A polypeptide specifically binding to coronavirus s protein, encoding gene and application thereof

The peptide P6 was screened using phage display technology, which solved the problem of the difficulty in blocking the binding of coronavirus S protein to ACE2 in existing technologies, and achieved effective inhibition of SARS-CoV-2, providing a new drug target and blocking agent.

CN116262778BActive Publication Date: 2026-04-07PRECEDO PHARMA CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202111532650.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2021-12-15
Publication Date
2026-04-07
Estimated Expiration
2041-12-15

AI Technical Summary

Technical Problem

Current technologies lack targeted therapies and drugs for coronaviruses, especially SARS-CoV-2, making it difficult to effectively block the key step in viral infection of cells, namely the binding of the coronavirus S protein to ACE2.

Method used

Phage display technology was used to screen for peptides that can specifically bind to the coronavirus S protein, especially the SARS-CoV-2 S protein. Peptide P6 was screened using phage display technology, and its binding to ACE2 was inhibited.

Benefits of technology

Peptide P6 can significantly block the binding of SARS-CoV-2 S protein to ACE2 with an IC50 value of 0.179 μM, providing a new target for anti-coronavirus drugs with high binding affinity and inhibitory effect.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116262778B_ABST
    Figure CN116262778B_ABST
Patent Text Reader

Abstract

This invention discloses a polypeptide that specifically binds to the coronavirus S protein, its encoding gene, and its applications, belonging to the field of molecular biology. The polypeptide specifically binding to the coronavirus S protein provided by this invention contains the following amino acid sequence: HFVKTPARWAWG, obtained through screening using phage display technology. The polypeptide provided by this invention can specifically bind to the coronavirus S protein and specifically block the binding of the coronavirus S protein to ACE2, thereby inhibiting coronavirus infection and can be used to prepare anti-coronavirus drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a polypeptide that specifically binds to the coronavirus S protein, its encoding gene and its applications, particularly to a polypeptide that can specifically block the binding of the coronavirus S protein and ACE2 (angiotensin-converting enzyme 2), thereby inhibiting coronavirus infection of cells, its encoding gene and its applications, and also to the application of this polypeptide in the preparation of anti-coronavirus drugs or in blocking agents for blocking the binding of the coronavirus S protein to ACE2. Background Technology

[0002] Coronaviruses are a class of positive-sense RNA viruses that pose significant health risks, causing illnesses ranging from the common cold to severe illness, such as Middle East Respiratory Syndrome (MERS) and Severe Acute Respiratory Syndrome (SARS). The novel coronavirus (SARS-CoV-2) is a newly discovered strain of coronavirus in recent years, belonging to the genus *β* of the family Coronaviridae, the same family as MERS and SARS. Common signs of SARS-CoV-2 infection in humans include respiratory symptoms, fever, cough, shortness of breath, and difficulty breathing. In more severe cases, infection can lead to pneumonia, severe acute respiratory syndrome, kidney failure, and even death, causing serious social harm and economic losses. Therefore, the search for and development of therapeutic drugs against novel coronavirus infection is extremely urgent. Summary of the Invention

[0003] To address one or more problems existing in the prior art, one aspect of the present invention provides a polypeptide, which is one of the following a or b:

[0004] a. A polypeptide containing the amino acid sequence shown in SEQ ID NO:2 (HFVKTPARWAWG) and capable of specifically binding to the coronavirus S protein;

[0005] The acetylated, carboxylated, glycosylated, or phosphorylated forms of ba polypeptides.

[0006] In some embodiments, the amino acid sequence of the above-mentioned polypeptide is shown in SEQ ID NO:2.

[0007] In some implementations, the coronaviruses mentioned above are selected from one or more of SARS-CoV-2, SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1.

[0008] In some implementations, the coronavirus mentioned above is SARS-CoV-2.

[0009] In another aspect, the present invention provides a gene encoding the aforementioned polypeptide, which contains or is composed of a nucleotide sequence as shown in SEQ ID NO:1.

