Monoclonal antibody of hsp30 of talaromyces marneffei yeast phase and application thereof
By screening for monoclonal antibodies against HSP30, a yeast phase protein of *Basilaria marneffei*, the problems of long detection time and low specificity in existing technologies have been solved, achieving rapid and highly specific diagnosis and improving detection efficiency and sensitivity.
Patent Information
- Application Number
- CN202510038696.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-09
- Publication Date
- 2026-04-28
- Estimated Expiration
- 2045-01-09
AI Technical Summary
Existing rapid diagnostic methods for *Basilaria marneffei* suffer from problems such as long detection time and low specificity. Traditional detection methods, such as fungal culture and histopathological examination, are time-consuming and prone to confusion, while emerging technologies, such as PCR and gene chips, are costly and difficult to apply widely.
A monoclonal antibody against HSP30, a yeast phase protein of *Basilaria marneffei*, was developed. By screening monoclonal antibodies that specifically bind to HSP30, these antibodies were used to prepare enzyme-linked immunosorbent assay (ELISA) kits, immunochromatographic assay kits, and fluorescent probe reagents, enabling rapid and specific detection of *Basilaria marneffei*.
It improves the sensitivity and specificity of *Basilella marneffei* detection, avoids cross-reaction with other fungi, and enables rapid and convenient diagnosis, with a detection sensitivity of 89% and a specificity of 100%.
Smart Images

Figure CN119757744B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biotechnology, specifically to a monoclonal antibody against HSP30, a yeast phase protein from Bassula marneffeis, and its applications, belonging to the field of biomedical technology. Background Technology
[0002] Talamyces marnefei (TM) infection, along with tuberculosis and cryptococcal infection, is considered one of the three major opportunistic infections in people living with HIV / AIDS, causing approximately 17,300 infections and 4,900 related deaths worldwide each year. Talamyces marnefei infection progresses rapidly, has a poor prognosis, and a high mortality rate; without timely treatment, the mortality rate can reach as high as 91.3%. Therefore, research into rapid diagnostic techniques for Talamyces marnefei infection is of great significance for achieving early detection, early treatment, and improved prognosis of infected patients, as well as reducing the social burden on healthcare.
[0003] The clinical diagnostic process for *Basilaria marneffei* is cumbersome and time-consuming. Traditional detection methods mainly rely on fungal culture and histopathological examination. The former requires a long time for fungal culture, typically 2-4 weeks, before detectable *Basilaria marneffei* growth can occur, potentially delaying diagnosis and treatment. The latter is sometimes easily confused with other macrophage pathogens. In recent years, with the rapid development of biotechnology, PCR, gene chips, mass spectrometry, and next-generation sequencing technologies have been explored and applied in *Basilaria marneffei* infection detection as supplements to traditional methods. However, the high cost, long processing time, and relatively high requirements for equipment and personnel limit their application. Therefore, clinical practice needs more convenient, accurate, and cost-effective rapid antigen detection methods. Currently, most antigen detection methods for *Basilaria marneffei* both domestically and internationally use ELISA kits with *M. marneffei* cell wall mannose protein Mp1p as the antigen. However, because the *M. marneffei* MPl gene and the *Aspergillus* mannose protein genes AFMP1 and AFMP2 have some homology, monoclonal antibodies using Mp1p protein antigen as the target protein for screening cannot distinguish between *Basilaria marneffei* and *Aspergillus*, resulting in a specificity of only 65% in the diagnosis of fungal pneumonia. Therefore, finding new diagnostic biomarkers for *Basilaria marneffei* is key to solving the problem of low specificity in current rapid antigen detection methods.
[0004] *Basilaria marneffei* is a temperature-dependent dimorphic fungus and an opportunistic pathogen. At 25°C, *Basilaria marneffei* exists in its mycelial phase, producing asexually reproducing conidia. After 24 hours of in vitro culture at 37°C or infection with humans, expression of yeast-like proteins begins to appear, and after 96 hours, it is observed under a microscope to have completely transformed into a yeast-like fungus. Figure 1Currently, the detailed molecular regulatory mechanisms of the biphasic transformation and pathogenicity of *Basilaria marneffei* remain unclear. Studies have shown that the morphological transition from the hyphal phase to the yeast phase is a necessary process for toxicity production. This transition not only leads to changes in cell morphology but also involves the expression of yeast-phase-specific proteins responsible for biphasic fungal toxicity. Chandler et al., by identifying proteomic differences between the hyphal and early yeast phases of *Basilaria marneffei*, found that proteins with increased expression during the yeast phase are related to heat shock response, general metabolism, and cell wall biosynthesis. In particular, the RanA protein, responsible for regulating mitosis and nuclear membrane transport, is considered to be involved in the signal transduction mechanism of biphasic transformation. By searching and comparing homologous fungal sequences in databases to infer proteins common to both hyphal and yeast phases, 16 differentially expressed proteins were found in the proteomic maps of the *Basilaria marneffei* hyphal and yeast phases, 12 of which were highly expressed in the yeast phase. Protein function prediction revealed homology between these proteins and proteins that play key roles in energy production and other cellular metabolic pathways. This suggests that protein components altered during the mycelial-yeast phase transition of *Basilella marneffei* are crucial toxic proteins involved in the phase transition and pathogenicity of the bacteria. The yeast phase protein HSP30 of *Basilella marneffei* happens to be a key protein component upregulated in the infection state. Further protein sequence homology analysis revealed that the species-specific yeast phase protein heat shock protein 30 (TM.HSP30) functions as a "molecular chaperone." When an organism is exposed to high temperatures, it synthesizes this protein through heat stimulation to protect itself, aid in the physiological folding and unfolding of newly synthesized polypeptide bonds, and correct misfolded polypeptide chains, thus restoring cellular function and structure. Therefore, it can be concluded that the yeast phase protein HSP30 plays a similarly important role in the phase transition and pathogenicity of *Basilella marneffei* and could serve as a novel diagnostic molecular marker for the detection of *Basilella marneffei*. Screening for monoclonal antibodies targeting HSP30 of *Bambusa marneffei* will also provide new ideas and solutions for the rapid detection and treatment of *Bambusa marneffei* in clinical practice. Summary of the Invention
[0005] Therefore, this invention provides a monoclonal antibody against *Basilaria marneffei* yeast phase protein HSP30 and its application in the preparation of a *Basilaria marneffei* detection kit. The NCBI publicly available gene sequence of *Basilaria marneffei* yeast phase protein HSP30 is ABF82266(gi|106647229). The *Basilaria marneffei* monoclonal antibody of this invention can bind to *Basilaria marneffei* yeast phase protein HSP30, achieving the effect of specifically capturing infected *Basilaria marneffei*.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] The technical problem to be solved by the present invention is to provide a mouse monoclonal antibody with high affinity, high specificity, high sensitivity and anti-Bacillus marneffei, and its application in the detection of Bacillus marneffei infection.
