release of cells for electrochemical detection.

[0005] It is another object of the present application to provide a method for capturing and releasing cells containing CD44 antigen, which effectively monitors the release of cells by electrochemical method.

[0006] It is still another object of the present application to provide a method for capturing and releasing cells containing CD44 antigen, which obtains differential electrochemical signals for detecting cells.

[0007] It is yet another object of the present application to provide a method for capturing and releasing cells containing CD44 antigen, which realizes quantitative detection of cells.

[0008] CD44 antigen is a group of widely distributed, molecular weight (85-160) x 10kD, multi-molecular form of membrane integrated protein, and contains a high amount of sugar. CD44 molecular weight ranges from 85 to 250 kD, mediates cell-cell and cell-extracellular matrix interactions, and is also a glycoprotein composed of extracellular, transmembrane and cytoplasmic three parts, and the sugar chain is chondroitin sulfate and heparan sulfate.

[0009] The present application constructs a lipid bilayer membrane modified electrode, uses the high affinity between the lipid bilayer and the cholesterol molecule to realize the immobilization of the nucleic acid aptamer, and then combines the nucleic acid cleavage activity of the bleomycin-ferrous ion complex (bleomycin-ferrous complex) to realize the capture, release and detection of cells containing CD44 antigen. It is particularly important for mesenchymal stem cells.

[0010] A composition for capturing and releasing cells containing CD44 antigen is applied to the capture and release of electrochemical detection of cells, comprising:

[0011] Cholesterol-aptamer, which contains the following nucleotide sequence, 5' containing a cholesteryl group:

[0012] 5'-Cholesteryl-AAAGCGCGTAAGTGAAATGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3';

[0013] Silver nano-modified aptamer, which contains the following nucleotide sequence:

[0014] 5'-CCCCCCCCCCCCGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'; and

[0015] Bleomycin-ferrous ion complex.

[0016] (1) Compared with gold electrode, the lipid bilayer membrane modified electrode can avoid non-specific adsorption in a complex environment, and has higher biocompatibility and stability for the immobilization of nucleic acid probe molecules.

[0017] (2) The bleomycin-ferrous complex formed by the combination of bleomycin and divalent iron ions can specifically cleave 5'-GT and 5'-GC sequences under the action of oxygen, and efficiently release the captured mesenchymal stem cells and cell surface bound signal probes.

[0018] (3) can be more convenient by combining with electrochemical biological chip sensor array, the capture, detection and release of cells containing CD44 antigen (such as: mesenchymal stem cells) are realized.

[0019] The composition of the application also includes a functionalized gold electrode, specifically: a lipid bilayer functionalized gold electrode.

[0020] An embodiment of the application for preparing a lipid bilayer functionalized gold electrode, first place the gold electrode in 0.5M-0.6M H2SO4 solution, cyclic voltammetry scanning in the voltage range of 0-1.6V, scanning number is 25-30, then dry the electrode with nitrogen.

[0021] Then, add the ethanol solution containing 2-2.5mM DPPTE to the surface of the gold working electrode, and incubate at room temperature for 16-20 hours to form the first lipid layer through Au-S interaction.

[0022] After that, rinse the electrode with ethanol and treat with 20-25mg / mL DPPC solution for 5-7 minutes, then place the electrode at-20℃ for 30-40 minutes, and then transfer to room temperature for another 30-40 minutes to form a lipid bilayer membrane, thus preparing a lipid bilayer functionalized gold electrode.

[0023] A method for capturing and releasing cells containing CD44 antigen, comprising:

[0024] Place the functionalized gold electrode in a solution containing 1-2μM cholesterol-aptamer and 10-15mM PBS, and place in a 4℃ dark reaction for 2-3 hours, then rinse the electrode surface with 5-10mL PBS;

[0025] Incubate the cell solution containing CD44 with the functionalized gold electrode for 1.5-2h, wash with PBS for 2-3 times to remove the cells not captured, then add 1-1.5μM silver nano-modified aptamer to the electrode capturing cells, and react at room temperature for 1-1.5h.

[0026] Finally, add 45-50μM bleomycin-ferrous complex, react for 60-65min, and collect the reaction solution. Centrifuge the obtained reaction solution at 500-1000rpm, and collect the lower precipitate as the released cells.

