DNA barcodes, primers for screening high-quality Tibetan brown mushroom and application thereof

By designing DNA barcodes and amplification primers based on the simple repetitive sequences of the whole genome of *Pleurotus eryngii*, the problems of low accuracy and low efficiency in screening *Pleurotus eryngii* varieties in existing technologies have been solved, enabling rapid and accurate variety screening and breeding.

CN116287418BActive Publication Date: 2026-03-03LHASA PLATEAU BIOSES RES INST
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202310398229.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2020-02-21
Publication Date
2026-03-03
Estimated Expiration
2040-02-21

AI Technical Summary

Technical Problem

Existing DNA barcoding technology suffers from low accuracy, complex operation, high cost, and low efficiency when screening Tibetan brown mushroom varieties. It is difficult to effectively screen high-quality varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity.

Method used

A DNA barcoding and amplification primer based on simple repetitive sequences in the whole genome of *Pleurotus tsutchuenensis* was designed, containing 17 DNA fragments and 17 primer pairs. Rapid and accurate screening of *Pleurotus tsutchuenensis* was achieved through PCR amplification and capillary fluorescence electrophoresis detection.

Benefits of technology

This method enables rapid and accurate screening of Tibetan brown mushroom varieties, reduces costs, improves screening efficiency, and allows for variety identification at different growth stages, avoiding the waste and inaccuracy of traditional methods.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116287418B_ABST
    Figure CN116287418B_ABST
Patent Text Reader

Abstract

The application discloses a DNA barcode for screening high-quality Tibetan brown mushroom, primers and application thereof. The DNA barcode for screening high-quality Tibetan brown mushroom comprises one or more of 17 DNA fragments with nucleotide sequences as shown in SEQ ID NO:1-17; the DNA barcode amplification primer for screening high-quality Tibetan brown mushroom comprises one or more of 17 pairs of primers with upper and lower nucleotide sequences as shown in SEQ ID NO:18-51. Compared with traditional breeding methods and other existing DNA barcode technologies, the application has the advantages of time saving, labor saving, money saving, accuracy and high efficiency, plays an active role in the genetic breeding of high-quality Tibetan brown mushroom, and simultaneously provides an effective method for identification and protection of germplasm resources.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of the invention patent application filed on February 21, 2020, with application number 202010108852.8 and invention title "A DNA barcode, primer and its application for screening high-quality Tibetan brown mushrooms". Technical Field

[0002] This invention relates to the field of edible fungi germplasm resource screening technology, and more specifically, to a DNA barcode, primer, and its application for screening high-quality Tibetan brown mushrooms. Background Technology

[0003] The Tibetan brown mushroom, a type of button mushroom, has a light brown color, falling between that of brown and white button mushrooms. White button mushrooms are prone to browning, affecting their quality, while brown button mushrooms are less prone to browning and have a high protein content. The main factor causing browning is the activity of polyphenol oxidase in button mushrooms; the higher the activity, the easier it is to brown. The Tibetan brown mushroom is a variety that is less prone to browning and possesses the excellent qualities of both white and brown button mushrooms. The main indicators for evaluating high-quality edible mushroom varieties, such as button mushrooms, include: high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols; strong antioxidant activity; and low polyphenol oxidase activity. Traditionally, wild samples are collected, domesticated, and then cultivated in the field. Plump, disease-free fruiting bodies are selected to isolate mycelium and preserve the spawn. Simultaneously, the above indicators are measured on each fruiting body, and only high-quality individuals corresponding to the spawn are selected for cultivation to obtain high-quality varieties. This selection process is lengthy and inefficient. The limited number of wild samples makes it impossible to determine the above indicators. Sufficient individuals must be obtained through mycelial isolation and preservation of the fungal strain for field cultivation before these indicators can be measured. Furthermore, for wild samples lacking high-quality indicators, subsequent domestication and field cultivation efforts will be wasted.