[0010] In another aspect, the present invention provides the use of the above-mentioned polypeptide in the preparation of anti-coronavirus drugs or in blocking agents for blocking the binding of coronavirus S protein to ACE2.

[0011] In some embodiments, when the above-described applications are used to administer the anti-coronavirus drug or an inhibitor to block the binding of the coronavirus S protein to ACE2 to a patient infected with coronavirus, the blood concentration of the polypeptide is at least 0.179 μM.

[0012] In another aspect, the present invention provides an anti-coronavirus drug comprising the aforementioned polypeptide as an active ingredient.

[0013] In another aspect, the present invention provides an inhibitor for blocking the binding of coronavirus S protein to ACE2, comprising the aforementioned polypeptide as an active ingredient.

[0014] The peptides provided by the above technical solutions can specifically bind to the S protein of coronaviruses (especially the novel coronavirus), thereby blocking the binding of ACE2 to the S protein and inhibiting coronavirus infection of cells. The results of the examples demonstrate that the peptides provided by this invention have a significant effect on blocking the binding of the novel coronavirus S protein to ACE2, with an IC50 value of [missing information]. 50 With a value of 0.179 μM, the peptide provided by this invention can be used to prepare anti-coronavirus (especially novel coronavirus) drugs or to block the binding of coronavirus S protein to ACE2, providing novel target drugs for the treatment of coronavirus infection. Attached Figure Description

[0015] Figure 1 Photographs of phage plaques from phage monoclonal strains after five rounds of attenuation screening of a phage library;

[0016] Figure 2 A statistical bar chart showing the binding affinity of 48 bacteriophage monoclonal antibodies to the S protein of SARS-CoV-2 as determined by ELISA.

[0017] Figure 3 The curves showing the relative fluorescence intensity changes detected at different concentrations of P6 peptide;

[0018] Figure 4 Curves showing the inhibition rate of different concentrations of P6 peptide against the binding of SARS-CoV-2 S protein to ACE2. Detailed Implementation

[0019] To address the current lack of targeted therapies and drugs for diseases caused by coronaviruses (such as SARS-CoV-2), this invention targets the S protein of coronaviruses (the binding of the coronavirus S protein to ACE2 on the surface of respiratory epithelial cells is crucial for viral invasion). It utilizes phage display technology to screen for peptides that can specifically bind to the coronavirus S protein, thereby inhibiting the binding activity of ACE2 to the S protein. Phage display technology is a specific peptide or protein screening technique that inserts specific gene fragments into phage DNA and expresses the corresponding peptides on the PIII capsid protein, forming fusion proteins displayed on the phage surface. The displayed peptides maintain relatively independent spatial structures and biological activities, establishing a direct link between a large number of random peptides and their DNA coding sequences. This allows for the rapid identification of peptide ligands for various target molecules (such as antibodies, enzymes, and cell surface receptors) through an in vitro affinity screening process. Based on the above principles, this invention uses phage display technology to screen a polypeptide that can specifically bind to the SARS-CoV-2 S protein and inhibit its binding to ACE2. This polypeptide has a good inhibitory effect on the binding of the SARS-CoV-2 S protein to ACE2 and can be used to prepare anti-novel coronavirus drugs or block the binding of coronavirus S protein to ACE2.

[0020] The present invention will be further described below with reference to specific embodiments. It should be understood that the specific embodiments are only used to further illustrate the present invention and are not intended to limit the scope of the present invention.

[0021] Unless otherwise specified, all methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).

[0022] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials in this invention. In fact, the sources of the biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments. Unless otherwise specified, the experimental materials used in the following embodiments are all conventional biochemical reagents that can be purchased commercially.

[0023] The sequences involved in the following examples can all be synthesized using existing technologies, and the short peptides involved can be synthesized by chemical synthesis.

[0024] Example 1: Phage display and screening of bioactive peptides that specifically bind to the novel coronavirus S protein

[0025] This embodiment mainly employs phage display technology. First, the novel coronavirus S protein is immobilized on carboxyl magnetic beads. Then, a mixed library of random nonapeptide and dodecapeptide phage displays is incubated with the target. After five rounds of panning and screening, the affinity of selected phage monoclonals is detected by ELISA. Several positive monoclonals are selected for sequencing, synthesis, and affinity testing. From these, bioactive peptides that can specifically bind to the novel coronavirus S protein are screened out. The specific steps include the following steps.