[0027] Electrochemical impedance characterization of the modified electrode surface for capture and release, a three-electrode system including a lipid bilayer modified electrode as the working electrode, a saturated calomel electrode as the reference electrode and a platinum wire as the counter electrode.

[0028] The supernatant obtained by centrifugation is added with 0.5-1M nitric acid solution for reaction at room temperature for 2h, and silver ions are enriched on the graphite electrode by using a stripping voltammetry method. Then, the electrochemical signal of silver nanoparticles is detected by using a differential pulse voltammetry method in the range of -0.4V to 0.4V with 0.5-1M sodium acetate electrolyte. The electrochemical measurement is performed by using a CHI660c electrochemical workstation. The three-electrode system includes a graphite electrode as a working electrode, a saturated calomel electrode as a reference electrode and a platinum wire as a counter electrode.

[0029] It is verified that the method of the present application is linearly correlated with the electrochemical signal obtained in the concentration range of 10 2 cells / mL to 10 6 cells / mL, and quantitative electrochemical detection can be realized in this concentration range. The linear equation is I (microampere) = 0.8192 x lg cell concentration (cells / mL) + 0.4149 (R 2 = 0.99), which is significantly better than most of the existing mesenchymal stem cell detection methods.

[0030] The beneficial effects achieved by the technical scheme of the present application are:

[0031] The existing mesenchymal stem cell separation methods include the adherent method, the flow cytometry separation method, the density gradient centrifugation method and the immunomagnetic bead method, etc. These methods are relatively complex. In comparison, the present method can avoid non-specific adsorption in a complex environment by using a lipid bilayer membrane modified electrode, and has higher biocompatibility and stability, which is conducive to forming a biological interface for efficient capture and release of mesenchymal stem cells.

[0032] Compared with the traditional separation and release method, the release method based on the cutting activity of the bleomycin-ferrous complex can not only successfully release the cells captured on the interface, but also release the signal molecules on the cell surface into the solution, so that the mesenchymal stem cells can be collected and effectively quantitatively detected and analyzed.

[0033] The present method is easy to operate, has relatively mild reaction conditions, and has the advantages of simplicity, rapidness and sensitivity, and is convenient for combination with other automatic reaction interfaces for commercial development. By combining with an electrochemical biosensor chip sensor array, more convenient mesenchymal stem cell capture, detection and release can be realized. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 EIS results of the electrode surface in different states;

[0035] Figure 2 Impedance graph of mesenchymal stem cells fixed on the electrode surface;

[0036] Figure 3Electrochemical signal diagram of mesenchymal stem cells after being cut and released by bleomycin-ferrous complex;

[0037] Figure 4 Electrochemical quantitative analysis result diagram of different mesenchymal stem cell concentrations;

[0038] Figure 5 Linear fitting diagram of electrochemical signal response results of different concentrations of mesenchymal stem cells;

[0039] Figure 6 Route diagram for capturing and releasing mesenchymal stem cells in the present application. DETAILED DESCRIPTION

[0040] The technical solutions of the present application are described in detail below in combination with the drawings. The embodiments of the present application are only used to illustrate the technical solutions of the present application and not to limit. Although the present application has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that the technical solutions of the present application can be modified or replaced equivalently without departing from the spirit and scope of the technical solutions of the present application, which should be covered in the scope of the claims of the present application.

[0041] Figure 6 Mechanism of capturing and releasing mesenchymal stem cells in the present application, including:

[0042] (1) The phospholipid bilayer membrane has good antifouling property and biocompatibility, so that modifying the phospholipid bilayer membrane on the electrode can improve the stability and biocompatibility of the electrode interface, and at the same time, the cell capture with this interface has good antifouling ability, which can enhance the efficiency of cell capture and release and ensure the activity of the cells after capture and release. Therefore, we first modified the lipid bilayer membrane on the working electrode surface by phospholipid self-assembly for capturing mesenchymal stem cells.

[0043] (2) The cholesterol-modified CD44 nucleic acid aptamer probe (cholesterol-aptamer chain) can be inserted into the lipid bilayer membrane through the hydrophobic interaction of the cholesterol group with the lipid membrane, and the DNA part can specifically capture mesenchymal stem cells as the nucleic acid aptamer sequence of the CD44 surface marker of mesenchymal stem cells.

