Nucleotide analogs and their applications in sequencing

Abstract

The present invention discloses nucleotide analogs and their application in sequencing. In the first aspect of the present application, a compound having a structural formula as shown in formula (I) is provided. The compound introduces an orthogonal cleavage group on the nucleotide, so that when it is incorporated into a primer as a replacement for a reversible terminator for extension, the orthogonal cleavage group as a protecting group can be quickly removed through an inverse electron demand Diels-Alder (IEDDA) reaction, thereby exposing 3′-OH for the next round of biochemical reactions, greatly shortening the reaction time in the sequencing process, reducing the phasing value, and ultimately reducing the error rate in the sequencing process and improving the accuracy of sequencing.

Description

Technical Field

[0001] The present application relates to the field of nucleotide technology, and in particular to nucleotide analogs and their application in sequencing. Background Art

[0002] Next-generation sequencing (NGS), also known as high-throughput sequencing, is a DNA sequencing technology developed based on PCR and gene chips. The second-generation sequencing pioneered the introduction of reversible terminators, thereby realizing sequencing by synthesis. Its basic principle is to determine the sequence of DNA by capturing the special markers (generally fluorescent molecular markers) carried by the newly added bases during DNA replication. In order to detect only one base per cycle, the base addition process requires the use of nucleotide analogs carrying a blocking group as reversible terminators, so as to react with the target nucleic acid and DNA polymerase for biochemical reactions. The target nucleic acid is used as a template to extend the primer to incorporate the nucleotide analog. The nucleotide analog with the blocking group will terminate the next extension of the primer until the deblocking reagent is added, and the next biochemical reaction can be carried out. This cycle is repeated many times, and the special markers carried by it are detected in each cycle, and the sequence of the target nucleic acid is analyzed. For example, the nucleotide analog obtained by introducing an azidomethyl group as a blocking group to protect the 3′-OH of the nucleotide will block the incorporation of the next base during the extension process of the target nucleic acid. After optical detection and analysis, a trivalent phosphorus reagent is added to remove the azidomethyl group, and then the next round of biochemical reaction is carried out. This cycle is repeated many times, and detection is performed in each cycle to obtain the nucleic acid sequence.

[0003] In the process of second-generation sequencing, phasing refers to the process of sequencing while synthesizing, in which part of the DNA chain cannot be completely incorporated into the cluster by the polymerase in the next round of sequencing cycle due to incomplete removal of the 3′ terminator and the fluorophore. Pre-phasing, on the other hand, refers to the incorporation of nucleotide analogs in the absence of an effective 3′ terminator, and the incorporation process is performed in advance for one cycle. Taking the fluorescently labeled nucleotides protected by azidomethyl as an example, sodium azide is required during the synthesis of the azide group, and sodium azide is explosive. At the same time, as an organic azide compound, its thermal stability is poor at the sequencing biochemical reaction temperature, and the azide methyl group is easily detached to expose the 3′-OH, causing the next round of biochemical reaction in sequencing, resulting in a high Pre-phasing value. In addition, organic azide compounds are easily affected by reducing agents during storage and transfer; and the removal of the azide methyl group requires the use of reducing agents such as easily oxidized trivalent phosphorus reagents. In addition, when using excision reagents, the excision time and excision efficiency affect the next biochemical reaction. Incomplete excision will lead to too high a phasing value. Excision reaction time is too long and the efficiency is too low, which will affect the sequencing biochemical reaction time and increase sequencing costs. Therefore, it is necessary to provide a nucleotide analog for sequencing, which can reduce the reaction time and phasing value in the sequencing process, and ultimately reduce the error rate and improve the accuracy. Summary of the invention

[0004] The present application aims to solve at least one of the technical problems existing in the prior art. To this end, the present application proposes a nucleotide analog and its application in sequencing, which can be quickly removed as a replacement for the reversible terminator in sequencing to expose 3′-OH, reduce the reaction time in the sequencing process, reduce the phasing value in the sequencing process, and ultimately reduce the error rate and improve the accuracy.

[0005] In the first aspect of the present application, a nucleotide analogue having a structural formula as shown in formula (I) is provided:

[0006]

[0007] Among them, R 1 including an optional orthogonal breaking group;

[0008] R 2 Includes bases;

[0009] R 3 including any of a hydroxyl group and a phosphate group;

[0010] R 4 Including hydrogen, OR 5 Any of the R 5 is an optional orthogonal breaking group;

[0011] R 1 , R 2 , R 3 , R 4 At least one of the proteins is also attached to a detectable label.

[0012] The compounds according to the embodiments of the present application have at least the following beneficial effects:

[0013] The compounds provided in the examples of the present application introduce an orthogonal cleavage group on the nucleotide. When such a compound is incorporated into a primer as a replacement for a reversible terminator for extension, the orthogonal cleavage group as a protecting group can be quickly removed through an inverse electron demand Diels-Alder (IEDDA) reaction, thereby exposing 3′-OH for the next round of biochemical reaction, greatly shortening the reaction time in the sequencing process, reducing the phasing value, and ultimately reducing the error rate in the sequencing process and improving the accuracy of sequencing.