[0004] To realize the development and utilization of Tibetan brown mushrooms, screening high-quality Tibetan brown mushroom varieties is particularly important and urgent. Previously, the breeding of Tibetan brown mushrooms mainly relied on morphological methods combined with the determination of the aforementioned beneficial indicators. However, due to the unique climate and environment of the Qinghai-Tibet Plateau, Tibetan brown mushrooms from different regions often exhibit homonyms and synonyms, making morphological identification methods ineffective. Even more challenging is the inability to screen for high-quality varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenol content, strong antioxidant activity, and low polyphenol oxidase activity using morphological methods. DNA barcoding molecular identification technology is a molecular biology technique based on DNA barcoding (conserved and stable genetic DNA sequences in the genome) for species and quality identification. It is an effective supplement and extension to traditional breeding methods, enabling accurate and effective identification of samples when morphological features are incomplete or lack morphological structure (processed products such as powders). Existing DNA barcoding technologies utilize ITS (internal transcribed spacer region) in ribosomes and non-coding regions or conserved gene sequences in mitochondria as DNA barcoding sequences. However, this approach is primarily limited to identifying a small number of genes or fragments, resulting in low information content and poor identification efficiency. Furthermore, it cannot be used for screening for superior quality characteristics. Restriction fragment length polymorphism (RFLP) in existing DNA barcoding technologies is cumbersome and complex, requiring radioactive isotope markers or carcinogenic imaging markers. It also consumes large amounts of genomic templates, resulting in few bands and limited information, and is susceptible to gene mutations, leading to unstable results. Random amplified polymorphic DNA (RAPD) in existing DNA barcoding technologies is prone to interference, requiring high operator skill and stable reproducibility. Additionally, the quality and concentration of the sample genomic template, primer length and sequence, PCR cycle number, genomic DNA complexity, and equipment all contribute to poor reproducibility of RAPD. Existing DNA barcoding technologies, particularly single nucleotide polymorphism (SNP) techniques, rely on SNP chips or mass spectrometry and sequencing, which are demanding, expensive, and costly. Therefore, to address the shortcomings of traditional breeding methods for selecting Tibetan brown mushroom varieties—namely, inaccuracy, time-consumingness, and labor-intensiveness—it is necessary to provide a DNA barcoding technology that can accurately and quickly identify the variety of Tibetan brown mushroom while simultaneously enabling the selection of high-quality varieties. Furthermore, this technology should address the deficiencies of existing DNA barcoding techniques by providing a low-cost, efficient, easy-to-operate, and stable, reliable, and reproducible detection method. Summary of the Invention

[0005] The purpose of this invention is to overcome the above-mentioned defects and deficiencies in the prior art and to provide a DNA barcode for screening high-quality Tibetan brown mushrooms.

[0006] Another objective of this invention is to provide a DNA barcoding amplification primer for screening high-quality Tibetan brown mushrooms.

[0007] Another object of the present invention is to provide the application of the DNA barcode and amplification primers.

[0008] Another object of the present invention is to provide a method for screening high-quality Tibetan brown mushroom varieties.

[0009] The above-mentioned objective of this invention is achieved through the following technical solution:

[0010] DNA barcodes used for screening high-quality Tibetan brown mushrooms contain one or more of 17 DNA fragments with nucleotide sequences as shown in SEQ ID NO: 1 to 17.

[0011] This invention screens all simple sequence repeats (SSRs) in the whole genome of *Pleurotus eryngii* to identify 17 DNA barcodes that can both identify the species and are associated with superior qualities such as high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity. These barcodes can be used to assist in the breeding of *Pleurotus eryngii* varieties with superior qualities such as high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity. The DNA barcodes used for screening total protein and total soluble protein content indicators have nucleotide sequences as shown in SEQ ID NO: 1–3, respectively; the DNA barcodes used for screening total hydrolyzed amino acid content indicators have nucleotide sequences as shown in SEQ ID NO: 4–5, respectively; the DNA barcodes used for screening total polysaccharide content indicators have nucleotide sequences as shown in SEQ ID NO: 6–8, respectively; the DNA barcodes used for screening total polyphenol content indicators have nucleotide sequences as shown in SEQ ID NO: 9–11, respectively; the DNA barcodes used for screening antioxidant activity indicators have nucleotide sequences as shown in SEQ ID NO: 12–14, respectively; and the DNA barcodes used for screening polyphenol oxidase activity indicators have nucleotide sequences as shown in SEQ ID NO: 15–17, respectively. This invention provides 2 to 3 DNA barcodes for each screening trait of Tibetan brown mushroom varieties. When only one DNA barcode is selected as the target sequence for detection, Tibetan brown mushroom varieties with excellent traits can be selected. When all DNA barcodes are selected as target sequences at the same time, the accuracy and efficiency of screening varieties with excellent traits can be greatly improved.