[0044] (3) When mesenchymal stem cells exist in the system, they can be recognized and captured by the cholesterol-aptamer chain on the gold electrode modified with the lipid bilayer membrane; then, the captured mesenchymal stem cells can be further recognized and combined with the CD44 aptamer functionalized silver nanoparticles (aptamer chain-silver nanoparticles), and the aptamer chain-silver nanoparticles are in situ labeled by recognizing and combining the CD44 aptamer with the mesenchymal stem cells.

[0045] (4) Since the CD44 aptamer contains a bleomycin-ferrous complex cleavage sequence, it can selectively cleave 5'-GC-3' and 5'-GT-3' in the aptamer sequence after the addition of the bleomycin-ferrous complex, so that the captured mesenchymal stem cells are released from the electrode surface, and the signal probe also leaves the cell surface, thereby releasing the mesenchymal stem cells and the silver nanometer signal probe into the solution.

[0046] (5) Collect the reaction solution, and the precipitate obtained after centrifugal treatment is the interface-released mesenchymal stem cells, which can be used for subsequent biological research; the supernatant obtained by centrifugation contains released silver nanoparticles, and the quantitative signal related to the number of mesenchymal stem cells can be obtained by electrochemical technology.

[0047] According to the above mechanism, the method used in the following embodiments of the application mainly includes the following steps:

[0048] (a) Preparation of a lipid bilayer gold electrode, the specific process being: after polishing the gold electrode, an ethanol solution containing 2-2.5 mM DPPTE (1,2-dipalmitoyl-sn-glycerol phosphatidylthioethanol) is added to the surface of the gold working electrode, and incubated at room temperature for 16-20 hours to form a first lipid layer through gold mercapto bond interaction. Then, the electrode is washed with ethanol and treated with a 20-25 mg / mL DPPC (dipalmitoyl phosphatidylcholine) solution for 5-10 minutes, and then placed at -20°C for 30-40 minutes, and then transferred to room temperature for another 30-40 minutes to form a lipid bilayer membrane.

[0049] (b) Preparation of an aptamer-functionalized lipid bilayer gold electrode, the specific process being: the electrode modified according to the above steps is inverted in a solution containing 1-2 μM cholesterol-aptamer chain and 10-15 mM PBS (pH about 7.4), and placed in a 4°C dark reaction for 2-3 hours, and then the electrode surface is washed with 5-10 mL of PBS.

[0050] (c) Preparation of aptamer strand-silver nanoparticles, the specific process is: 3-5 μL of 100-110 μM CD44 aptamer strand is added to 1200-1500 μL of silver nanoparticle solution, and both are incubated at room temperature for 1-2 hours to allow the DNA to be adsorbed on the silver nanoparticles; 10-15 μL of 500-510 mM trisodium citrate buffer (pH = 3) is added to the above solution, and the final concentration reaches 5-10 mM, and it is incubated at room temperature for 30-60 minutes; 150-200 μL of 200-210 mM PB buffer (pH = 7.4) is added to make the pH of the silver nanoparticle solution neutral, and it is incubated at room temperature for 10-15 minutes; 14000 rpm centrifugation at 4°C for 20-30 minutes to remove unbound aptamer; washed with 1-2 mL of 10-15 mM PB buffer (pH = 7.4) for 3 times; after washing, the CD44 aptamer functionalized silver nanoparticle complex is dispersed in 1-2 mL of 10 mM PB buffer (pH = 7.4) and stored at 4°C for subsequent use. The preparation method of 200-210 mM PB buffer (pH = 7.4) is as follows: A liquid: 3.5-3.6 g of disodium hydrogen phosphate dihydrate is dissolved in 100-110 mL of deionized water, B liquid: 3.1-3.2 g of sodium hydrogen phosphate dihydrate is dissolved in 100-101 mL of deionized water. Before use, mix A liquid and B liquid uniformly, and store the prepared PB buffer at 4°C for use.