[0014] The orthogonal cleavage group refers to a group based on the bioorthogonal cleavage (click to release) principle, which has bioorthogonality and controllable bond cleavage properties.

[0015] In some embodiments of the present application, the orthogonal cleavage group is a dienophile group. By using the dienophile group as a linker for orthogonal cleavage, an inverse electron demand Diels-Alder (IEDDA) click reaction occurs, so that the orthogonal cleavage group as a protecting group can be quickly released from the 3′-OH position, achieving a shorter excision time and higher excision efficiency, and reducing the time required for sequencing.

[0016] In some embodiments of the present application, the orthogonal breaking group is -LR 6 ;

[0017] Wherein, L is selected from any one of non-existent, substituted or unsubstituted C1-C10 alkylene, substituted or unsubstituted C1-C10 heteroalkylene, substituted or unsubstituted C1-C10 cycloalkylene, substituted or unsubstituted C1-C10 heterocycloalkylene, substituted or unsubstituted C6-C10 arylene and substituted or unsubstituted C6-C10 heteroarylene;

[0018] R 6 is selected from a substituted or unsubstituted trans-cyclooctene group, a substituted or unsubstituted norbornene group, a substituted or unsubstituted benzonorbornene group, a substituted or unsubstituted vinyl group, a substituted or unsubstituted cyano group, and a substituted or unsubstituted azidophenyl group.

[0019] In some embodiments of the present application, the above L or R 6The substituents of the group in the moiety can be selected from at least one of halogen, haloalkyl, cyano, amino, nitro, carboxyl, thiol, sulfonic acid, acyl, amide, sulfonyl, carbonyl, unsubstituted alkyl, unsubstituted heteroalkyl, unsubstituted alkoxy, unsubstituted heterocycloalkyl, unsubstituted aryl, and unsubstituted heteroaryl.

[0020] The heteroatoms in the heteroalkyl, heteroalkylene, heteroaryl, heteroarylene, heterocycloalkyl, and heterocycloalkylene include but are not limited to atoms such as O, N, P, S, and Si, and the number of heteroatoms can be at least one.

[0021] In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C8 alkylene, substituted or unsubstituted C1-C8 heteroalkylene, substituted or unsubstituted C1-C8 cycloalkylene, substituted or unsubstituted C1-C8 heterocycloalkylene, substituted or unsubstituted C6-C8 arylene and substituted or unsubstituted C6-C8 heteroarylene.

[0022] In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C6 alkylene, substituted or unsubstituted C1-C6 heteroalkylene, substituted or unsubstituted C1-C6 cycloalkylene, substituted or unsubstituted C1-C6 heterocycloalkylene, substituted or unsubstituted C6-C8 arylene and substituted or unsubstituted C6-C8 heteroarylene.

[0023] In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C6 alkylene, substituted or unsubstituted C1-C6 heteroalkylene, substituted or unsubstituted C1-C6 cycloalkylene, substituted or unsubstituted C1-C6 heterocycloalkylene, substituted or unsubstituted phenylene and substituted or unsubstituted heterophenylene.

[0024] In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C4 alkylene, substituted or unsubstituted C1-C4 heteroalkylene, substituted or unsubstituted C1-C4 cycloalkylene, and substituted or unsubstituted C1-C4 heterocycloalkylene.

[0025] In some embodiments of the present application, L is selected from any one of absent, substituted or unsubstituted C1-C2 alkylene, substituted or unsubstituted C1-C2 heteroalkylene, substituted or unsubstituted C1-C2 cycloalkylene, and substituted or unsubstituted C1-C2 heterocycloalkylene.

[0026] In some embodiments of the present application, R 6 is a substituted or unsubstituted trans-cyclooctene group.

[0027] In some embodiments of the present application, the orthogonal breaking group is selected from any one of the following structures:

[0028]

[0029] Among them, L 1 , L 2 , L 3 Each independently is absent, an ester group, an ether group, or a C1-C6 alkylene group;

[0030] R 6 is hydrogen or a boronic acid group.

[0031] In some embodiments of the present application, L 1 Selected from any one of absence, ester group and ether group.

[0032] In some embodiments of the present application, L 2 Does not exist.

[0033] In some embodiments of the present application, L 3 is any one of C1 to C6 alkylene. In some embodiments, is any one of C1 to C3 alkylene.

[0034] In some embodiments of the present application, the orthogonal breaking group is selected from any one of the following:

[0035]

[0036] In some embodiments of the present application, R 3 The phosphate groups in the ester can be monophosphate or polyphosphate groups (eg, 2 or more).