[0012] The DNA barcodes corresponding to the aforementioned trait indicators of this invention can be combined and used in combination according to actual screening needs. For example, when only one Tibetan brown mushroom variety with superior traits needs to be screened, such as Tibetan brown mushroom varieties with high total protein and total soluble protein content, high total hydrolyzed amino acid content, high total polysaccharide content, high total polyphenol content, strong antioxidant activity, or low polyphenol oxidase activity, the DNA barcodes corresponding to the aforementioned screening indicators are selected as target sequences for detection. When two or more Tibetan brown mushroom varieties with superior traits need to be screened simultaneously, the DNA barcodes corresponding to the trait indicators can be combined and used in combination according to actual needs. When the above 17 DNA barcodes are used together as target sequences for screening, Tibetan brown mushroom varieties with the highest screening accuracy, characterized by high total protein, total soluble protein, total hydrolyzed amino acid, total polysaccharide, and total polyphenol content, strong antioxidant activity, and low polyphenol oxidase activity, can be obtained.

[0013] Preferably, a set of DNA barcodes for screening Tibetan brown mushroom varieties with high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity contains a total of 17 DNA fragments, the nucleotide sequences of which are shown in SEQ ID NO: 1 to 17.

[0014] DNA barcoding amplification primers for screening high-quality Tibetan brown mushrooms contain one or more of 17 primer pairs with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 18-51, respectively. The DNA barcode amplification primers used for screening total protein and total soluble protein content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 18-23; the DNA barcode amplification primers used for screening total hydrolyzed amino acid content indicators include two pairs of primers, with nucleotide sequences shown in SEQ ID NO: 24-27; the DNA barcode amplification primers used for screening total polysaccharide content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 28-33; the DNA barcode amplification primers used for screening total polyphenol content indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 34-39; the DNA barcode amplification primers used for screening antioxidant activity indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 40-45; and the DNA barcode amplification primers used for screening polyphenol oxidase activity indicators include three pairs of primers, with nucleotide sequences shown in SEQ ID NO: 18-23. ID NO: 46-51 as shown.

[0015] This invention uses the aforementioned 17 DNA barcodes as target sequences and designs 17 primer pairs based on the analysis of all simple sequence repeat (SSR) sites in the whole genome of *Pleurotus eryngii*. The polymorphisms of the fragments amplified using these 17 primer pairs can assist in the selection of brown mushrooms with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols content, strong antioxidant activity, and low polyphenol oxidase activity. The effect of assisted breeding can be achieved by electrophoresis detection after PCR amplification. As described above regarding DNA barcodes, the 17 DNA barcode amplification primer pairs can be selected from 2-3 primer pairs included in the trait indicators to be screened, or used together, to improve the accuracy and efficiency of screening varieties with superior traits, depending on the actual trait screening requirements. When the above 17 pairs of DNA barcode amplification primers are used together as detection primers, Tibetan brown mushroom varieties with the highest screening accuracy, high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity can be obtained.

[0016] Preferably, a set of DNA barcoding primers for screening Tibetan brown mushroom varieties with high total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols content, strong antioxidant activity, and low polyphenol oxidase activity is provided. The set comprises 17 pairs of primers, with the upstream and downstream nucleotide sequences of which are shown in SEQ ID NO: 18-51, respectively. High-quality Agaricus bisporus As2796 has an average total protein content of 260 mg / g, an average soluble total protein content of 80 mg / g, an average total hydrolyzed amino acid content of 160 mg / g, an average total polysaccharide content of 70 mg / g, an average total polyphenol content of 10 mg / g, an average ABTS free radical scavenging rate of 70%, and a polyphenol oxidase activity of 4420 units / g. Using the primers of this invention, Tibetan brown mushroom samples with superior performance across all indicators compared to Agaricus bisporus As2796 can be screened.

[0017] This invention also provides the application of the above-mentioned DNA barcode or DNA barcode amplification primers in screening or assisting in the breeding of high-quality Tibetan brown mushroom varieties.