[0051] (d) Capture, release and detection of mesenchymal stem cells, the specific process is: an electrochemical workstation and a three-electrode system are used for electrochemical measurement. The three-electrode system includes: a graphite electrode or a gold electrode as a working electrode, a saturated calomel electrode as a reference electrode, and a platinum wire as a counter electrode. The mesenchymal stem cell solution is poured onto the aptamer functionalized lipid bilayer gold electrode and incubated for 1.5-2 hours, and then washed with PBS for 2-3 times to remove the mesenchymal stem cells that are not captured. Then, 1-1.5 μM of aptamer strand-silver nanoparticle is added to the electrode with captured cells, and reacted at room temperature for 1-1.5 hours, and then washed with PBS for 2-3 times. Subsequently, the electrode is immersed in 100-120 μL of a solution containing 45-50 μM of bleomycin-ferrous complex, and reacted for 60-90 minutes to realize the simultaneous release of mesenchymal stem cells and signal probes. Subsequently, the reacted solution is collected, 100-120 μL of 0.5-1 M nitric acid solution is added, and reacted at room temperature for 1.5-2 hours to make the silver nanoparticles be acid-dissolved and release a large amount of silver ions. Finally, the acid-dissolved reaction solution is mixed with 3.8-3.9 mL of 0.5-1 M sodium acetate solution as an electrolyte, and the silver ions are enriched on the surface of the graphite electrode by electrochemical deposition process, and the electrochemical signal is collected by differential pulse voltammetry.

[0052] wherein: the sequence of the cholesterol-aptamer strand used in step (b) is: 5'- Cholesteryl- AAAGCGCGTAAGTGAAATGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'.

[0053] The sequence of the silver nano-modified aptamer strand used in step (c) is: 5'- CCCCCCCCCCCCCGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'.

[0054] The specific parameters of the electrochemical deposition process used in step (d) are: deposition for 8 minutes at -1.2V potential; the specific parameters of the differential pulse voltammetry used are: potential scan range of -0.4V to 0.4V, amplitude of 25mV, frequency of 15Hz.

[0055] Example 1

[0056] The lipid bilayer gold electrode was prepared as follows:

[0057] (a) The gold electrode was first polished on sandpaper to make the surface of the gold electrode flat and consistent in scratches. Then it was polished with aluminum powder until it was shiny, and repeatedly rinsed with distilled water until impurities were removed. Subsequently, the gold electrode was ultrasonically cleaned in ethanol and distilled water for 2-3 minutes, respectively. After the electrode surface was blown dry with nitrogen, it was immersed in freshly prepared wobbegong fish solution (30% hydrogen peroxide: concentrated sulfuric acid = 1:3, V / V) for 2-3 minutes, and then ultrasonically cleaned in ethanol and distilled water for 2-3 minutes, respectively, to remove residual substances.

[0058] (b) Subsequently, the gold electrode was placed in a 0.5M-0.6M H2SO4 solution and cyclic voltammetry scanning was performed in the voltage range of 0-1.6V, with 25-30 scanning cycles, and then the electrode was blown dry with nitrogen.

[0059] (c) Subsequently, an ethanol solution containing 2-2.5mM DPPTE was added to the surface of the gold working electrode, and incubated at room temperature for 16-20 hours to form the first lipid layer through Au-S interaction.

[0060] (d) After that, the electrode was rinsed with ethanol and treated with a 20-25mg / mL DPPC solution for 5-7 minutes, then placed at -20°C for 30-40 minutes, and then transferred to room temperature for another 30-40 minutes to form a lipid bilayer membrane.

[0061] The modification of lipid bilayer on the electrode surface is essential for the implementation of the present application, therefore, we used alternating current impedance spectroscopy to characterize the assembly of the electrode surface. As shown in Figure 2, Figure 1 The Nyquist plot clearly shows the EIS results of the electrode surface in different states. The impedance spectrum of the bare gold electrode is almost a straight line, which indicates that the electronic transfer resistance is extremely low at this time (curve Au). When the lipid bilayer is assembled on the electrode surface, the impedance spectrum (curve LB) shows a significant increase, indicating that the lipid bilayer forms a significant steric barrier, resulting in an increase in the transfer resistance of the charge, and thus indicating that the lipid bilayer is successfully assembled on the electrode surface.