[0037] The second aspect of the present application further provides the use of the above nucleotide analogs in the synthesis or sequencing of nucleic acids. In some embodiments of the present application, the synthesis of nucleic acids includes any one of enzymatic synthesis and chemical synthesis.

[0038] In some embodiments of the present application, the synthesis of nucleic acid includes any one of enzymatic synthesis and chemical synthesis of DNA.

[0039] In some embodiments of the present application, the enzymatic synthesis of nucleic acid refers to the use of the aforementioned compound as a synthesis substrate, a DNA template, and an enzyme system to complete the synthesis within a set reaction program including temperature conditions and reaction time. In some embodiments, the enzyme in the system includes a DNA polymerase, which can be an enzyme that can catalyze template-dependent DNA polymerization reactions, such as Taq DNA polymerase, Pfu DNA polymerase, etc.

[0040] In some embodiments of the present application, the chemical synthesis of nucleic acid refers to using the aforementioned compounds as synthetic raw materials, and completing the synthesis process by protecting the non-reactive groups before the reaction, activating the reactive groups, coupling, and deprotecting after the reaction. In some embodiments, the chemical synthesis of nucleic acid includes at least one of the phosphodiester bond method, the phosphotriester bond method, and the phosphite amide method. In some embodiments, the chemical synthesis of nucleic acid is solid phase synthesis, that is, the synthesis reaction is carried out on a solid support.

[0041] In some embodiments of the present application, the nucleic acid comprises more than 2 nucleotides, further more than 10, 20, 30, 50, 100, 200, 500, 1000 nucleotides.

[0042] The third aspect of the present application provides a sequencing method, comprising the following steps:

[0043] S1: contacting a template, a polymerase, any of the aforementioned nucleotide analogs and a primer, so that the nucleotide analog is incorporated into the primer in a set order for extension; the nucleotide analog includes four different tags according to different base types;

[0044] S2: identifying the incorporated nucleotide analogs based on the type of label on the nucleotide analogs incorporated into the primers;

[0045] S3: cleavage of the nucleotide analog to expose the 3′-OH using a cleavage agent;

[0046] Repeat steps S1 to S3 to determine the sequence of the template.

[0047] In some embodiments of the present application, the cleavage agent includes a tetrazine compound.

[0048] In some embodiments of the present application, the tetrazine compound has a general formula as shown in formula (II):

[0049] Among them, R 7 , R 8 They are independently selected from hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 heteroalkyl, substituted or unsubstituted C1-C10 cycloalkyl, substituted or unsubstituted C1-C10 heterocycloalkyl, substituted or unsubstituted C6-C10 aryl and substituted or unsubstituted C1-C10 heteroaryl.

[0050] In some embodiments of the present application, R 7 and R 8 Not at the same time as hydrogen.

[0051] In some embodiments of the present application, the substituents of the C1-C10 alkyl, C1-C10 heteroalkyl, C1-C10 cycloalkyl, C1-C10 heterocycloalkyl, C6-C10 aryl and C1-C10 heteroaryl are selected from at least one of amino and carboxyl groups.

[0052] In some embodiments of the present application, R 7 is hydrogen, R 8 Any one selected from C1-C10 alkyl substituted by amino and / or carboxyl, C1-C10 heteroalkyl substituted by amino and / or carboxyl, C1-C10 cycloalkyl substituted by amino and / or carboxyl, C1-C10 heterocycloalkyl substituted by amino and / or carboxyl, C6-C10 aryl substituted by amino and / or carboxyl, and C1-C10 heteroaryl substituted by amino and / or carboxyl.

[0053] In some embodiments of the present application, the detectable label is a fluorescent group.

[0054] In some embodiments of the present application, specific examples of fluorescent groups include but are not limited to FAM, HEX, TAMRA, Cy3, Cy3.5, Cy5, Cy5.5, Cy7, Texas, ROX, JOE, R6G, EDANS, IFluor, Alexa Fluor, FITC, etc.

[0055] In some embodiments of the present application, the nucleotide analogs used for sequencing generally have four different bases. To determine the specific base types, the nucleotide analogs of different base types have different detectable labels. For example, when the detectable label is a fluorescent group, the emission wavelengths of the fluorescent groups of the nucleotide analogs of different base types are significantly different. It is understood that the detectable label can also be other labels known in the art that can distinguish different base types by at least one method in physics, chemistry, and biology.

[0056] In the above sequencing process, the cleavage reaction uses pyridazine elimination triggered by IEDDA reaction, and a dihydropyridazine intermediate is formed by the reaction of tetrazine with a dienophilic group (such as trans-cyclooctene), which can spontaneously lead to the release of the group at the allylic position through 1,4-elimination. Compared with the existing azide protecting groups, dienophilic groups, especially trans-cyclooctene groups, have better stability. At the same time, during the Diels-Alder reaction of tetrazine compounds with dienophilic groups, especially trans-cyclooctene, nitrogen can be released to reduce the tension of the trans-cyclooctene ring, thereby further shortening the excision time and improving the excision efficiency, thereby reducing the time required for sequencing. Taking C2TCO as an example, when an optimized tetrazine compound containing an amino or carboxyl group as a guiding group is used for excision, the half-life is only 1.9 seconds, and 99.7% of the excision efficiency can be achieved within 40 seconds.