[0008] This invention provides the application of an antibody prepared using the yeast phase protein HSP30 of *Basilaria marneffei* as an antigen in the preparation of detection products for *Basilaria marneffei*.
[0009] The present invention also provides an antibody, wherein:
[0010] (1) Antibody TM-49D11 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes CDRH1 as shown in SEQ ID NO:9, CDRH2 as shown in SEQ ID NO:10 and CDRH3 as shown in SEQ ID NO:11. The light chain variable region includes CDRL1 as shown in SEQ ID NO:12, CDRL2 as shown in SEQ ID NO:13 and CDRL3 as shown in SEQ ID NO:14.
[0011] (2) Antibody TM-50G1 includes a heavy chain variable region and a light chain variable region. The heavy chain variable region includes CDRH1 as shown in SEQ ID NO:15, CDRH2 as shown in SEQ ID NO:16 and CDRH3 as shown in SEQ ID NO:17. The light chain variable region includes CDRL1 as shown in SEQ ID NO:18, CDRL2 as shown in SEQ ID NO:19 and CDRL3 as shown in SEQ ID NO:20.
[0012] In some specific embodiments of the present invention, the heavy chain variable region of the antibody has:
[0013] (1) An amino acid sequence as shown in SEQ ID NO:5 or SEQ ID NO:7; or
[0014] (2) An amino acid sequence obtained by substituting, deleting, or adding one or more residues as shown in (1), and whose function is the same as or similar to that of (1); or
[0015] (3) An amino acid sequence that is at least 90% homologous to the amino acid sequence shown in (1) or (2);
[0016] Its light chain variable region has:
[0017] (4) An amino acid sequence as shown in SEQ ID NO:6 or SEQ ID NO:8; or
[0018] (5) An amino acid sequence obtained by substituting, deleting, or adding one or more residues as shown in (4), and whose function is the same as or similar to that of (4); or
[0019] (6) An amino acid sequence that is at least 90% homologous to the amino acid sequence shown in (4) or (5);
[0020] The number of items is 2 to 5.
[0021] The present invention also provides the amino acid sequence of the recombinant protein HSP30 from the yeast phase protein of *Basilella marneffei*, as shown in SEQ ID NO:4.
[0022] The kit for constructing the *Basilus marneffei* yeast phase protein HSP30 based on the above-mentioned antibody is characterized in that the kit for *Basilus marneffei* yeast phase protein HSP30 includes the above-mentioned *Basilus marneffei* yeast phase protein HSP30 monoclonal antibody or antibody combination.
[0023] This invention also provides the use of the above-mentioned monoclonal antibody against the yeast phase protein HSP30 of *Basilella marneffei* in any of the following:
[0024] 1) Prepare an enzyme-linked immunosorbent assay kit for detecting HSP30, a yeast phase protein of Bassicaceae Marneffei;
[0025] 2) Prepare an immunochromatographic assay kit for detecting HSP30, a yeast phase protein of Bassula marneffei;
[0026] 3) Preparation of fluorescent probe reagent for in vitro detection of HSP30 yeast phase protein in *Basilella marneffei*;
[0027] 4) Prepare drugs or formulations for the prevention and / or treatment of diseases related to *Brachysmus marneffei* infection.
[0028] The present invention also provides a labeled complex comprising a marker and the antibody described above, wherein the marker is at least one of the following:
[0029] Biotin;
[0030] Colloidal gold;
[0031] Fluorescent composite nanoprobes.
[0032] In some specific embodiments of the present invention, the above-mentioned detection product includes a test strip or a test card, and the raw materials of the test strip or test card include at least one of the following:
[0033] The above-mentioned monoclonal antibody against HSP30, a yeast phase protein of Bassula marneffei;
[0034] The above-mentioned labeled complex;
[0035] Goat anti-mouse monoclonal antibody;
[0036] Biotin-labeled monoclonal antibody against HSP30, a yeast phase protein from Bassula marneffei;
[0037] Streptavidin-labeled fluorescent markers.
[0038] This invention also provides a method for preparing the yeast phase protein HSP30 of *Basilella marneffei*, comprising the following steps:
[0039] Step (1): Bioinformatics analysis was performed on the yeast phase protein HSP30 of Bassula marneffei, species-specific analysis was performed by sequence alignment, and nucleic acid genes with immunogenicity were extracted by protein conformation prediction.
[0040] Step (2): Using a plasmid containing the HSP30 encoding gene of *Basilella marneffei* yeast phase protein extracted in step (1) as a template, the HIS tag is added by gene synthesis to obtain the encoding gene of HSP30.
[0041] Step (3): The coding gene obtained in step (2) is ligated into a template plasmid that has been methylated by Dpn1 digestion to obtain a recombinant expression plasmid;
[0042] Step (4): The recombinant expression plasmid from step (3) was introduced into competent cells, and after kanamycin resistance screening, it was cultured and fermented. The fermentation broth was purified by nickel column to obtain the yeast phase protein HSP30 of Bassula marneffei.
[0043] Preferably, the mutation primers in step (2) are HSP30-F (SEQ ID NO:2) and HSP30-R (SEQ ID NO:3).
[0044] This invention also provides a method for preparing a monoclonal antibody for detecting *Basilella marneffei*, comprising the following steps:
[0045] Step (1): Mice were immunized with purified *Basilus marneffei* yeast phase protein HSP30. After immunization, spleen cells from the mice were fused with myeloma cells SP20. Hybridoma cells were obtained by screening with HAT medium. Using the *Basilus marneffei* protein culture extract as an antigen, hybridoma cells that could produce *Basilus marneffei*-specific capture antibodies were screened by ELISA. After expansion culture, the cells were injected into the peritoneal cavity of mice to harvest monoclonal antibodies.