[0018] A method for screening high-quality Tibetan brown mushroom varieties includes the following steps:

[0019] S1. Extract genomic DNA from the sample to be tested;

[0020] S2. Using S1 genomic DNA as a template, select one or more pairs of amplification primers from the above DNA barcodes according to the trait screening requirements and perform PCR amplification reactions respectively;

[0021] S3. The PCR amplification products of S2 are detected by capillary fluorescence electrophoresis, and the results are determined by the number of fragments, the number of SSR sites, the number of SSR repeat elements and their repeat times.

[0022] For example, when it is necessary to screen for Tibetan brown mushroom varieties with high total protein and total soluble protein content, at least one pair of the three primer pairs shown in SEQ ID NO: 18-23 is used for PCR amplification reaction detection in step S2; when it is necessary to screen for Tibetan brown mushroom varieties with high total protein, high total soluble protein content, and high total hydrolyzed amino acid content, at least one pair of the three primer pairs shown in SEQ ID NO: 18-23 and at least one pair of the two primer pairs shown in SEQ ID NO: 24-27 are used for PCR amplification reaction detection in step S2.

[0023] Preferably, the PCR amplification reaction system in step S2 consists of 5 μL of 2×Taq PCR Master Mix, 1 μL of template, 0.1 μL of upstream primer, 0.4 μL of downstream primer, 0.4 μL of 10 μM fluorescent M13 primer, and is brought to a final volume of 10 μL with sterile deionized water.

[0024] Preferably, the PCR amplification reaction program in step S2 is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, PCR annealing at 62 to 55℃ for 30 s, extension at 72℃ for 30 s, for a total of 10 cycles; 95℃ denaturation for 30 s, 52℃ annealing for 30 s, extension at 72℃ for 30 s, for a total of 25 cycles; final extension at 72℃ for 20 min; and incubation at 4℃ for 6 h.

[0025] Specifically, when screening for Tibetan brown mushroom varieties with high total protein and total soluble protein content in step S2, PCR amplification reactions can be performed using the three primer pairs shown in SEQ ID NO: 18-23, and the PCR amplification products can be detected by capillary electrophoresis. Detection and judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 1.1 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with an SSR repeat element of AG, and one fragment has 5 repeats of AG while the other has 6 repeats of AG, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. When using primer 1.2 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with an SSR repeat element of CA, and one fragment has 6 repeats of CA while the other has 7 repeats of CA, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. When using primer 1.3 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with an SSR repeat element of AC, and the fragment has 5 repeats of AC, then the sample is identified as *Pleurotus ostreatus*, a mushroom with high total protein and total soluble protein content. The best accuracy is achieved when primers 1.1, 1.2, and 1.3 are used simultaneously for comprehensive detection and identification.

[0026] Specifically, when screening for Tibetan brown mushroom varieties with high total hydrolyzed amino acid content in step S2, PCR amplification reactions can be performed using the two primer pairs shown in SEQ ID NO: 24-27, and the PCR amplification products can be detected by capillary electrophoresis. The detection is based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 2.1 for fragment amplification, if a fragment (one peak) containing one SSR site with an SSR repeat element of AT, and the amplified fragment has 11 repeats of AT, then the sample is identified as Tibetan brown mushroom with high total hydrolyzed amino acid content. When using primer 2.2 for fragment amplification, if a fragment (one peak) containing one SSR site with an SSR repeat element of AT, and the amplified fragment has 5 repeats of AT, then the sample is identified as Tibetan brown mushroom with high total hydrolyzed amino acid content. The accuracy is best when primers 1.1 and 1.2 are used simultaneously for comprehensive detection.

[0027] Specifically, when screening for Tibetan brown mushroom varieties with high total polysaccharide content in step S2, PCR amplification reactions are performed using the three primer pairs shown in SEQ ID NO: 28-33, and the PCR amplification products are detected by capillary electrophoresis. Detection and judgment are based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 3.1 for fragment amplification, if two fragments (two peaks) are obtained, each containing two SSR sites with the SSR repeat element TG, and one fragment has 7 repeats of TG while the other has 9 repeats of TG, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. When using primer 3.2 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element TC, and the fragment has 11 repeats of TC, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. When using primer 3.3 for fragment amplification, if one fragment (one peak) is obtained, containing one SSR site with the SSR repeat element AT, and the fragment has 6 repeats of AT, then the sample is identified as *Pleurotus tumefaciens*, a mushroom with high total polysaccharide content. The accuracy is best when primers 3.1, 3.2, and 3.3 are used simultaneously for comprehensive detection and identification.