[0062] Example 2

[0063] Mesenchymal stem cell capture and release, the steps are as follows:

[0064] (a) Pour the mesenchymal stem cell solution upside down on the functionalized gold electrode and incubate for 1.5-2h, wash with PBS for 2-3 times to remove the mesenchymal stem cells that are not captured, then add 1-1.5μM silver nano-modified aptamer chain to the electrode with captured cells, and react at room temperature for 1-1.5h.

[0065] (b) Then add 45-50μM bleomycin-ferrous complex, react for 60-65min, and collect the reaction liquid. Centrifuge the obtained reaction solution at 500-1000rpm, and the lower precipitate is the released cells, which are collected for re-culture and further study. Electrochemical impedance characterization of the modified electrode surface for capture and release, the three-electrode system includes a lipid bilayer modified electrode as the working electrode, a saturated calomel electrode as the reference electrode and a platinum wire as the counter electrode.

[0066] (c) Add 0.5-1M nitric acid solution to the supernatant solution obtained by centrifugation and react at room temperature for 2h, and use stripping voltammetry to enrich silver ions on the graphite electrode. Then use 0.5-1M sodium acetate electrolyte to detect the electrochemical signal of silver nanoparticles by differential pulse voltammetry in the range of -0.4V to 0.4V. The electrochemical measurement is performed by CHI660c electrochemical workstation. The three-electrode system includes a graphite electrode as the working electrode, a saturated calomel electrode as the reference electrode and a platinum wire as the counter electrode.

[0067] The sequence of the relevant oligonucleotide DNA chain is as follows:

[0068] The nucleotides contained in the cholesterol-aptamer chain are as follows, which contain a cholesterol group at the 5' end:

[0069] 5'-Cholesteryl-AAAGCGCGTAAGTGAAATGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'.

[0070] The nucleotides contained in the silver nanoparticle-modified aptamer chain are as follows:

[0071] 5'-CCCCCCCCCCCCGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'.

[0072] After successfully modifying the lipid bilayer membrane on the electrode and immobilizing the cholesterol-modified aptamer chain, we used electrochemical methods to investigate its feasibility for the capture and release of mesenchymal stem cells. Figure 2 Impedance mapping obtained for immobilizing and releasing mesenchymal stem cells on electrodes. For example... Figure 2 As shown, in mesenchymal stem cells (10 6 When the captured mesenchymal stem cells (cells / mL) are fixed on the electrode surface, a large semicircular radius impedance map can be obtained. However, when the captured mesenchymal stem cells are released with the aptamer chain cleavage, the semicircular diameter of the electrochemical impedance spectrum becomes smaller, almost equivalent to the impedance obtained from the original lipid membrane modified electrode surface, proving that the cells captured on the electrode surface were successfully released.

[0073] The cleavage effect of the bleomycin-ferrous complex not only releases mesenchymal stem cells from the capture interface but also releases silver nanoparticles from the surface of the mesenchymal stem cells, allowing for the collection of the supernatant and characterization of the silver nanoparticles for quantitative analysis. Figure 3 As shown, when the mesenchymal stem cells captured at the interface are cleaved and released by the bleomycin-ferrous complex, signaling molecules on the cell surface are also released into the supernatant along with the cleavage reaction of the aptamer marker. The resulting solution can be analyzed to obtain the corresponding electrochemical signal (curve a). However, when the CD44 aptamer modified with silver nanoparticles binds to the surface of mesenchymal stem cells, no corresponding electrochemical signal is detected in the co-culture supernatant without cleavage by the bleomycin-ferrous complex (curve b). These results demonstrate that our established method can effectively monitor the release of mesenchymal stem cells using electrochemical methods.

[0074] Example 3

[0075] The quantitative analysis of mesenchymal stem cells follows these steps:

[0076] (a) Different concentrations (10–10)6 The mesenchymal stem cell solution (10-100 cells / μL) was dropped on the functionalized gold electrode and incubated for 1.5-2 h. The electrode was washed with PBS for 2-3 times to remove the un-captured mesenchymal stem cells. Then, 1-1.5 μM silver nanoparticle-aptamer complex was added to the electrode with captured cells and reacted for 1-1.5 h at room temperature.

[0077] (b) After that, 45-50 μM bleomycin-ferrous complex was added and reacted for 60-65 min. Then, 0.5-1 M nitric acid solution was added and reacted for 2 h at room temperature. The silver ions were enriched on the graphite electrode by using stripping voltammetry.