[0026] 1.1 Immobilization of BSA protein with carboxyl magnetic beads: Take 100 μl of carboxyl magnetic beads (Invitrogen, Dynabeads) TM MyOne TM Carboxylic Acid (#65012) was washed four times with 200 μl of ultrapure water. The beads were then magnetically hooked, and the supernatant was discarded. 100 μl of prepared NHS (N-hydroxysuccinimide, CAS No.: 6066-82-6) and 100 μl of EDC (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride, CAS No.: 25952-53-8) were slowly thawed at room temperature. The NHS was added to the EDC and mixed well, then added to the magnetic beads from the previous step. The mixture was incubated on a shaker at room temperature for 20 min. The beads were then magnetically hooked, the supernatant was discarded, and the mixture was washed twice with 200 μl of PBS. 10 μl of BSA protein (2 mg / ml, Abcam) was added to 95 μl of pH 3.6 NaAC solution and mixed well. This mixture was then added to the magnetic beads from the previous step and incubated on a shaker at room temperature for 60 min. The beads were then magnetically hooked, and the supernatant was discarded. Add 100 μl of 1M ethanolamine (pH 8.5) to the magnetic beads from the previous step and incubate at room temperature on a shaker for 10 min. Use a magnet to pick up the magnetic beads, discard the supernatant, and wash four times with 200 μl of PBS to obtain carboxyl-modified magnetic beads immobilized with BSA protein, denoted as MB-BSA, for later use.

[0027] 1.2 Immobilization of SARS-CoV-2 S protein with carboxyl magnetic beads: Take 100 μl of carboxyl magnetic beads, wash 4 times with 200 μl of ultrapure water, magnetize the beads, and discard the supernatant. Take 50 μl of prepared NHS and 50 μl of EDC, thaw slowly at room temperature, add NHS to EDC and mix well, then add to the magnetic beads from the previous step. Incubate at room temperature on a shaker for 20 min, magnetize the beads, discard the supernatant, and wash twice with 200 μl of PBS. Take 10 μl of SARS-CoV-2 S protein (hereinafter referred to as SARS-CoV-2 S protein, concentration 2.0 mg / ml, purchased from Sino Biological), add 30 μl of pH 3.6 NaAC, and add to the magnetic beads from the previous step. Incubate at room temperature on a shaker for 60 min, magnetize the beads, and discard the supernatant. Take 100 μl of 1M ethanolamine (pH 8.5) and add to the magnetic beads from the previous step. Incubate at room temperature on a shaker for 10 min. Magnetize the beads with a magnet, remove the supernatant, and wash four times with 200 μl PBS to obtain carboxyl magnetic beads immobilized with SARS-Cov-2 S protein, denoted as MB-S, for later use.

[0028] 1.3 Filtering

[0029] (1) Wash 100 μl of the MB-BSA magnetic beads obtained in step 1.1 with sterile PBS at least 3 times in a clean bench and remove the supernatant. Take 200 μl of a mixed library of random nonapeptide and dodecapeptide phage display (random nonapeptide and random dodecapeptide phage display libraries are mixed in equal proportions, both purchased from New England Biolabs, USA) and add it to the magnetic beads from the previous step, and mix well by pipetting. Incubate on a rotating shaker at room temperature for 60 min, use a magnet to fish for the magnetic beads, and label the supernatant as pool-. Take 1 μl of the supernatant for titer determination of the number of blue-white spots in the library.