[0028] Specifically, when screening for Tibetan brown mushroom varieties with high total polyphenol content in step S2, PCR amplification reactions are performed using the three primer pairs shown in SEQ ID NO: 34-39, and the PCR amplification products are detected by capillary electrophoresis. Detection and judgment are based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 4.1 for fragment amplification, if one fragment (one peak) is amplified containing one SSR site with the SSR repeat element CT, and the amplified fragment has 7 repeats of CT, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. When using primer 4.2 for fragment amplification, if one fragment (one peak) is amplified containing one SSR site with the SSR repeat element AT, and the amplified fragment has 6 repeats of AT, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. When using primer 4.3 for fragment amplification, if two fragments (two peaks) are amplified containing two SSR sites with the SSR repeat element AT, and one amplified fragment has 6 repeats of GA while the other has 11 repeats of GA, then the sample is identified as *Mammillaria tibetica*, a Tibetan brown mushroom with high total polyphenol content. The accuracy is best when primers 4.1, 4.2, and 4.3 are used simultaneously for comprehensive detection and identification.

[0029] Specifically, when screening for Tibetan brown mushroom varieties with strong antioxidant activity in step S2, PCR amplification reactions were performed using the three primer pairs shown in SEQ ID NO: 40-45, and the PCR amplification products were detected by capillary electrophoresis. Detection and judgment were based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 5.1 for fragment amplification, if two fragments (two peaks) are amplified, each containing two SSR sites with the SSR repeat element AG, and one fragment has six AG repeats while the other has seven, then the sample is identified as *Pleurotus ts.*, a species of Tibetan brown mushroom with strong antioxidant activity. When using primer 5.2 for fragment amplification, if one fragment (one peak) is amplified, each containing one SSR site with the SSR repeat element CCA, and the fragment has four CCA repeats, then the sample is identified as *Pleurotus ts.*, a species of Tibetan brown mushroom with high total polyphenol content. When using primer 5.3 for fragment amplification, if two fragments (two peaks) are amplified, each containing two SSR sites with the SSR repeat element CAG, and one fragment has six CAG repeats while the other has eight, then the sample is identified as *Pleurotus ts.*, a species of Tibetan brown mushroom with high total polyphenol content. The best accuracy is achieved when primers 5.1, 5.2, and 5.3 are used simultaneously for comprehensive detection and identification.

[0030] Specifically, when screening for Tibetan brown mushroom varieties with low polyphenol oxidase activity in step S2, PCR amplification reactions were performed using the three primer pairs shown in SEQ ID NO: 46-51, and the PCR amplification products were detected by capillary electrophoresis. Detection and judgment were based on the SSR sites and SSR repeat elements in the primer amplification fragments. When using primer 6.1 for fragment amplification, if two fragments (two peaks) are amplified, each containing two SSR sites with the SSR repeat element TGA, and one fragment has five TGA repeats while the other has eight, then the sample is identified as *Pleurotus tumefaciens*, a species with low polyphenol oxidase activity. When using primer 6.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site with the SSR repeat element TTG, and the amplified fragment has eight TTG repeats, then the sample is identified as *Pleurotus tumefaciens*, a species with low polyphenol oxidase activity. When using primer 6.3 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site with the SSR repeat element AAG, and the amplified fragment has three AAG repeats, then the sample is identified as *Pleurotus tumefaciens*, a species with high total polyphenol content. The best accuracy is achieved when primers 6.1, 6.2, and 6.3 are used simultaneously for comprehensive detection and identification.

[0031] The present invention also claims protection for the use of the above-mentioned DNA barcode or the above-mentioned DNA barcode amplification primers in the preparation of products for screening high-quality Tibetan brown mushroom varieties.

[0032] A product for screening high-quality Tibetan brown mushrooms contains amplification primers for detecting the aforementioned 17 DNA barcodes.

[0033] Preferably, it comprises one or more of the 17 pairs of primers, with upstream and downstream nucleotide sequences as shown in SEQ ID NO: 18-51, respectively.

[0034] Preferably, the product further comprises reagents required for PCR amplification reactions and for fluorescence capillary electrophoresis detection.