[0046] Step (2): After fusion, monoclonal antibodies are obtained. The monoclonal antibodies that are reactive to *Basilella marneffei* are amplified and cultured. Monoclonal antibodies are prepared from ascites fluid. The sensitivity and reactivity of the monoclonal antibodies are further tested, and the best antibody pair is matched using the checkerboard method.
[0047] This invention departs from the approach of targeting the mannosylprotein Mp1p protein of *Bambusa marneffei* cell wall as the target antigen. Instead, it takes a different approach by analyzing the thermal dimorphism characteristics of *Bambusa marneffei*. Based on the fact that *Bambusa marneffei* releases yeast phase proteins after infecting humans, it screens for the species-specific and highly antigenic yeast phase protein HSP30 as the target protein. The obtained *Bambusa marneffei* yeast phase protein HSP30 has high purity and high yield, and can be used for effective screening of monoclonal antibodies against *Bambusa marneffei*.
[0048] The monoclonal antibody against HSP30, a yeast phase protein of *Basilaria marneffei*, screened in this invention exhibits higher sensitivity and specificity for detecting *Basilaria marneffei* than detection kits using monoclonal antibodies targeting the mannose protein Mp1p. It is less prone to cross-reactivity with other *Mucor*, *Aspergillus*, yeasts, and *Cryptococcus*. Furthermore, because *Basilaria marneffei* transforms into its yeast phase and releases yeast phase proteins after infecting humans, this monoclonal antibody also avoids interference from environmental *Basilaria marneffei*, further improving detection specificity.
[0049] The Marneffei bacteria yeast phase protein HSP30 of the present invention and its application in the preparation of detection kits have the following effects:
[0050] This invention selects the antigen of *Bacillus marneffei* as a target, which has higher sensitivity and specificity than detecting the corresponding human antibodies, and can avoid infection during the window period.
[0051] The *Bassula marneffei* monoclonal antibodies TM-49D11 and TM50G5, constructed and screened using the above methods, can be used to construct *Bassula marneffei* antigen detection kits. These kits effectively capture yeast phase proteins released by *Bassula marneffei* in serum, offering greater convenience and sensitivity compared to capturing intact fungi. Compared to traditional fungal culture diagnostic methods, this approach is faster and simpler, significantly improving detection efficiency and sensitivity. The monoclonal antibody targeting the *Bassula marneffei* yeast phase protein HSP30 of this invention can bind to HSP30 released by *Bassula marneffei* after human infection, exhibiting good sensitivity and specificity. Clinical application trials show that its sensitivity for detecting *Bassula marneffei* infection reaches 89%, and its specificity reaches 100%. Attached Figure Description
[0052] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.
[0053] Figure 1 The thermodynamic duality of *Basilella marneffei* is shown;
[0054] Figure 2 A three-dimensional protein structure diagram of HSP30, a yeast phase protein from *Basilella marneffei*.
[0055] Figure 3 The image shows the predicted antigenic epitopes after bioinformatics simulation.
[0056] Figure 4 A recombinant plasmid of the yeast phase protein HSP30 from *Bassula marneffei*.
[0057] Figure 5 HSP30, a yeast phase protein expressed in Escherichia coli (Coomassie brilliant blue staining), is shown.
[0058] Figure 6 Standard curves after assembly of T monoclonal antibody TM-50G1 and Biotin-TM-49D11 are shown.
[0059] Figure 7 The results show the sensitivity and specificity of using monoclonal antibodies TM-50G1 and Biotin-TM-49D11 against the HSP30 phase protein of Bassula marneffei yeast in an ELISA double-sandwich antibody system.
[0060] Figure 8 The flowchart shows the process of constructing a fluorescent immunochromatographic kit using HSP30 monoclonal antibody-labeled fluorescent composite nanoprobes for the detection of *Basilaria marneffei* yeast.
[0061] Figure 9 To demonstrate the specificity of the disclosed *Blue-headed Marneffei* immunochromatographic kit, 1 represents *Penicillium*, 2 represents *Aspergillus nidus*, 3 represents *Aspergillus flavus*, 4 represents *Aspergillus polyploid*, 5 represents *Candida albicans*, 6 represents *Candida tropicalis*, 7 represents *Candida glabrata*, 8 represents *Candida auris*, 9 represents *Cryptococcus*, 10 represents *Staphylococcus aureus*, 11 represents *Streptococcus pneumoniae*, 12 represents *Cephalosporinus*, 13 represents *Staphylococcus epidermidis*, 14 represents blank control, and 15 represents *Blue-headed Marneffei*.
[0062] Figure 10 This demonstrates the sensitivity verification of the Marneffei Basket Immunochromatographic Kit disclosed herein. Detailed Implementation
[0063] This invention discloses a *Basilaria marneffei* yeast phase protein HSP30 and its application in the preparation of a *Basilaria marneffei* detection kit. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0064] The heat shock proteins (HSPs) described in this invention are highly conserved stress proteins produced by organisms (or cultured cells) under adverse environmental conditions, and are ubiquitous throughout the biological world. The heat shock response (HSR) is a rapid and transient physiological regulation of cellular metabolism. During this period, the expression of some normal genes within the cell is suppressed, while a specific group of genes is activated and expressed. This specific group of genes is called heat shock genes, and the resulting proteins are called heat shock proteins. Heat shock protein 30 (HSP30) is one type of small-molecule heat shock protein.
[0065] By performing homology analysis on the amino acid sequences of the target proteins and comparing the functions of identified orthologs, this application predicted the functions of yeast phase proteins from *Bassula marneffei*. The results showed that these proteins can be classified into several categories: Ran GTPase spi1, succinyl-CoA synthase α subunit, heat shock protein 30, NAD-dependent formate dehydrogenase and putative protein HSP90 ATPase activator, heat shock protein 70, heat shock protein 90 ATPase, and catalase-peroxidase. These proteins share homology with proteins currently known to play roles in energy production and other cellular metabolic pathways (such as NAD-dependent formate dehydrogenase, ATP synthase β subunit, adenylate kinase, phosphoglycerate kinase, and succinyl-CoA synthase subunit). Further analysis of protein sequence homology revealed that the yeast phase protein heat shock protein 30 (TM.HSP30), exhibiting the highest species specificity, functions as a "molecular chaperone." When an organism is exposed to high temperatures, it is thermally stimulated to synthesize this protein to protect itself, aid in the physiological folding and unfolding of newly synthesized polypeptide bonds, and correct misfolded polypeptide chains, thus restoring cellular function and structure. Therefore, yeast phase protein HSP30 plays a similarly important role in the phase transition and pathogenicity of *Basilaria marneffei*, and could serve as a novel diagnostic molecular marker for *Basilaria marneffei* detection. Large-scale preparation of *Basilaria marneffei* yeast phase protein HSP30 can be used to screen for *Basilaria marneffei*-specific monoclonal antibodies for rapid serological detection of *Basilaria marneffei*.