[0030] (2) Wash the MB-BSA magnetic beads obtained in step 1.1 four times with 200 μl PBST (PBS containing 0.1% Tween-20). Add 100 μl glycine hydrochloride solution (pH 2.2) and mix by pipetting. Incubate on a rotating shaker at room temperature for 10 min, then use a magnet to pick up the magnetic beads. Transfer the supernatant to a new 1.5 ml centrifuge tube, add 20 μl Tris solution (1M, pH 9.0) and 80 μl PBS solution again for neutralization, and record this as Elution-. Take 1 μl for titer determination, count the number of blue-white spots on the negative sieve, and use this to calculate the retention rate.

[0031] (3) Wash 100 μl of MB-S magnetic beads obtained in step 1.2 with sterile PBS at least 3 times in a clean bench and discard the supernatant. Add the pool- that has been sieved in step (1) above and mix well by pipetting. Incubate on a rotating shaker at room temperature for 60 min, then use a magnet to pick up the magnetic beads and discard the supernatant. Wash the MB-S magnetic beads 4 times with 200 μl of PBST (PBS containing 0.1% Tween-20). Add 100 μl of glycine hydrochloride solution (pH 2.2) and mix well by pipetting. Incubate on a rotating shaker at room temperature for 10 min, then use a magnet to pick up the magnetic beads. Transfer the supernatant to a new 1.5 ml centrifuge tube, add 20 μl of Tris solution (1M, pH 9.0) and 80 μl of PBS solution again for neutralization, and record this as Elution+. Take 1 μl for titer determination and count the number of blue-white spots on the positive sieve to calculate the retention rate.

[0032] (4) Add the Elution+ obtained in step (3) to 20 ml of ER2738 bacterial culture (E. coli ER2738, purchased from New England Biolabs, USA) with OD600 = 0.5, mix well, and incubate in a shaker at 37°C and 220 rpm for 4.5 h for amplification. Transfer the amplified product to a new centrifuge tube, centrifuge at 8000g for 20 min at 4°C, transfer the supernatant to another centrifuge tube, and repeat the centrifugation. Transfer the upper 80% of the supernatant to a fresh centrifuge tube, add 1 / 6 volume of PEG / NaCl (20% [w / v] PEG-8000, 2.5M NaCl), and precipitate overnight at 4°C. After centrifugation again, resuspending in 1 ml PBS, and precipitating with PEG / NaCl for 20 min, dissolve in 200 μl PBS, centrifuge at 14000 rpm for 1 min, and transfer the supernatant to another fresh centrifuge tube. This is the amplified eluent (the eluted phage). Take 1 μl for titer determination, and use the rest for the next round of panning or for preservation.

[0033] In the second to fifth rounds of screening (each round of screening uses the amplified elution as the initial phage display library, and repeats the above steps (1) to (4)), the Tween-20 concentration in the washing buffer PBST is increased to 0.5% in each round, the incubation time with the target protein is reduced to 30 min in each round, the number of washes is increased to 8 times in each round, and the other conditions and steps are the same as in the first round. The retention rates of each round of screening are shown in Table 1 below.

[0034] Table 1: Retention Rates in Each Round of Screening

[0035]

[0036] 1.4 Determination of phage titer: The phage eluted in each round of step (4) of step 1.3 above was serially diluted 100-fold with PBS. 10 μl of the diluted phage was mixed with 200 μl of logarithmic growth cycle *E. coli* ER2738 bacterial suspension. This mixture was then added to LB agar at 45°C and quickly poured onto a plate containing LB / IPTG / Xgal. The plate was incubated overnight, and the blue phage plaques were counted. Figure 1 As shown, the blue phage plaques are those of the bacteriophage after five rounds of attenuation screening.