[0057] In a fourth aspect of the present application, a method for synthesizing nucleic acid is also provided, which comprises using the aforementioned nucleotide analogs as synthetic raw materials.

[0058] In some embodiments of the present application, the synthesis method is a chemical synthesis method of nucleic acid or an enzymatic synthesis method of nucleic acid.

[0059] The fourth aspect of the present application also provides a composition comprising the aforementioned nucleotide analogs.

[0060] In some embodiments of the present application, the composition includes sequencing reagents.

[0061] In some embodiments of the present application, the composition includes a polymerization reagent.

[0062] In some embodiments of the present application, the composition includes a polymerization reaction reagent and a cleavage reaction reagent. The polymerization reaction reagent includes the aforementioned compound, and the cleavage reaction reagent includes a cleavage reagent.

[0063] In some embodiments of the present application, the composition includes a polymerization reaction reagent and a cleavage reaction reagent. The polymerization reaction reagent includes an orthogonal cleavage group selected from Any one of the aforementioned compounds, wherein the cleavage reaction reagent includes a tetrazine compound.

[0064] In some embodiments of the present application, the polymerization reaction reagent further includes a polymerase.

[0065] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become apparent from the description below, or will be learned through the practice of the present application. DETAILED DESCRIPTION

[0066] The following will clearly and completely describe the concept of the present application and the technical effects produced in combination with the embodiments, so as to fully understand the purpose, features and effects of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, not all of them. Based on the embodiments of the present application, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present application.

[0067] The embodiments of the present application are described in detail below. The described embodiments are exemplary and are only used to explain the present application, and should not be understood as limiting the present application.

[0068] In the description of this application, "several" means more than one, "many" means more than two, "greater than", "less than", "exceed", etc. are understood to exclude the number itself, "above", "below", "within", etc. are understood to include the number itself, and "about" means within the range of ±20%, 10%, 8%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.2%, 0.1%, etc. of the number itself. If there is a description of "first" or "second", it is only used to distinguish the technical features, and cannot be understood as indicating or implying the relative importance or implicitly indicating the number of the indicated technical features or implicitly indicating the order of the indicated technical features.

[0069] In the description of the present application, the description with reference to the terms "one embodiment", "some embodiments", "illustrative embodiments", "examples", "specific examples", or "some examples" means that the specific features, structures, materials, or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present application. In this specification, the schematic representation of the above terms does not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described may be combined in any one or more embodiments or examples in a suitable manner.

[0070] Example 1

[0071] This example provides a nucleotide analog (Compound 5), the synthesis route of which is as follows:

[0072]

[0073] The specific steps are:

[0074] (1) A nucleoside (Compound 1) is reacted with tert-butyldimethylsilyl chloride (TBSCl) and imidazole in N,N-dimethylformamide (DMF) at room temperature for 24 hours to add a TBS protecting group to the 5′-OH to obtain Compound 2.

[0075] (2) Under nitrogen protection at room temperature, triphenylphosphine (PPh3) and trans-cyclooctene-2′-OH were weighed into a round-bottom flask, tetrahydrofuran (THF) was added as a solvent and stirred to dissolve, diethyl azodicarboxylate (DEAD) was slowly added dropwise over 5 min, and then compound 2 dissolved in tetrahydrofuran was slowly added to the above mixture. The reaction was monitored by TLC. After compound 2 was completely reacted, the reaction solvent was removed by a rotary evaporator, and the intermediate compound 3 was purified by normal silica gel chromatography to obtain a white solid.

[0076] (3) Under nitrogen protection at room temperature, compound 3 was weighed into a round-bottom flask, anhydrous THF was added to dissolve it, and then triethylamine hydrogen fluoride (Et3N-HF) was slowly added dropwise, and the reaction was stirred. The reaction was monitored by TLC until all the raw materials were completely reacted. The reaction solvent was removed by a rotary evaporator, and it was dissolved in ethyl acetate and extracted and separated with a saturated aqueous sodium bicarbonate solution. After the ethyl acetate layer was extracted, saturated sodium chloride was added for extraction, and then it was dried with anhydrous sodium sulfate. The mixture was filtered and the ethyl acetate was removed by a rotary evaporator. The obtained yellow oily liquid was purified by normal silica gel chromatography to obtain the intermediate compound 4 as a white solid.