[0066] The analytical yield of HSP30, a yeast phase protein from *Basilaria marneffei*, is approximately 30 kDa. Comparative analysis with the NCBI database revealed that HSP30 exhibits stronger species specificity compared to other *Basilaria marneffei* yeast phase proteins. A three-dimensional model of HSP30 was constructed using bioinformatics. Figure 3 Its surface has 6 B-cell epitopes, resulting in better antigenicity. This makes it more advantageous for screening monoclonal antibodies specific to *Basilella marneffei*.
[0067] 1. This invention also provides a method for preparing HSP30, a yeast phase protein of *Basilella marneffei*, comprising the following steps:
[0068] In some embodiments of the present invention, the preparation method of *Basilella marneffei* yeast phase protein HSP30 specifically includes:
[0069] (1) The original sequence of the yeast phase protein HSP30 of *Basilaria marneffei* was downloaded from the NCBI database: ABF82266(gi|106647229). Based on database comparison and protein conformation prediction, the gene fragment with the strongest species specificity and immunogenicity was extracted. According to the amino acid sequence, the functionally identical amino acid sequence obtained by substitution, deletion, or / and addition of one or more amino acids was preferred. The nucleotide sequence encoding the yeast phase protein HSP30 of *Basilaria marneffei* was synthesized and optimized as the plasmid gene sequence, as shown in SEQ ID NO:1. Using this as a template, site-directed mutagenesis was used, and the mutation primers were used as specific amplification primers for PCR amplification to obtain the encoding gene of the yeast phase protein HSP30 of *Basilaria marneffei*. The primers were HSP30-F (SEQ ID NO:2) and HSP30-R (SEQ ID NO:3).
[0070] (2) The coding gene obtained in step (1) is ligated into a template plasmid that has been methylated by Dpn1 digestion to obtain a recombinant expression plasmid;
[0071] (3) The recombinant expression plasmid from step (2) was introduced into BL21 and T7E competent cells. After kanamycin resistance screening, the cells were cultured and fermented. The fermentation broth was purified by nickel column to obtain the yeast phase protein HSP30 of Bassula marneffei. The purified protein sequence is SEQ ID NO:4.
[0072] 2. This invention also provides a method for preparing a monoclonal antibody against the yeast phase protein HSP30 of *Basilella marneffei*.
[0073] (1) Purified *Bambusa marneffei* yeast phase protein HSP30 was used as the target antigen to immunize mice. After four booster immunizations, mouse serum was collected for indirect ELISA detection. *Bambusa marneffei* fungal protein extract was used as the coating antigen. The detection effect of *Bambusa marneffei* in the baseline serum of mice before immunization and the serum of mice after immunization was compared to determine the effectiveness of screening *Bambusa marneffei*-specific monoclonal antibodies by immunizing mice with the target antigen. Mice with good sensitivity and specificity were selected for booster immunization. Hybridoma cells were obtained using cell fusion technology. *Bambusa marneffei* fungal protein extract was used again as the coating antigen to screen monoclonal antibody strains with good detection sensitivity and specificity. These strains were then cultured in a large scale and injected into mice to collect ascites fluid. Specific *Bambusa marneffei* monoclonal antibodies were separated and purified using affinity chromatography.
[0074] (2) A total of 40 monoclonal antibodies were obtained after fusion, of which 12 monoclonal antibody supernatants were reactive to *Basilus marneffei*. These were then amplified and cultured in ascites fluid to prepare more monoclonal antibodies. Further testing of the sensitivity and reactivity of these 12 monoclonal antibodies was conducted, and the optimal antibody pair was determined using a checkerboard method. Ultimately, it was confirmed that the assembled Antibody 49-D11-G8 and Antibody 50-G5-E1 antibodies showed the best detection effect against *Basilus marneffei*.
[0075] Antibody 49-D11-G8-VH amino acid sequence:
[0076]
[0077] Antibody 49-D11-G8-VL amino acid sequence:
[0078]
[0079] Antibody 50-G5-E1-VH amino acid sequence:
[0080]
[0081] Antibody 50-G5-E1-VL amino acid sequence:
[0082]
[0083] The CDR sequences are as follows:
[0084] Antibody 49-D11-G8-VH:
[0085] CDR1:GASLTDAG(SEQ ID NO:9);
[0086] CDR2: ISGAGAT (SEQ ID NO: 10); CDR3: AHGTWQGY (SEQ ID NO: 11).
[0087] Antibody 49-D11-G8-VL:
[0088] CDR1: QTVTTSSYTY(SEQ ID NO:12);
[0089] CDR2: YATS (SEQ ID NO:13);
[0090] CDR3: QHSWASQWT (SEQ ID NO:14).
[0091] Antibody 50-G5-E1-VH:
[0092] CDR1: GYSFTSNYA (SEQ ID NO:15);
[0093] CDR2: INQYTGEP (SEQ ID NO:16);
[0094] CDR3: ASRGSASTGAVDY (SEQ ID NO: 17). Antibody 50-G5-E1-VL:
[0095] CDR1: QDHKTY (SEQ ID NO:18);
[0096] CDR2: SATA (SEQ ID NO:19);
[0097] CDR3: LAHAESPWG (SEQ ID NO:20).
[0098] Antibody 49-D11-G8-VH nucleotide sequence:
[0099]
[0100] Antibody 49-D11-G8-VL nucleotide sequence:
[0101]
[0102] Antibody 50-G5-E1-VH nucleotide sequence:
[0103]
[0104] Antibody 50-G5-E1-VL nucleotide sequence:
[0105]
[0106] 3. This invention also provides a method for detecting HSP30, a yeast phase protein of *Bacillus marneffei*, using the above-mentioned antibody composition as a double-antibody sandwich ELISA (enzyme-linked immunosorbent assay). The two antibodies in the antibody composition serve as the capture antibody and detection antibody in the double-antibody sandwich ELISA, respectively. The detection antibody may also carry a detectable label such as a biotin tag. In some embodiments of this invention, the detection method is a double-sandwich ELISA method, which has advantages such as simple operation, low cost, high sensitivity, high specificity, high accuracy, and high precision, and can be used for accurate and rapid detection of *Bacillus marneffei* infection.