[0037] 1.5 ELISA Identification of Phage Peptides: After five consecutive rounds of attenuated screening of the phage display library, 48 phage clones (i.e., 48 blue phage plaques) were randomly selected from the phage titer assay plates. The affinity of these phage clones for the SARS-CoV-2 S protein was preliminarily identified using ELISA. The specific identification method was as follows: SARS-CoV-2 S protein was coated onto an ELISA plate and incubated overnight at 4°C. The plate was then blocked with 5% skim milk at room temperature for 2 hours, washed four times with 0.05% PBST, and the 48 phage clones were added and incubated for 4 hours. HRP-anti-M13 antibody (purchased from Abcam) was added, and the plate was incubated at 37°C for 1 hour. TMB was used for color development (100 μl per well, 8-15 min, purchased from Abcam). The reaction was terminated by adding an equal volume of 1M HCl, and the reading was taken at 450 nm using a microplate reader (denoted as P). BSA protein coating was used as a negative control (denoted as N). When P / N>2, the phage clone was identified as a positive clone that specifically binds to the SARS-CoV-2 S protein. The results are as follows: Figure 2 As shown, the ELISA results of affinity determination of 48 phage clones for the SARS-CoV-2 S protein are presented. Figure 2 It is evident that the phage clones corresponding to numbers 6, 12, 14, 18, 19, 28, 29, 31, and 35 are positive phage single clones. Furthermore, the positive phage single clone corresponding to number 6 has a significantly higher affinity for the SARS-CoV-2 S protein compared to other positive single clones. Therefore, this invention preferably uses the positive single clone corresponding to number 6 for gene extraction and sequencing.

[0038] 1.6 Gene Extraction and Sequencing: Phage clones numbered 6, initially identified as positive by ELISA, were amplified using plaque amplification. After centrifugation, the phage supernatant was transferred to a new centrifuge tube, 200 μL of PEG / NaCl was added, and the mixture was inverted and incubated at room temperature for 10 min. Centrifugation was then performed at 12000 rpm for 10 min, and the supernatant was discarded. A brief centrifugation was performed, and residual supernatant was carefully aspirated. The precipitate was thoroughly resuspended in 100 μL of iodide buffer, and 250 μL of ethanol was added. The mixture was incubated at room temperature for 10 min. This short incubation at room temperature allowed the single-stranded phage DNA to precipitate while most of the phage protein remained in solution. Centrifugation was then performed at 12000 rpm for 10 min, and the supernatant was discarded. The precipitate was washed with pre-cooled 70% ethanol and briefly vacuum-dried. The precipitate was resuspended in 30 μL of ddH2O and sent to General Biotechnology Co., Ltd. for single-clone sequencing. The sequencing results are shown in Table 2, and the corresponding amino acid sequences are shown in Table 3.

[0039] Table 2: Nucleotide sequence of phage clone number 6

[0040] Single clone number Monoclonal nucleotide sequence (3' to 5') 6 ACCCCAAGCCCAACGCGCAGGCGTCTTAACAAAATG(SEQ ID NO:1)

[0041] Table 3: Amino acid sequences corresponding to the nucleotide sequences of bacteriophage clone number 6

[0042]

[0043] 1.7 Bioinformatics Analysis of the Sequence: The nucleotide and corresponding amino acid sequences of phage clone number 6 were subjected to bioinformatics analysis in the National Center for Biotechnology Information (NCBI) GenBank DNA Sequence Database and Swiss-Prot Protein Database to search for homologous sequences. It was found that neither sequence showed homology with any known genes or proteins in the NCBI GenBank DNA Sequence Database or the Swiss-Prot Protein Database, and none of these sequences had been reported in existing technologies. Therefore, this invention yields a novel polypeptide capable of specifically binding to the SARS-CoV-2 S protein, and based on... Figure 2 The affinity test results for the SARS-CoV-2 S protein show that this polypeptide has a higher binding affinity than the polypeptides obtained from other positive monoclonal clones. The polypeptide obtained from the positive monoclonal clone numbered 6 is named P6, and its amino acid sequence is shown in Table 3 above.

[0044] The above-mentioned P6 polypeptide sequence can be obtained by chemical synthesis and can be modified by introducing modifications into the polypeptide. Modifications may include the deletion, insertion and / or substitution of one or more amino acids, as well as the addition or deletion of one or more amino acids at the C-terminus and / or N-terminus. Such modifications may also include acetylation, carboxylation, glycosylation, and phosphorylation of the polypeptide (e.g., in the form of phosphorylated amino acid residues (including but not limited to: phosphotyrosine, phosphotyserine, phosphotythreonine)), as long as the modified polypeptide can still specifically bind to the SARS-CoV-2 S protein.