[0077] (4) Weigh compound 4 and proton sponge in a dried two-necked bottle, evacuate the air, replace with N2 three times, add 20 ml of trimethyl phosphate and ultrasonically dissolve it, then put it in an ice-water bath, slowly drop POCl3 in the ice-water bath, and stir and react for 2 hours in the ice-water bath; take another dried two-necked bottle, weigh ammonium pyrophosphate, evacuate the air, replace with N2 three times, add 20 ml of DMF and ultrasonically dissolve it, add DIPEA and put it in an ice-water bath, then add the reaction solution of the first step monophosphoric acid back to the above solution, keep the ice-water bath to react for 2 hours; after 2 hours, drop 10 ml of 1M TEAB in the ice-water bath to quench, react for 1 hour and send the sample for HPLC analysis. The target molecule compound 5 was purified by DEAE ion exchange chromatography and preparative HPLC. 1 H NMR characterization was correct.

[0078] Example 2

[0079] This example provides a nucleotide analog (Compound 9), the synthesis route of which is as follows:

[0080]

[0081] The specific steps are:

[0082] (1) Under nitrogen protection at room temperature, compound 2 was weighed into a round-bottom flask, anhydrous DMF was added as solvent, followed by anhydrous dichloromethane (DCM) and 4-dimethylaminopyridine (DMAP), and stirred at room temperature until a uniform liquid was formed, then carbonyl diimidazole was quickly added, the reaction was resealed and stirred at room temperature for 2 hours until all the raw materials were consumed. The reaction mixture was filtered through silica gel, and the filter cake was washed with ethyl acetate. The solvent was removed by rotary evaporator to obtain a crude compound 6, which was used for the next step reaction.

[0083] (2) Under nitrogen protection at room temperature, the crude product of compound 6 was weighed into a round-bottom flask, and trans-cyclooctene-2′-OH and triethylamine were added and stirred for 2 hours. After compound 6 was completely reacted, the reaction solvent was removed by a rotary evaporator and purified by normal silica gel chromatography to obtain the intermediate compound 7 as a white solid.

[0084] (3) Under nitrogen protection at room temperature, compound 7 was weighed into a 100 mL round-bottom flask, anhydrous THF was added to dissolve it, and then triethylamine hydrogen fluoride was slowly added dropwise. The reaction was stirred and the reaction was observed by TLC tracking until all the raw materials were completely reacted. The reaction solvent was removed by a rotary evaporator, and it was dissolved in ethyl acetate and extracted and separated with a saturated aqueous sodium bicarbonate solution. After the ethyl acetate layer was extracted, saturated sodium chloride was added for extraction, and then it was dried with anhydrous sodium sulfate. The mixture was filtered and the ethyl acetate was removed by a rotary evaporator. The obtained yellow oily liquid was purified by normal silica gel chromatography to obtain the intermediate compound 8 as a white solid.

[0085] (4) Weigh the intermediate compound 8 and the proton sponge in a 100 mL dried two-necked bottle, evacuate the air, replace it with N2 three times, add 20 mL of trimethyl phosphate and ultrasonically dissolve it, then put it in an ice-water bath, slowly drop POCl3 in the ice-water bath, and stir and react for 2 hours in the ice-water bath; take another dried two-necked bottle, weigh ammonium pyrophosphate, evacuate the air, replace it with N2 three times, add 20 mL of DMF and ultrasonically dissolve it, add DIPEA and put it in an ice-water bath, then add the reaction solution of the first step monophosphoric acid back to the above solution, keep the ice-water bath to react for 2 hours; after 2 hours, drop 10 mL of 1M TEAB in the ice-water bath to quench, react for 1 hour and send the sample for HPLC analysis. After DEAE ion exchange chromatography and preparative HPLC purification, the target molecule compound 9 was obtained. 1 H NMR characterization was correct.

[0086] Example 3

[0087] This embodiment provides a tetrazine compound 11 for excision reaction, and its synthesis route is as follows:

[0088]

[0089] The specific preparation process is as follows:

[0090] Add n-boc-b-cyano-l-alanine (compound 10) (600 mg, 2.8 mmol), acetic acid guanidine salt (1.46 g, 14 mmol), Zn(OTf)2 (255 mg, 0.7 mmol), dioxane (8.4 mL, 98 mmol) and hydrazine monohydrate (6.8 mL, 140 mmol) to a round-bottom flask, mix well, and seal immediately. Stir at 30°C for 72 hours, then pour into 50 ml of ice water. After adding NaNO2 (3.9 g, 56 mmol), acidify the solution with 2N HCI aqueous solution (60 mL). Extract the mixture with ethyl acetate (5×70 mL), and take the organic layer, dry it over MgSO4, filter and concentrate. Purify by preparative reverse phase column chromatography (C18, H2O / MeCN, gradient elution, 0.1% formic acid) to obtain tetrazine (compound 11), which is obtained by 1 H NMR characterization was correct.