[0107] 4. The present invention also provides a labeling complex comprising the above-mentioned monoclonal antibody against the yeast phase protein HSP30 of *Basilella marneffei* and a label, wherein the label includes, but is not limited to, any one of the following: biotin, colloidal gold, or fluorescent composite nanoprobe.
[0108] 5. The present invention also provides a test strip or test card, wherein the raw materials of the test strip or test card include any one or a combination of the following: the above-mentioned monoclonal antibody against the yeast phase protein HSP30 of *Basilella marneffei*, the above-mentioned labeled complex, and goat anti-mouse monoclonal antibody.
[0109] 6. This invention also provides the application of composite nanoprobes labeled with monoclonal antibodies TM-50G1 and TM-49D11 against the yeast phase protein HSP30 of *Basilaria marneffei* in the preparation of products for detecting *Basilaria marneffei*.
[0110] 7. The present invention provides a fluorescent immunochromatographic kit for detecting *Basilaria marneffei*, the kit comprising the *Basilaria marneffei* yeast phase protein HSP30 monoclonal antibody as described in the first aspect.
[0111] This invention utilizes composite nanomaterials and a monoclonal antibody against *Basilaria marneffei* yeast phase protein HSP30 in immunochromatography (LFA). In one specific embodiment, the *Basilaria marneffei* is present. The kit further includes an immunochromatographic test strip comprising a sample pad, a chromatography membrane, and an absorbent pad connected sequentially. The chromatography membrane has a detection line and a control line. The detection line is loaded with *Basilaria marneffei* yeast phase protein HSP30 monoclonal antibody TM-50G1; a reconstituted fluorescent nanomaterial is used to label *Basilaria marneffei* yeast phase protein HSP30 monoclonal antibody TM-49D11; and the control line is loaded with goat anti-mouse IgG. This method enables rapid enrichment and quantitative analysis of *Basilaria marneffei* in samples, especially rapid enrichment and quantitative analysis of *Basilaria marneffei* yeast phase protein HSP30. It achieves magnetic enrichment effect and signal amplification, eliminates matrix interference in practical applications, and further improves detection sensitivity. It has great potential for high-sensitivity and on-site monitoring of *Basilaria marneffei* infection.
[0112] The present invention will be further illustrated below with reference to the embodiments.
[0113] Example 1: Screening for specific monoclonal antibodies against yeast phase proteins of *Bassula marneffei*
[0114] (1) Identify the target protein to be used as a diagnostic marker for *Basilella marneffei* infection.
[0115] The yeast phase protein sequences of *Basilaria marneffei* were compared with the NCBI protein database using the BLAST homology search tool to remove protein sequences highly homologous to other bacteria and fungi. Finally, proteins with strong species specificity and functional roles were identified as the target antigen proteins for this study, and *Basilaria marneffei* yeast phase protein HSP30 was ultimately determined as the target protein.
[0116] (2) Expression of HSP30, a yeast phase protein of Bassula marneffei, using genetic engineering technology
[0117] By comparing and analyzing the amino acid sequence of HSP30, a yeast phase protein from *Basilella marneffei*, the gene sequence was optimized, and the target protein gene fragment was synthesized.
[0118]
[0119] Using the plasmid containing the gene encoding the *Bambusa marneffei* yeast phase protein HSP30 as a template, site-directed mutagenesis was employed, and the mutagenic primers were used as specific amplification primers for PCR amplification to obtain the gene encoding the *Bambusa marneffei* yeast phase protein HSP30. The primer sequences are as follows:
[0120] HSP30-F: TGTTCCAGGGGCCCggatccAGCCTTTTCC (SEQ ID NO: 2);
[0121] HSP30-R:TCGAGTGCGGCCGCAAGCTTTTATTCAATG (SEQ ID NO: 3).
[0122] The obtained coding gene was ligated into the Dpn1-digested and methylated template plasmid pET-28b-3C (EMDBiosciences, Novagen). A recombinant expression plasmid was obtained by using the BamHI / HindIII restriction site. This plasmid was then introduced into BL21 and T7E competent cells. After kanamycin resistance selection, the cells were cultured and fermented. The fermentation broth was purified by nickel column chromatography to obtain the *Basilella marneffei* yeast phase protein HSP30. Figure 5 The purified protein sequence is as follows:
[0123]
[0124] The residues 1 to 11 are his tags, used for protein purification by nickel column, and the residues 12 to 23 are cleavage sites.
[0125] (3) Mouse immunization and identification of HSP30, a yeast phase protein from Bassula marneffei.
[0126] Using the above-mentioned *Bambusa marneffei* yeast phase protein HSP30 as the target antigen, mice were immunized with different concentration gradients. After four booster immunizations, mouse serum was collected for indirect ELISA detection. *Bambusa marneffei* fungal protein extract was used as the coating antigen. The detection effect of *Bambusa marneffei* in the baseline serum of mice before immunization and the serum of mice after immunization was compared to determine the effectiveness of *Bambusa marneffei*-specific monoclonal antibodies in screening mice immunized with *Bambusa marneffei* yeast phase protein HSP30. Mice with good sensitivity and specificity were selected for booster immunization.
[0127] (4) Fusion, screening and identification of specific monoclonal antibodies
[0128] a. Cell fusion and screening of monoclonal antibodies
[0129] ① Mouse spleen cells and SP2 / 0 myeloma cells were fused using traditional cell fusion techniques. Feeder cells were prepared in advance and seeded into 96-well plates on the day of fusion. Spleens were removed from immunized mice using aseptic surgery, and spleen cells were gently ground and filtered to obtain spleen cells. These cells were then fused with SP2 / 0 myeloma cells, which had been resuscitated and cultured to a healthy state one week prior, using PEG. The cells were resuspended in HAT medium and seeded into prepared 96-well plates containing feeder cells for culture. On the sixth day after fusion, the cells were observed and half-filled with medium was replaced. On the eighth day, the medium was completely replaced with HT medium. Simultaneously, the removed medium was used for ELISA testing to determine the antibody titer in each well, and positive clones were selected for scale-up culture.