[0078] (c) The electrochemical signal of silver nanoparticles was detected by differential pulse voltammetry using 0.5-1 M sodium acetate electrolyte at -0.4 V to 0.4 V. The electrochemical measurement was performed by CHI660c electrochemical workstation. The three-electrode system included a graphite electrode as the working electrode, a saturated calomel electrode as the reference electrode and a platinum wire as the counter electrode.

[0079] A series of mesenchymal stem cells with different concentrations were subjected to electrochemical analysis. Figure 4 The results of electrochemical quantitative analysis of different mesenchymal stem cell concentrations are shown in the figure. As shown, the electrochemical response current increases with the increase of the number of mesenchymal stem cells, which is consistent with the expected results. The increase of the number of target cells increases the number of silver nanoparticle-modified aptamer chains on the surface of the target cells, and the increase of the number of signal molecules further improves the response value of the electrochemical signal. As shown, the peak current (I) increases with the increase of the number of mesenchymal stem cells. Figure 5 The peak current is linearly related to the logarithm of the number of mesenchymal stem cells in the range of 10 2 to 10 6 cells / μL. The linear equation is I (microampere) = 0.8192 x lg cell concentration (cells / μL) + 0.4149 (R 2 = 0.99).

Claims

1. A composition for capturing and releasing cells containing CD44 antigen, applied to the capture and release of cells for electrochemical detection, comprising: cholesterol-aptamer containing the following nucleotide sequence, 5' containing a cholesteryl group: 5'-Cholesteryl-AAAGCGCGTAAGTGAAATGAGATTCATCACGCGCATAGTCCC AAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'; silver nano-modified aptamer containing the following nucleotide sequence: 5'-CCCCCCCCCCCCGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGG AACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'; and bleomycin-ferrous ion complex.

2. The composition for capturing and releasing cells with CD44 antigen according to claim 1, wherein The cells are mesenchymal stem cells.

3. A method of capturing and releasing cells containing a CD44 antigen, characterized by Comprising: placing a functionalized gold electrode in a solution containing 1-2 μM cholesterol-aptamer and 10-15 mM PBS, and placing it in a 4°C dark reaction for 2-3 hours, then rinsing the electrode surface with 5-10 mL of PBS; incubating the cell solution containing CD44 with the functionalized gold electrode for 1.5-2 h, washing with PBS 2-3 times to remove cells that have not been captured, then adding 1-1.5 μM silver nano-modified aptamer to the electrode with captured cells, and reacting at room temperature for 1-1.5 h; finally, adding 45-50 μM bleomycin-ferrous complex, reacting for 60-65 min, and collecting the reaction liquid; centrifuging the obtained reaction liquid at 500-1000 rpm, and collecting the lower precipitate as the released cells; the cholesterol-aptamer containing the following nucleotide sequence, 5' containing a cholesteryl group: 5'-Cholesteryl-AAAGCGCGTAAGTGAAATGAGATTCATCACGCGCATAGTCCC AAGGCCTGCAAGGGAACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'; the silver nano-modified aptamer containing the following nucleotide sequence: 5'-CCCCCCCCCCCCGAGATTCATCACGCGCATAGTCCCAAGGCCTGCAAGGG AACCAAGGACACAGCGACTATGCGATGATGTCTTC-3'.

4. The method of capturing and releasing CD44 antigen-bearing cells according to claim 3, wherein The electrochemical scanning range for detecting silver ion signals by differential pulse voltammetry is from -0.4 V to 0.4 V, the frequency is 15 Hz, and the amplitude is 50 mV.

5. The method of capturing and releasing CD44 antigen-bearing cells according to claim 3, wherein The cells containing CD44 antigen are subjected to quantitative detection. The cells containing CD44 antigen are subjected to quantitative detection.

6. The method of capturing and releasing CD44 antigen-bearing cells according to claim 3, wherein The cell concentration range from 10 2 cells / mL to 10 6 cells / mL is linearly correlated with the resulting electrochemical signal.

Citation Information

Patent Citations

  • DNA-cell conjugates

    CN102575228A

  • Method for capturing and releasing circulating tumor cells

    CN108690832A