[0091] Example 4

[0092] This embodiment provides a tetrazine compound 13 for excision reaction, and its synthesis route is as follows:

[0093]

[0094] The specific preparation process is as follows:

[0095] 3-Cyanpropionic acid (compound 12, 1 g, 8.26 mmol), acetic acid formamidinium salt (4.3 g, 41.3 mmol), Zn(OTf)2 (0.9 g, 2.5 mmol), and hydrazine monohydrate (10 mL, 206 mmol) were mixed evenly in a round-bottom flask and sealed immediately. After stirring at 60°C for 60 minutes, NaNO2 (2.3 g, 33 mmol) was added, the solution was acidified with 2N HCI aqueous solution, and then the mixture was extracted with ethyl acetate (6×150 mL), and the organic layer was dried over MgSO4, filtered, and concentrated. Purification was performed by reverse phase column chromatography (H2O / MeCN, gradient elution, 0.1% formic acid) to obtain tetrazine (compound 13), which was obtained by 1 H NMR characterization was correct.

[0096] Example 5

[0097] This example provides a nucleotide analogue, the synthesis route of which is different from that of Example 1 in that 2→3 is replaced by 2→14→15 as follows, and then compound 15 is used to replace compound 3 in steps (3) to (4) of Example 1:

[0098]

[0099] The specific preparation process of 2→14→15 is as follows:

[0100] (1) Under nitrogen protection at room temperature, compound 2 was dissolved in acetonitrile (MeCN), dibromoethane and K2CO3 were added, and the mixture was stirred at 80°C overnight and then cooled to room temperature. Deionized water was added to quench the reaction, and the product was extracted with ether. The organic layer was washed with brine and dried over MgSO4, and the volatiles were removed under reduced pressure. The crude product was purified by column chromatography (30% EtOAc / heptane) to obtain intermediate 14 as a white solid.

[0101] (2) Intermediate 14 was dissolved in dry DMSO and purged with N2 for 10 minutes. Potassium tert-butoxide (t-BuOK) was slowly added in batches and the mixture was stirred for 10 minutes. The mixture was then diluted with EtOAc and quenched with ice water. The layers were separated, the organic layer was washed with deionized water and brine, and dried over MgSO4. The volatiles were removed under reduced pressure and the product was dissolved in MeOH. Sodium borohydride (NaBH4) was added in batches and the mixture was stirred for 1.5 hours. The reaction was quenched with H2O and the pH was adjusted to 7 with 0.1M HCl. The product was then washed with EtOAc, brine and dried over MgSO4. The volatiles were removed and the crude product was purified by column chromatography (30% EtOAc / heptane) to give compound 15, which was obtained by 1 H NMR characterization was correct.

[0102] Example 6

[0103] This example provides a nucleotide analogue, the synthesis route of which is different from that of Example 1 in that 2→3 is replaced by 2→16→17→18→19 as follows, and then compound 19 is used to replace compound 3 in steps (3) to (4) of Example 1:

[0104]

[0105] The specific preparation process is as follows:

[0106] a) Compound 2 was weighed and dissolved in DMF, and K2CO3 was added. Trichloroethylene was added dropwise at 70°C and reacted overnight. After cooling to room temperature, deionized water was added to quench the reaction, and the product was extracted with ether. The combined organic layer was washed with brine and dried over Na2SO4, and the volatiles were removed under reduced pressure. The extraction, washing, and drying steps were repeated to obtain Compound 16.

[0107] b) Compound 16 was dissolved in ether and n-BuLi was added dropwise. Stirred at -78°C for 1 hour, then heated to -40°C for 1 hour and stirred again for 1 hour. Deionized water was added to quench the reaction, and the product was extracted with ether. The combined organic layer was washed with saturated NH4Cl and brine and dried over Na2SO4. Volatiles were removed under reduced pressure and the crude product was purified by column chromatography (1% EtOAc / heptane) to obtain Compound 17.

[0108] c) Compound 17 was dissolved in toluene and purged with N2 for 10 minutes. Pinacolborane and RuHClCO(PPh3)3 were added and stirred at 50°C overnight. After cooling to room temperature, the volatiles were removed under reduced pressure. The crude product was dissolved in ether, washed with saturated NaHCO3 and brine, and dried over Na2SO4. After removing the volatiles under reduced pressure, the crude product was purified by column chromatography (30-40% EtOAc / heptane) to obtain compound 18. 1 H NMR characterization was correct.

[0109] d) Compound 18 was hydrolyzed in PBS to obtain compound 19.

[0110] Example 7

[0111] This example provides a group of four nucleotide analogs with different detectable labels, including nucleotide analogs dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, the difference between it and the nucleotide analog in Example 1 is that the base is modified with a detectable label through a linking group, specifically an optional fluorescent group Fluor, and the structural formula is as follows:

[0112]

[0113] Similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group via a linker group on the base, and the excitation bands of these fluorescent groups are different.

[0114] Example 8

[0115] This example provides a group of four nucleotide analogs with different detectable labels, including nucleotide analogs dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, the difference between it and Example 2 is that the base is modified with a detectable label through a linking group, specifically an optional fluorescent group Fluor, and the structural formula is as follows:

[0116]

[0117] Similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group via a linker group on the base, and the excitation bands of these fluorescent groups are different.