[0130] ② Using the protein extract of *Basilella marneffei* as the target antigen, a cell line capable of stably secreting monoclonal antibodies was established through verification by ELISA and multiple subclonal screenings.
[0131] ③ Using protein extracts from various fungi such as *Basilella marneffei*, *Aspergillus*, *Mucor*, *Cryptococcus*, and *Candida* as antigens, the cross-reactivity of each monoclonal antibody strain was detected by ELISA.
[0132] ④ Select highly specific and highly sensitive monoclonal antibody cell lines for ascites preparation and antibody purification.
[0133] b. Performance evaluation of the selected *Basilella marneffei* monoclonal antibodies
[0134] The sensitivity, specificity, and antibody affinity of the purified monoclonal antibody were determined by indirect ELISA using bacterial extracts and protein leaching solutions from *Basilella marneffei*, *Aspergillus*, *Mucor*, *Cryptococcus*, and *Candida*.
[0135] Experimental results:
[0136] 1. The serum titer of mice immunized with Bacteroides marneffei yeast phase protein HSP30 is shown in Table 2.
[0137] Table 1
[0138]
[0139]
[0140] 2. ELISA results for the detection of *Basilus marneffei* in the culture supernatant of the fusion monoclonal antibody.
[0141] After fusion, a total of 40 monoclonal antibodies were successfully screened and established. The yeast phase protein of *Basilella marneffei* was detected by cell culture supernatant. Among them, 12 monoclonal antibodies with good reactivity to the protein were selected for cell line amplification culture and ascites preparation. The subtype detection results of these 12 monoclonal antibodies after purification are shown in Table 2.
[0142] Table 2
[0143] Antibody clone number Antibody subtypes 10-C6-H1 IgG 1 10-H6-B6 IgG 1 1-E6-B1 IgG 2b 10-E2-H3 IgG 2b 17-E11-C12 IgG 2b 3-F1-B3 IgG 2b 8-D3-C1 IgG 2b 17-C8-A11 IgG 2b 35-D5-D2 IgG 2a 49-D11-G8 IgG 2b 50-G5-E1 IgG 1 52-C1-C5 IgG 2b
[0144] 4. ELISA results of antibody titers against HSP30 for 12 monoclonal antibodies
[0145] The antibody titer of monoclonal antibodies against HSP30 was detected using an indirect ELISA. The coating antigen was HSP30 protein, the coating concentration was 5 μg / ml, the volume was 100 μL / well, and the coating dilution buffer was CBS, pH 9.6. The secondary antibody used was Peroxidase AffiniPure Goat Anti-Mouse IgG (FC). The blank control was PBS.
[0146] Antibody titer: The highest dilution ratio when the detected value / blank control is >= 3.
[0147] The results are shown in Table 3.
[0148] Table 3
[0149]
[0150] 5. ELISA results for detecting the titer of monoclonal antibodies against *Basilella marneffei* cells.
[0151] The antibody titer against *Basilaria marneffei* bacteria was determined using an indirect ELISA. The coating antigen was 1 μg of *Basilaria marneffei* culture extract, the antibody concentration was 5 μg / ml, the volume was 100 μL / well, and the coating dilution buffer was CBS, pH 9.6. The secondary antibody was Peroxidase Affini Pure Goat Anti-Mouse IgG (FC). PBS was used as the blank control.
[0152] Antibody titer: The highest dilution ratio when the detected value / blank control is >= 3.
[0153] The results are shown in Table 4.
[0154] Table 4
[0155] Cloned ID 1:2K 1:4K 1:8K 1:16K 1:32K 1:64K 1:128K blank 1-E6-B1 0.17 0.08 0.09 0.07 0.05 0.05 0.05 0.08 10-E2-H3 0.07 0.05 0.06 0.06 0.06 0.06 0.04 0.06 17-E11-C12 0.29 0.17 0.13 0.08 0.07 0.05 0.04 0.06 3-F1-B3 1.75 1.83 1.70 1.53 1.23 1.00 0.71 0.06 8-D3-C1 3.82 2.86 2.04 1.31 0.83 0.48 0.27 0.06 17-C8-A11 1.80 1.65 1.51 1.30 1.07 0.80 0.56 0.07 35-D5-D2 0.31 0.24 0.20 0.15 0.11 0.09 0.06 0.06 49-D11-G8 2.73 2.57 2.25 1.79 1.53 0.95 0.60 0.06 50-G5-E1 0.77 0.43 0.31 0.24 0.18 0.12 0.09 0.06 52-C1-C5 1.15 0.99 0.97 0.85 0.74 0.55 0.37 0.12 10-C6-H1 0.10 0.07 0.06 0.07 0.06 0.06 0.05 0.07 10-H6-B6 0.12 0.12 0.12 0.12 0.11 0.11 0.11 0.11
[0156] The ELISA results of 12 monoclonal antibodies against *Basilella marneffei* showed that 4 of them had good reactivity. These antibodies with good reactivity were paired up using a checkerboard method to find suitable antibody pairs.
[0157] Example 2: Establishment and optimization of a double-sandwich enzyme-linked immunosorbent assay for *Basilella marneffei*
[0158] (1) Diagnostic antibody pairing of monoclonal antibodies against Basiliformis marneffei
[0159] A portion of the *Basilaria marneffei* antibody obtained in Example 1 was biotin-labeled, and the other portion was used as a capture antibody to coat an ELISA plate. Streptavidin-HRP was used as the secondary antibody for detection. A checkerboard titration method was employed for sample loading, and pairwise pairing of antibodies from each strain was performed. *Basilaria marneffei* protein extract was used as the target antigen for testing to determine the optimal pairing combination of coating antibody and capture antibody, the optimal dilution of each antibody, and the optimal working concentration of the enzyme-labeled antibody. Steps:
[0160] 1. Coating: Antibody, 2 μg / mL, 100 μL / well, 37℃, 2h; sample loading positions are shown in Table 5;
[0161] Table 5
[0162] Plate-1 1 2 3 4 5 6 7 A 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 B 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 C 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 D 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 E 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 F 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 G 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5
[0163] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37℃, 1.5 h;
[0164] 3. Washing: PBST, 300 μL / well, 3 times;
[0165] 4. Add antigen, 0.5 μg / mL, 100 μL / well, 37℃, 1 h; the sample addition positions are shown in Table 6;
[0166] Table 6
[0167]
[0168] 5. Washing: PBST, 300 μL / well, 3 times;
[0169] 6. Biotin-conjugated antibody, 0.3 μg / mL, 100 μL / well, 37℃, 1 h; sample loading positions are shown in Table 7;
[0170] Table 7
[0171] Plate-1 1 2 3 4 5 6 7 A Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 Biotin-3 B Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 Biotin-8 C Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 Biotin-17 D Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 Biotin-35 E Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 Biotin-49 F Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 Biotin-50 G Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52 Biotin-52
[0172] 7. Washing: PBST, 300 μL / well, 3 times;
[0173] 8. Streptavidin-HRP, 100 μL / well, 37℃, 30 min;
[0174] 9. Washing: PBST, 300 μL / well, 5 times;
[0175] 10. TMB substrate solution, 100 μL / well, 37 °C, 5 min;
[0176] 11. Termination: 2M HCl, 50μL / well;
[0177] 12. Reading: OD 450 -OD 620 .