[0035] Preferably, the product is a reagent kit.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] This invention provides a DNA barcode and primers for screening high-quality Tibetan brown mushrooms. It allows for identification and selection of superior varieties using wild samples of Tibetan brown mushrooms and small amounts of tissue or mycelium. It can identify varieties and select superior varieties at different growth stages of Tibetan brown mushrooms, including mycelium, primordia, fruiting bodies, and spores. The screening cycle is short, not limited by sample type, and avoids waste, overcoming the shortcomings of traditional breeding methods for selecting Tibetan brown mushroom varieties, which are often inaccurate, time-consuming, and labor-intensive. The DNA barcode and primers of this invention can accurately identify varieties with high morphological similarity and correspond to superior qualities such as high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides, and total polyphenols, strong antioxidant activity, and low polyphenol oxidase activity, thus assisting in the selection of superior Tibetan brown mushroom varieties. It is not only low-cost and highly efficient, but also simple to operate, with stable, reliable, and reproducible results. Compared with traditional breeding methods and other existing DNA barcoding technologies, this invention has the advantages of being time-saving, labor-saving, cost-saving, accurate, and efficient. It plays a positive role in the genetic breeding of high-quality Tibetan brown mushrooms and also provides an effective method for the identification and protection of germplasm resources. Attached Figure Description

[0038] Figure 1 Screening specific primers for high-quality varieties of *Mushroom tigrinum* with low polyphenol oxidase activity. 6.1, 6.2, 6.3 PCR amplification products were detected by capillary electrophoresis.

[0039] Figure 2 The results show the comparison of polyphenol oxidase activity between Example 6 and Comparative Example 6.

[0040] Figure 3 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.1.

[0041] Figure 4 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.2.

[0042] Figure 5 The amplification results of Example 6 and Comparative Example 6 were amplified using primer 6.3. Detailed Implementation

[0043] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.

[0044] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.

[0045] Example 0: Construction and identification method of DNA barcodes from *Brown Mushroom tibetica*

[0046] Based on the analysis of all simple sequence repeat (SSR) sites in the whole genome of *Pleurotus ostreatus*, 17 pairs of primers were screened and designed. The polymorphism of the fragments obtained by amplifying the genome of the sample using these 17 pairs of primers can help select brown mushrooms with high content of total protein, total soluble protein, total hydrolyzed amino acids, total polysaccharides and total polyphenols, strong antioxidant activity and low polyphenol oxidase activity.

[0047] (6) Screening of varieties with low polyphenol oxidase activity

[0048] Polyphenol oxidase was extracted from the fruiting bodies of *Pleurotus ostreatus* (Tibetan brown mushroom), dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using ultrasound at 300 W for 30 min. The extract was then centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the polyphenol oxidase extract. The polyphenol oxidase activity of the *Pleurotus ostreatus* fruiting body extract was determined using a polyphenol oxidase (PPO) activity assay kit (catalog number BC0190) from Beijing Solarbio Science & Technology Co., Ltd., and expressed as enzyme activity units per milligram of sample.

[0049] Samples with a concentration lower than 4420 units per gram (this index is the average polyphenol oxidase activity of Agaricus bisporus As2796) were selected. Primer sequences are shown in Table 1. The method is as described in (1). SSR-specific primer amplification was performed, and the amplification results are as follows. Figure 1 As shown, the fragment size in the electrophoresis diagram is equal to the actual bp number of the amplified fragment plus 18 bp of the M13 fluorescent primer. Two peaks in capillary electrophoresis indicate that the gene is heterozygous and has two similar fragments.

[0050] Table 1. Specific primers for screening high-quality varieties of *Mushroom tigrinum* with low polyphenol oxidase activity.

[0051]

[0052] Primer 6.1 amplifies the fragment (target sequence) as shown in SEQ ID NO: 15, 246 bp.

[0053] Primer 6.2 amplifies the fragment (target sequence) as shown in SEQ ID NO: 16, 191 bp.

[0054] Primer 6.3 amplifies the fragment (target sequence) as shown in SEQ ID NO: 17, 257bp.

[0055] Detection and Judgment: Judgment is made based on the SSR sites and SSR repeat elements in the primer-amplified fragments. When using primer 6.1 for fragment amplification, if two fragments (two peaks) are amplified, containing two SSR sites, with the SSR repeat element being TGA, and one amplified fragment has 5 TGA repeats while the other has 8 TGA repeats, then the sample is identified as *Mammillaria tibetica* with low polyphenol oxidase activity. When using primer 6.2 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being TTG, and the amplified fragment has 8 TTG repeats, then the sample is identified as *Mammillaria tibetica* with low polyphenol oxidase activity. When using primer 6.3 for fragment amplification, if one fragment (one peak) is amplified, containing one SSR site, with the SSR repeat element being AAG, and the amplified fragment has 3 AAG repeats, then the sample is identified as *Mammillaria tibetica* with high total polyphenol content. The accuracy is best when primers 6.1, 6.2, and 6.3 are used simultaneously for comprehensive detection and judgment.