[0118] Example 9

[0119] This example provides a group of four nucleotide analogs with different detectable labels, including nucleotide analogs dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, the difference between it and Example 5 is that the base is modified with a detectable label through a linking group, specifically an optional fluorescent group Fluor, and the structural formula is as follows:

[0120]

[0121] Similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group via a linker group on the base, and the excitation bands of these fluorescent groups are different.

[0122] Example 10

[0123] This example provides a group of four nucleotide analogs with different detectable labels, including nucleotide analogs dATP, dCTP, dGTP and dTTP. Taking dCTP as an example, the difference between it and Example 6 is that the base is modified with a detectable label through a linking group, specifically an optional fluorescent group Fluor, and the structural formula is as follows:

[0124]

[0125] Similar to dCTP, dATP, dGTP and dTTP are each modified with a fluorescent group via a linker group on the base, and the excitation bands of these fluorescent groups are different.

[0126] Example 11: Thermal stability test

[0127] The nucleotide analogs prepared in Examples 1, 2, 5, and 6 were respectively prepared into 0.1 mM PBS (pH = 9) solutions, heated at 60° C. for 5 s to 10 min, and samples were taken at multiple different time points. The proportion of nucleotides with unblocked 3′-OH groups was analyzed by HPLC. The R 1 Stability of the protecting group. According to the results of thermal stability reflected by the degradation rate of nucleotide analogs at different time points, the R 1The protecting group has good thermal stability, which is 3.4 times more stable than the nucleotide protected by azidomethyl under the same conditions. Therefore, the nucleotide analogs provided in the embodiments of the present application can ensure the smooth progress of polymerization reaction and signal acquisition in the sequencing cycle, reduce the phasing value, and facilitate high-accuracy sequencing of the template.

[0128] Example 12: Comparison of excision efficiency

[0129] THPP was used as a deprotection reagent to perform excision reaction on comparative example 1 (azidomethyl protected nucleotide analog), and tetrazine compound 11 and compound 13 prepared in Examples 5 and 6 were used as deprotection reagents to perform excision reaction on the nucleotide analogs prepared in Examples 1, 2, 5, and 6, and the half-retention rates were compared. The principle of the tetrazine excision reaction is shown in the following route:

[0130]

[0131] The results show that the half-retention time of excision of the azidomethyl-protected nucleotide under five times the equivalent of THPP at room temperature is 6.4 min, while the half-retention time of excision using five times the equivalent of tetrazine compound in the example is 4.1 min, and the half-retention rate of excision of the nucleotide analogs of Examples 1, 2, 5, and 6 using compounds 11 and 13 is significantly higher than the half-retention rate of excision of the nucleotide analogs of Comparative Example 1 using THPP. Therefore, using the nucleotide analogs provided in the above examples for primer extension and using the corresponding tetrazine compounds for deprotection can greatly accelerate the excision reaction and shorten the sequencing time.

[0132] Example 13: Sequencing Example

[0133] This embodiment provides a method for sequencing a human genome, and the specific process is as follows:

[0134] 1. Sequencing library construction

[0135] (1) Nucleic acid extraction: Use a rapid DNA extraction kit (TIANGEN, KG203) to complete the extraction and purification of genomic DNA of the sample. For specific operations, see its operating instructions.

[0136] (2) Library construction: The library was constructed using the VAHTS Universal Plus DNA Library Prep Kit for Illumina (Cat. No. ND617-02). For specific operations, see its operating instructions.

[0137] (3) Library quality control: the enriched library is subjected to concentration detection and fragment length quality control.

[0138] After the above operation, a library sample of about 50 nM with a length of about 1-1000 bp was obtained.

[0139] 2. Preparation of sequencing chips

[0140] Illumina's Miseq sequencer and its matching sequencing kit (MiSeq Reagent Kit v3) were used to perform library denaturation, library loading and chip surface amplification to obtain a DNA amplification cluster, and a sequencing primer ACACTCTTTCCCTACACGACGCTCTTCCGATC (SEQ ID No. 1) was added. After hybridization, the DNA amplification cluster hybridized with the sequencing primer was fixed in the flow cell of the sequencing chip, waiting for the next sequencing reaction.

[0141] 3. Sequencing

[0142] (1) Preparation of sequencing reagents

[0143] Prepare the polymerization reaction solution, which contains DNA polymerase, Mg 2+ and 1 μM each of the nucleotide analogs dATP, dCTP, dGTP and dTTP in Example 7; and an elution buffer, a pre-wash buffer and an excision reaction solution containing compound 11.

[0144] (2) Sequencing reaction cycle

[0145] In the amplified chip, the pre-wash buffer and the polymerization reaction solution are pumped in sequence to start the polymerization reaction. When the polymerization reaction solution is finished, the signal of the entire sequencing chip is collected to determine the type of base bound to the primer chain on each amplification cluster. After the signal collection is completed, the elution buffer and the excision reaction solution are pumped in sequence, and then the elution buffer is pumped in for cleaning.