[0045] Example 2: Biological effect of P6 peptide inhibiting the binding of SARS-CoV-2 S protein to ACE2

[0046] To verify the biological effect of the P6 peptide shown in Table 3 above as an inhibitor of the binding of SARS-CoV-2 S protein to ACE2, the peptide used in this example was diluted with PBS buffer (containing 0.01% DMSO) to a concentration of 0.001 μM–1.5 mM. The HEK 293T cell line (purchased from Hefei Zhongke Puruisheng Pharmaceutical Biotechnology Co., Ltd.) was cultured in DMEM (Coring, USA) + 10% fetal bovine serum (Fetal Bovine Serum, Excell) + 1% penicillin-streptomycin solution (Coring, USA). The plasmid ACE2-pcDNA3.1 and other plasmids were provided by the Hefei Institutes of Physical Science, Chinese Academy of Sciences. The specific operating steps are as follows.

[0047] (1) Preparation of SARS-CoV-2 virus-like cells: HEK 293T cell lines were cultured in DMEM (Coring, USA) + 10% fetal bovine serum (Excell) + 1% penicillin-streptomycin solution (Coring, USA). After cell resuscitation, the cells were cultured for two generations before testing. HEK 293T cells were seeded into T75 dishes 20-24 hours in advance. When the cell confluence reached 60-70%, the PAX2, PHB, and S protein expression plasmids were packaged and transfected using the transfection reagent Lipofiter 3.0. The T75 dishes were incubated at 37℃ and 5% CO2. After 48 hours of transfection, the viral supernatant was collected, which was the SARS-CoV-2 virus-like cell. The virus-like cells were stored at -80℃.

[0048] (2) Transient transfection and digestion: HEK 293T cells were seeded into 6-well plates 20-24 h in advance. When the cell confluence reached 60-70%, 3 μg of plasmid ACE2-pcDNA3.1 was transfected into HEK 293T cells using Lipofiter 3.0 transfection reagent. The 6-well plates were then incubated at 37°C with 5% CO2 for 48 h. After 48 h of transient transfection, HEK 293T-ACE2 cells were digested with trypsin, resuspended in complete culture medium, counted using a cell counter, and seeded into 96-well plates (Corning 3917, NY, USA) with a volume of 50 μl per well (25,000 cells / well). The plates were then incubated at 37°C with 5% CO2 for 12 h to allow the cells to adhere.

[0049] (3) Preparation of peptide compound P6: Prepare peptide compound P6 at different concentrations. Dilute PBS (containing 0.01% DMSO) by serial dilution (concentrations of approximately 1.1111 μM, 0.3704 μM, 0.1235 μM, 0.0412 μM, 0.0137 μM, 0.0046 μM, and 0.0015 μM, respectively). Add 10 μl each of the positive control drug Apilimod (STA-5326) and the control group PBS to the corresponding 96 wells in step (2) above, with two replicates for each treatment. Incubate at 37°C and 5% CO2 for 1 h. Then add 40 μl of SARS-CoV-2 viroid to each well for infection to ensure sufficient interaction between the peptide compound and the viroid.

[0050] (4) Medium replacement: After incubating the culture plate in a 37℃, 5% CO2 incubator for 24h, replace it with 100μL of fresh DMEM complete medium and continue culturing.

[0051] (5) Plate reading: After changing the medium, continue culturing for 24 hours before detection. Melt the Renilla-Glo Luciferase Assay System reagent and place it at room temperature. Take out the cell culture plate and place it for 10 minutes to equilibrate to room temperature. Add 30 μL of the reagent to each well. Shake the culture plate on a track shaker for 2 minutes to induce cell lysis. Place the culture plate at room temperature for 5 minutes to stabilize the luminescence signal. Detect the luminescence signal on an MD SpectraMax Paradigm plate reader.