[0178] 13: Experimental results: as shown in Table 8.
[0179] Table 8
[0180] Plate-1 1 2 3 4 5 6 7 HSP30 3-F1-B3 8-D3-C1 17-C8-A11 35-D5-D2 49-D11-G8 50-G5-E1 52-C1-C5 Biotin-3 1.18 2.92 4.28 4.32 0.58 4.66 4.28 Biotin-8 4.46 3.43 3.66 4.01 3.69 3.98 3.86 Biotin-17 4.11 3.80 2.73 4.56 4.58 4.48 4.51 Biotin-35 5.04 3.85 4.16 3.66 4.30 4.13 3.98 Biotin-49 1.23 2.90 4.04 4.65 0.75 4.69 4.38 Biotin-50 4.57 3.68 4.13 3.94 4.46 4.23 4.00 Biotin-52 4.00 3.95 3.91 3.93 4.50 4.40 4.24
[0181] (2) Determine the detection sensitivity of the optimal antibody pair after assembly.
[0182] Based on the above steps (1), the most suitable antibody pairs 50-G5-E1 and biotin-labeled 49-D11-G8 were determined and named TM-50G5 and Biotin-TM49D11, respectively.
[0183] 1. Coating: TM-50G5, 2μg / mL, 100μL / well, 37℃, 2h;
[0184] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37℃, 1.5 h;
[0185] 3. Washing: PBST, 300 μL / well, 3 times;
[0186] 4. Primary antibody: concentration from 2 ng / mL to 0.03125 ng / mL, dilution ratio from 1:16 to 1:1024, 100 μL / well, 37℃, 1 h; the sample addition location and dilution factor are shown in Table 8;
[0187] Table 9
[0188]
[0189] 5. Washing: PBST, 300 μL / well, 3 times;
[0190] 6. Biotin-conjugated antibody Biotin-TM49D11, 0.2 μg / mL, 100 μL / well, 37℃, 1 h;
[0191] 7. Washing: PBST, 300 μL / well, 5 times;
[0192] 8. Streptavidin-HRP, 100 μL / well, 37℃, 30 min;
[0193] 9. Washing: PBST, 300 μL / well, 5 times;
[0194] 10. TMB substrate solution, 100 μL / well, 37 °C, 5 min;
[0195] 11. Termination: 2M HCl, 50μL / well;
[0196] 12. Reading: OD 450 -OD 620 .
[0197] 13: The detection performance results of the assembled TM-50G5 and Biotin-TM49D11 antibodies are shown in Table 10, and the standard curve is shown in... Figure 6 As shown.
[0198] Table 10
[0199]
[0200] (3) Determine the detection specificity of the optimal antibody pair after assembly.
[0201] We selected *Bassula marneffei*, normal human serum, and other common fungi and bacteria dilutions, including *Candida albicans*, *Aspergillus flavus*, *Candida auris*, *Aspergillus nidus*, *Aspergillus polyploid*, *Penicillium*, *Cryptococcus*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, *Staphylococcus epidermidis*, *Streptococcus viridans*, and *Pseudomonas aeruginosa* protein extracts, and used the constructed *Bassula marneffei* ELISA double-sandwich method to detect them. We then analyzed its clinical sample detection capability and evaluated its application conditions.
[0202] step:
[0203] 1. Coating: TM-50G5, 2μg / mL, 100μL / well, 37℃, 2h;
[0204] 2. Blocking: 3% BSA-PBS, 300 μL / well, 37℃, 1.5 h;
[0205] 3. Washing: PBST, 300 μL / well, 3 times;
[0206] 4. Primary antibody antigen: Bassilago farfara, normal human serum and other common fungi and bacteria dilutions (Candida albicans, Aspergillus flavus, Candida auris, Aspergillus nidus, Aspergillus polyploid, Penicillium, Cryptococcus, Streptococcus pneumoniae, Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus viridans, Pseudomonas aeruginosa), the sampling sites and dilution factors are shown in Table 11;
[0207] Table 11
[0208]
[0209]
[0210] 5. Washing: PBST, 300 μL / well, 3 times;
[0211] 6. Biotin-conjugated antibody Biotin-TM49D11, 0.2 μg / mL, 100 μL / well, 37℃, 1 h;
[0212] 7. Washing: PBST, 300 μL / well, 5 times;
[0213] 8. Streptavidin-HRP, 100 μL / well, 37℃, 30 min;
[0214] 9. Washing: PBST, 300 μL / well, 5 times;
[0215] 10. TMB substrate solution, 100 μL / well, 37 °C, 5 min;
[0216] 11. Termination: 2M HCl, 50μL / well;
[0217] 12. Reading: OD 450 -OD 620 The positive or negative status of a sample is determined by combining the Cutoff method.
[0218] 13. Test results are available. Figure 7 Table 12.