[0146] Repeat the above steps to perform the next sequencing cycle, for a total of 100 sequencing cycles.

[0147] Comparative Example 2: A method for sequencing the human genome is provided, which differs from Example 13 in that the nucleotide analogs in the polymerization reaction solution are replaced by the corresponding nucleotides with azidomethyl protected 3′-OH, and at the same time, THPP is used for compound 11 in the excision reaction solution.

[0148] The phasing values, pre-phasing values ​​and Q30 reflecting the sequencing quality of different samples of Example 13 and Comparative Example 2 were compared, and the results are shown in Table 1:

[0149] Table 1. Results of testing different samples according to the methods of Example 13 and Comparative Example 2

[0150]

[0151] From the above results, it can be seen that the nucleotide analogs used in the embodiment are more completely removed, and the phasing value and pre-phasing value are significantly lower than the control example. At the same time, the sequencing quality Q30 is also significantly higher than the control example. It can be seen that Example 12 can maintain a relatively high accuracy of sequencing.

[0152] Embodiment 14

[0153] This embodiment provides a sequencing method, which is different from Embodiment 13 in that the nucleotide analogs used in the polymerization reaction solution are a group of four nucleotide analogs in Embodiment 8.

[0154] Embodiment 15

[0155] This embodiment provides a sequencing method, which is different from Embodiment 13 in that the nucleotide analogs used in the polymerization reaction solution are a group of four nucleotide analogs in Embodiment 9.

[0156] Example 16

[0157] This embodiment provides a sequencing method, which is different from Embodiment 13 in that the nucleotide analogs used in the polymerization reaction solution are a group of four nucleotide analogs in Embodiment 10.

[0158] The phasing value and pre-phasing value of the excision reagent in the sequencing of Examples 14 to 16 are similar to those of Example 13, both lower than those of the corresponding Comparative Example 2. Q30 is also similar to that of Example 13, both higher than that of Comparative Example 2, which will not be repeated here.

[0159] From the above examples, it can be seen that the nucleotide analogs provided in the examples of the present application, as a substitute for the reversible terminator, can stably protect the 3′-OH under the sequencing reaction conditions, and are quickly cleaved off to expose the 3′-OH after contact with the cleavage reagent, thereby not only reducing the phasing value in the sequencing process, but also ultimately reducing the error rate, improving the accuracy, and greatly shortening the sequencing time.

[0160] Examples 17 to 20

[0161] This embodiment provides a method for chemical synthesis of DNA, which is based on the phosphite-amide solid-phase chemical synthesis method on a DNA chip using the nucleotides of Examples 7 to 10 as reaction raw materials or their precursor compounds to synthesize a DNA sequence of a certain length through reaction steps such as deblocking, activation coupling, capping, and oxidation.

[0162] The present application is described in detail above in conjunction with the embodiments, but the present application is not limited to the above embodiments, and various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present application. In addition, the embodiments of the present application and the features in the embodiments can be combined with each other without conflict.

Claims

1. A sequencing method, characterized in that The following steps are involved: S1: contacting a template, a polymerase, a nucleotide analog and a primer, so that the nucleotide analog is incorporated into the primer according to a set order for extension; S2: identifying the incorporated nucleotide analogue according to the type of label on the nucleotide analogue incorporated into the primer; S3: using a cleavage reagent to cleave the nucleotide analog to expose 3′-OH, wherein the cleavage reagent comprises a tetrazine compound; Repeat steps S1 to S3 to determine the sequence of the template; Wherein, the structural formula of the nucleotide analog is shown in formula (I): Among them, R 1 including an optional orthogonal breaking group; R 2 Includes bases; R 3 including any of a hydroxyl group and a phosphate group; R 4 Including hydrogen, OR 5 Any of the R 5 is an optional orthogonal breaking group; The R 1 , R 2 , R 3 , R 4 At least one of the nucleotide analogs is also connected to a detectable label, and the nucleotide analogs are connected to four different detectable labels according to different base types; The orthogonal breaking group is selected from any one of the following: Among them, L 1 , L 2 , L 3 Each independently is absent, an ester group, an ether group, or a C1-C6 alkylene group; R 6 is hydrogen or a boronic acid group.

2. The sequencing method according to claim 1, characterized in that The orthogonal breaking group is selected from any one of the following:

3. The sequencing method according to claim 1, characterized in that The tetrazine compound has the general formula (II): Among them, R 7 , R 8 Each of them is independently selected from any one of hydrogen, substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C1-C10 heteroalkyl, substituted or unsubstituted C1-C10 cycloalkyl, substituted or unsubstituted C1-C10 heterocycloalkyl, substituted or unsubstituted C6-C10 aryl and substituted or unsubstituted C6-C10 heteroaryl.

Images