[0052] 6) Data Analysis: MD SpectraMax Paradigm readings yielded the corresponding fluorescence value (RLU) per well. Inhibition rate data were processed using the following formula:

[0053] Inhibition rate (%) = 100% - (RLU) Drug -RLUMin ) / (RLU Max -RLU Min )*100%

[0054] In the above formula: RLU Drug RLU represents the fluorescence value measured after adding the peptide. Min RLU represents the fluorescence value measured without the addition of cells and peptides. Max This indicates the fluorescence value measured after adding PBS.

[0055] In Excel, the inhibition rates of different concentrations of peptide compound P6 were calculated. Then, GraphPad 7.0 Prism software was used to plot a curve with the inhibition rate on the ordinate and the Log value of the concentration on the abscissa, and relevant parameters, including IC50, were calculated. 50 Value (half-inhibitory concentration).

[0056] The relative fluorescence intensity of SARS-CoV-2 S protein binding to ACE2 as a function of time under different concentrations of peptide compound P6 is shown in the figure below. Figure 3 As shown, the relative fluorescence intensity gradually decreases with the increase of P6 peptide concentration. When the relative fluorescence intensity is about 50%, the inhibitory effect of P6 peptide on the binding of SARS-CoV-2 S protein to ACE2 reaches saturation. Figure 4 The curves showing the inhibition rate of different concentrations of peptide compound P6 on the binding of SARS-CoV-2 S protein to ACE2 are presented. It can also be seen that peptide P6 provided by this invention can inhibit the binding of SARS-CoV-2 S protein to ACE2. The calculated IC50 value... 50 With a molecular weight of 0.179 μM, this peptide P6 can be used to prepare a targeted drug against the novel coronavirus that targets the binding of the SARS-CoV-2 S protein to ACE2. Furthermore, the peptide sequence provided by this invention is relatively short, making it easy to synthesize and enabling large-scale production.

[0057] In summary, the peptide P6 provided by this invention can specifically bind to the S protein of the novel coronavirus, thereby effectively inhibiting or blocking the binding of the SARS-CoV-2 S protein to ACE2, with a corresponding IC50 value. 50With a concentration of 0.179 μM, this peptide can be used to prepare targeted drugs against the SARS-CoV-2 S protein or to prepare inhibitors that block the binding of the SARS-CoV-2 S protein to ACE2. After administration of this drug to a patient, it is preferable to achieve a blood concentration of P6 peptide of 0.179 μM or higher. On the other hand, since coronavirus S proteins are highly similar and their amino acid sequences are highly identical, the peptide P6 provided by this invention can also specifically bind to the S proteins of other coronaviruses (especially SARS-CoV, MERS-CoV, HCoV-229E, HCoV-OC43, HCoV-NL63, and HCoV-HKU1), thereby blocking the binding of the S protein to ACE2 and preparing targeted drugs against other coronaviruses.

[0058] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention. sequence list <110> Hefei Zhongke Puruisheng Biomedical Technology Co., Ltd. <120> A polypeptide that specifically binds to the coronavirus S protein, its encoding gene, and its applications. <160> 2 <170> SIPOSequenceListing 1.0 <210> 1 <211> 36 <212> DNA <213> Artificial Sequence <400> 1 accccaagcc caacgcgcag gcgtcttaac aaaatg 36 <210> 2 <211> 12 <212> PRT <213> Artificial Sequence <400> 2 His Phe Val Lys Thr Pro Ala Arg Trp Ala Trp Gly 1 5 10

Claims

1. A polypeptide having the amino acid sequence shown in SEQ ID NO:2, and capable of specifically binding to the coronavirus S protein.

2. The use of the polypeptide of claim 1 in the preparation of an anti-coronavirus drug, wherein the coronavirus is SARS-CoV-2.

3. An anti-coronavirus drug comprising the polypeptide of claim 1 as an active ingredient.

4. An inhibitor for blocking the binding of coronavirus S protein to ACE2, comprising the polypeptide of claim 1 as an active ingredient.

Citation Information

Patent Citations

  • Polypeptide molecule capable of being specifically combined with nucleocapsid protein of severe acute respiratory syndrome coronavirus and preparation method

    CN112940081A

  • Coronavirus S peptides

    US20060199176A1