[0056] Example 6: Screening and Validation of Polyphenol Oxidase Indicators

[0057] The widely cultivated high-quality button mushroom variety As2796 was used as Comparative Example 6, and the high-quality Tibetan brown mushroom was used as Example 6. The fruiting bodies of Example 6 and Comparative Example 6 were collected, dehydrated by vacuum freeze-drying, pulverized, and passed through a 50-mesh sieve. 1 gram of dry powder was added to 20 mL of double-distilled water, and extraction was performed using 300W ultrasonic-assisted extraction for 30 min. Then, the mixture was centrifuged at 5000 rpm for 30 min, and the supernatant was collected to prepare the total polysaccharide extract. The phenol oxidase activity of the extracts from Example 6 and Comparative Example 6 was determined using the polyphenol oxidase (PPO) activity assay kit (catalog number BC0190) from Beijing Solarbio Science & Technology Co., Ltd., and expressed as enzyme activity units per gram of mushroom fruiting body dry powder. Figure 2 As shown, the polyphenol oxidase activity in Example 6 was significantly lower than that in Comparative Example 6.

[0058] Fruiting body samples from Comparative Example 6 and Example 6 were collected, and the genome was extracted and amplified using primers 6.1, 6.2, and 6.3, as in Example 1.

[0059] (1) The amplification results of primer 6.1 are as follows Figure 3 As shown; specifically, the SSR repeat element amplified by primer 6.1 is a TGA; the Tibetan brown mushroom has two SSR sites, one is a 5-repeated TGA of a 265bp amplified fragment, and the other is an 8-repeated TGA of a 271bp amplified fragment; the comparative example, Agaricus bisporus As2796, has two SSR sites, one is a 5-repeated TGA of a 265bp amplified fragment, and the other is a 6-repeated TGA of a 268bp amplified fragment. The specific sequence information is shown below; where the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.

[0060] 265bp amplified fragment sequence:

[0061] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGATATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGAG TGATGATGATGATGA TGTTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG;

[0062] 268bp amplified fragment sequence:

[0063] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGTATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGATGAG TGATGATGATGATGATGA TTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG;

[0064] 271bp amplified fragment sequence:

[0065] TGTAAAACGACGGCCAGTCAGACAGAGACGGCCTTGAGGATGGATGATGTTTCAGAAGTCACGGTCCCCAAGTCGCAATATGACGACGACACTCTACCAAAACATAGCGATATTCGTATACCTTGATTTTAGAAATTTGTATTCATGATATTTTGTGCATTAGCCACCTTCAGGTTGTACAGTACTTTGAG TGATGATGATGATGATGATGATGA TTGAGCGTCGAAGTTGCTGACTCAGCGAATCTCGCGGTTTGAATGGACGCGACCTG.

[0066] (2) The amplification results of primer 6.2 are as follows Figure 4 As shown; specifically, the SSR repeat element amplified by primer 6.2 is a TTG; the Tibetan brown mushroom in the example has one SSR site, which is an 8-repeated TTG of a 213bp amplified fragment; the comparative example Agaricus bisporus As2796 has two SSR sites, one is a 7-repeated TTG of a 209bp amplified fragment, and the other is an 8-repeated TTG of a 213bp amplified fragment. The specific sequence information is shown below; among them, the first 18 bases are 18bp of the M13 fluorescent primer, and the underlined part is the SSR repeat element.