[0219] Table 12
[0220] Plate-1 1 2 3 4 5 6 A 2.185 0.009 0.007 0.028 0.005 0.006 B 2.163 0.008 0.007 0.025 0.007 0.006 C 0.015 0.008 0.006 0.006 0.0012 0.007 D 0.017 0.009 0.007 0.008 0.01 0.009 E 0.01 0.005 2.884 1.333 0.013 0.009 F 0.013 0.006 2.347 1.376 0.017 0.007 G 0.008 0.007 0.009 0.007 0.006 0.005 H 0.009 0.009 0.007 0.006 0.007 0.008
[0221] ELISA specificity assays showed that the monoclonal antibodies in this group exhibited no cross-reactivity against *Candida albicans*, *Aspergillus flavus*, *Candida auris*, *Aspergillus nidus*, *Aspergillus polyploid*, *Penicillium*, *Cryptococcus*, *Streptococcus pneumoniae*, *Staphylococcus aureus*, *Staphylococcus epidermidis*, *Streptococcus viridans*, and *Pseudomonas aeruginosa*, but showed good reactivity against *Paspalum distichum*. Clinical sample detection capability tests indicated that the *Paspalum distichum* monoclonal antibodies TM-50D5 and TM-49G11 possessed excellent sensitivity and specificity for detecting *Paspalum distichum*.
[0222] Example 3: Marneffei Basket Fluorescent Immunochromatographic Kit
[0223] (1) A fluorescent immunochromatographic kit was constructed using HSP30 monoclonal antibody-labeled fluorescent composite nanoprobes from *Basilella marneffei* yeast.
[0224] 1. The selected monoclonal antibody TM-49D11 of *Basilella marneffei* is labeled with fluorescent markers at different concentrations. The amount of specific antibody added is greater than 0 and not greater than 1 mg per 1 g of composite fluorescent nanospheres, preferably 0.001-0.02 mg; the specific antibody is *Basilella marneffei* monoclonal antibody TM-49D11.
[0225] 2. Anti-Marneffei monoclonal antibody TM-50G5 and goat anti-mouse IgG were sprayed onto the surface of a nitrocellulose membrane, respectively; then the modified NC membrane was placed in a constant temperature drying oven (37℃) to obtain the nitrocellulose membrane in the immunochromatographic test strip. The concentration of anti-Marneffei monoclonal antibody TM-50G5 was greater than 0 and not greater than 1 mg / mL, preferably 0.8 mg / mL; the concentration of goat anti-mouse IgG was greater than 0 and not greater than 3 mg / mL, preferably 1 mg / mL.
[0226] 3. Assembly: Attach the nitrocellulose membrane, absorbent paper, conjugate pad, and sample pad to a PVC backing board, cut them into 3mm wide strips, and store them in a dry place. The backing board serves as the backing card for the immunochromatographic test strip; the preferred material for the backing board is PVC. The sample pad is used to load the sample solution to be tested. The absorbent pad provides capillary force. The chromatographic membrane can be a nitrocellulose membrane (NC membrane).
[0227] 4. The loading buffer consists of: 100% 10 mmol / L PBS buffer, 1% Tween 20, and 3% fetal bovine serum (FBS).
[0228] 5. The sample to be tested is co-incubated with the composite nanoprobe. Bacteria are then magnetically enriched and recovered using the composite nanoprobe, resuspended in the sample loading buffer, and loaded onto the sample pad of the immunochromatographic test strip. The sample is then brought into contact with the detection line on the immunochromatographic test strip for chromatographic reaction. After the chromatographic reaction, the fluorescence signal is read using an immunofluorescence analyzer. The effect is shown in the figure below. Figure 8 As shown.
[0229] (2) Specificity verification
[0230] A variety of common pathogenic bacteria were selected, including Penicillium, Aspergillus nidulans, Aspergillus flavus, Aspergillus polyploid, Candida albicans, Candida tropicalis, Candida glabrata, Candida auris, Cryptococcus, Staphylococcus aureus, Streptococcus pneumoniae, Staphylococcus cephalosporin, and Staphylococcus epidermidis (10). 5 The specificity of Mag@QDs-TM49D11 was tested using cells / mL as a bacterial interfering agent. Results are as follows: Figure 9 As shown in the photographs and fluorescence signals on the test lines of the immunochromatographic test strip, Mag@QDs-TM49D11 clearly demonstrates good selectivity for the target bacteria. Therefore, the specific bacterial antibody applied to the test lines of the immunochromatographic test strip is sufficient to ensure the high specificity of the detection platform.
[0231] (3) Sensitivity verification
[0232] Validation of Mag@QDs-TM49D11 in immunochromatographic assays for detecting different concentrations of *Basilella marneffei* (0-10 μL). 5 The performance (cells / mL) was shown in the figure. Figure 10 The vLOD of Mag@QDs-TM49D11 in fluorescence mode was 100 cells / mL. These results indicate that the immunochromatographic assay containing Mag@QDs-TM49D11 exhibits high analytical performance against the target bacterium *Basilella marneffei*, with a wide dynamic range (5 orders of magnitude).
[0233] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An antibody against HSP30, a yeast phase protein of *Bassula marneffei*, characterized in that: (I) The sequence of the heavy chain variable region is SEQ ID NO: 5, and the sequence of the light chain variable region is SEQ ID NO: 6; or (II) The sequence of the heavy chain variable region is SEQ ID NO: 7, and the sequence of the light chain variable region is SEQ ID NO:
8.
2. An antibody composition, characterized in that, Includes the antibody as described in claim 1.
3. A nucleic acid molecule encoding the antibody of claim 1.
4. Any of the following applications in the preparation of products containing *Marneffei*: (i) The antibody as described in claim 1; (ii) The antibody composition as described in claim 2; (iii) The nucleic acid molecule as described in claim 3; The products include: (a) An enzyme-linked immunosorbent assay (ELISA) kit for detecting HSP30, a yeast phase protein of *Basilella marneffei*; or (b) An immunochromatographic assay kit for detecting HSP30, a yeast phase protein of *Basilella marneffei*; or (c) Fluorescent probe reagent for in vitro detection of HSP30 phase protein of Bassula marneffei yeast.
5. The product, characterized in that, include: (i) The antibody as described in claim 1; or (ii) The antibody composition as described in claim 2; The products include: (a) An enzyme-linked immunosorbent assay (ELISA) kit for detecting HSP30, a yeast phase protein of *Basilella marneffei*; or (b) An immunochromatographic assay kit for detecting HSP30, a yeast phase protein of *Basilella marneffei*; or (c) Fluorescent probe reagent for in vitro detection of HSP30 phase protein of Bassula marneffei yeast.
6. A method for detecting *Basilella marneffei* for non-diagnostic and non-therapeutic purposes, characterized in that, Based on any of the following tests: (i) The antibody as described in claim 1; (ii) The antibody composition as described in claim 2.