[0067] 209bp amplified fragment sequence:

[0068] TGTAAAACGACGGCCAGTCACGGATGCCAACTCAAACGGAAAATCTATTACTACTTTTCCTCTAAACAAAGCGCCATCCCAC AAACCACTAAATATATTACTGGTATTCTGTCGATGCCGCATAAGAAAGTTATGAGTTCTTCCTCCATTA TTGTTGTTGTTGTTGTTG TTG TGATAGGTATCTGAAGAATCTGTGGCTCGATCGTCG;

[0069] 213bp amplified fragment sequence:

[0070] TGTAAAACGACGGCCAGTCACGGATGCCAACTCAAACGGAAAATCTATTACTACTTTTCCTCTAAACAAAGCGCCATCCCAC AAACCACTAAATATATTACTGGTATTCTGTCGATGCCGCATAAGAAAGTTATGAGTTCTTGCCTCCATTA TTGTTGTTGTTGTTGTT GTTGTTG TGATAGGTATCTGAAGAATCTGTGGCTCGATCGTCG.

[0071] (3) The amplification results of primer 6.3 are as follows: Figure 5 As shown; specifically, the SSR repeat element amplified by primer 6.3 is AAG; the Tibetan brown mushroom in the example has 1 SSR site, which is a 3-fold repeat AAG of the 265bp amplified fragment; the comparative example Agaricus bisporus As2796 has 2 SSR sites, one is a 2-fold repeat AAG of the 264bp amplified fragment, and the other is a 6-fold repeat AAG of the 274bp amplified fragment.

[0072] 264bp amplified fragment sequence:

[0073] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAAGTAATCAAGTAAGT AAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG;

[0074] 265bp amplified fragment sequence:

[0075] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAGTAATCAAGTAAGT AAGAAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG;

[0076] 274bp amplified fragment sequence:

[0077] TGTAAAACGACGGCCAGTGCCAACGATTACGGTACCCAATATACAAACGTCAACCTTCTTGTTATTGGTATATATACGAATTTGTAGATGACGAAGTTCATTTAGACAATTTGGTTCGCATAGCCAAATTGCGGGGTCTAGTACAGTAATCAAGTAAGT AAGAAGAAGAAGAAGAAG GTTTGCACAAATATAAAGAAATGAAGTCACTTTGGATGATTTTGATAAACTGGCAAGATCGTCTCAGGCGCCGGTACGCGGGTGCAATCCAAAGAAG.

[0078] The above results show that Comparative Example 6 and Example 6 can be effectively distinguished using primers 6.1, 6.2, and 6.3. Primers 6.1, 6.2, and 6.3 can be used to screen for Tibetan brown mushrooms with low polyphenol oxidase activity.

Claims

1. A method of screening for superior varieties of Agaricus blazei murrill, characterized by, Screening the low polyphenol oxidase activity Tibetan brown mushroom, comprising the following steps: S1. Extracting the genomic DNA of the sample to be tested; S2. Taking the genomic DNA of S1 as a template, and according to the trait screening requirement, selecting one or more pairs of primers shown in SEQ ID NO: 46 and SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49, SEQ ID NO: 50 and SEQ ID NO: 51 to perform PCR amplification reaction respectively; S3. Detecting the PCR amplification product of S2 by capillary electrophoresis, and determining by the fragment number, SSR site number, SSR repeat element and its repeat number of the amplification product.

2. The method of claim 1, wherein the method is characterized by, The standard for determining by the fragment number, SSR site number, SSR repeat element and its repeat number of the amplification product in step S3 is that when using SEQ ID NO: 46 and SEQ ID NO: 47 to perform fragment amplification, if 2 fragments are obtained, containing 2 SSR sites, the SSR repeat element is TGA, and one of the amplified fragments has 5 repeated TGA, and the other fragment has 8 repeated TGA, then the sample to be tested is determined as the low polyphenol oxidase activity Tibetan brown mushroom; when using SEQ ID NO: 48 and SEQ ID NO: 49 to perform fragment amplification, if 1 fragment is obtained, containing 1 SSR site, the SSR repeat element is TTG, and the amplified fragment has 8 repeated TTG, then the sample to be tested is determined as the low polyphenol oxidase activity Tibetan brown mushroom; when using SEQ ID NO: 50 and SEQ ID NO: 51 to perform fragment amplification, if 1 fragment is obtained, containing 1 SSR site, the SSR repeat element is AAG, and the amplified fragment has 3 repeated AAG, then the sample to be tested is determined as the low polyphenol oxidase activity Tibetan brown mushroom.

Citation Information

Patent Citations

  • A SSR-PCR method for identification of four main cultivars of Agaricus bisporus

    CN109207625A

  • SSR primer set for discriminating Agaricus bisporus strain and uses thereof

    KR102029016B1