A method of oligonucleotide inkjet printing
By using the non-volatile solvents glutaronitrile and propylene carbonate for oligonucleotide inkjet printing, the problems of low synthesis efficiency and instrument damage caused by the volatility of acetonitrile were solved, and efficient and stable oligonucleotide sequence synthesis was achieved.
Patent Information
- Application Number
- CN202211681516.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2022-12-27
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2042-12-27
AI Technical Summary
In existing oligonucleotide inkjet printing methods, the solvent acetonitrile is volatile, causing droplets to evaporate before reaching the chip surface, which affects synthesis efficiency and damages the instrument.
Non-volatile solvents such as glutaronitrile and propylene carbonate are used as oligonucleotide synthesis reagents. In situ synthesis of oligonucleotide sequences is carried out on the surface of a solid-phase carrier by inkjet printing. Combined with phosphorus amide solid-phase chemical synthesis method, the inkjet volume and environment are controlled to reduce the use of volatile solvents.
This method improves the synthesis efficiency of oligonucleotide inkjet printing, enables high-throughput oligonucleotide sequence synthesis, avoids damage to the instrument caused by solvent evaporation, and ensures the stability and accuracy of the synthesis.
Smart Images

Figure CN116288743B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of oligonucleotide in situ synthesis technology, and particularly relates to a method for oligonucleotide inkjet printing. Background Technology
[0002] Oligonucleotide microarray fabrication technology exhibits two major trends: one is the development of high-density, high-throughput, and highly parallel biochips, exemplified by companies like Affymetrix, which aims to immobilize corresponding probes for all human organisms onto a single chip. This development will revolutionize basic and applied research in life sciences and may trigger a new revolution in the future. The other trend is process integration, exemplified by companies like Nenogen. In practical clinical diagnostics, military, and judicial applications, high-density chips are often unnecessary; instead, moderate-density, simple, flexible, fast, low-cost, easy-to-operate, and reliable chip fabrication methods and technologies are required. Therefore, the development of medium- and low-density biochips has significant practical application value and a large potential market, potentially yielding substantial economic and social benefits. Both high-density and medium- / low-density biochips are of paramount importance in biological detection, medical testing and disease diagnosis, drug screening, and biological sequence analysis.
[0003] Oligonucleotide chips are primarily fabricated using glass or silicon wafers as carriers. In-situ synthesis and micromatrix methods are employed to sequentially arrange oligonucleotide fragments or cDNA as probes onto the carrier. Traditional inkjet in-situ oligonucleotide synthesis methods use picoliter-level liquid delivery, resulting in extremely small and easily volatile droplets that evaporate before reaching the chip surface. Current first-generation synthesis methods use acetonitrile as a solvent, which, due to its low boiling point, is highly volatile and unsuitable for inkjet printing. Therefore, there is an urgent need to develop an oligonucleotide inkjet printing method that reduces droplet evaporation. Summary of the Invention
[0004] In view of this, the purpose of this invention is to provide a method for inkjet printing oligonucleotides, which greatly avoids the reduction or failure of synthesis efficiency caused by the volatilization of inkjet reagents during the inkjet process, and effectively improves the inkjet synthesis efficiency.
[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0006] An oligonucleotide inkjet printing method includes the following steps: modifying the surface of a solid support with chemically active functional groups; depositing an oligonucleotide synthesis reagent onto the modified solid support surface by inkjet printing to perform in-situ synthesis of oligonucleotide sequences; wherein the solvent in the oligonucleotide synthesis reagent includes one or two of glutaronitrile, acetonitrile, and propylene carbonate.
[0007] Preferably, the mass-to-volume ratio of solvent to mononucleotide in the oligonucleotide synthesis reagent is 20 mL / g to 40 mL / g.
[0008] Preferably, the method for modifying the surface of the solid support with chemically active functional groups includes: sequentially modifying the surface of the solid support with piranha solution, aminosilane coupling agent ethanol solution, melamine tetrahydrofuran solution, polyethyleneimine ethanol solution, and carboxyl-protected thymidine pyridine solution.
[0009] Preferably, the volume ratio of concentrated sulfuric acid to hydrogen peroxide in the piranha solution is (0.5-2):(0.5-2); the volume percentage of the aminosilane coupling agent ethanol solution is 3%-7%; the mass-volume ratio of the melamine chloride tetrahydrofuran solution is 0.5%-2%; the volume percentage of the polyethyleneimine ethanol solution is 0.5%-2%; and the volume percentage of the carboxyl-protected thymidine pyridine solution is 0.5%-2%.
[0010] Preferably, the piranha solution modification includes ultrasonic treatment at 70-80°C for 1-3 hours.
[0011] Preferably, the ultrasonic treatment time for the aminosilane coupling agent modified with ethanol solution is 20-28 hours.
[0012] Preferably, the melamine chloride tetrahydrofuran solution modification includes: ultrasonic treatment under ice bath conditions for 0.5-2 hours.
[0013] Preferably, the polyethyleneimine ethanol solution modification includes ultrasonic treatment at 20-30°C for 0.5-2 hours.
[0014] Preferably, the carboxyl-protected thymidine pyridine solution modification includes: ultrasonic treatment at 40-60°C for 20-28 hours.
[0015] Preferably, the oligonucleotide sequence is synthesized in situ using a phosphorusamide solid-phase chemical synthesis method.
[0016] Compared with the prior art, the present invention has the following beneficial effects:
[0017] This invention provides a method for inkjet printing oligonucleotides using a non-volatile solvent, significantly reducing reagent evaporation and organic vapor generation during the inkjet synthesis process. This maintains high reaction efficiency and prevents damage to the instrument caused by organic vapors from traditional volatile organic solvents like acetonitrile. It also avoids the phenomenon where ink droplets evaporate before reaching the chip surface due to acetonitrile's volatility, preventing the successful inkjet synthesis of oligonucleotides. This method allows for high-throughput oligonucleotide sequence synthesis, enabling the synthesis of thousands of different oligonucleotide sequences on a single 1 square centimeter slide. Attached Figure Description
[0018] Figure 1 This is a flowchart of the surface modification process for solid-phase carriers.
[0019] Figure 2 This is a schematic diagram of oligonucleotide inkjet printing.
[0020] Figure 3 This is a capillary electrophoresis image of the synthesized sequence 1 in Example 3;
[0021] Figure 4 This is a capillary electrophoresis image of sequence 2 synthesized in Example 3;
[0022] Figure 5 This is a capillary electrophoresis image of sequence 3 synthesized in Example 3. Detailed Implementation
[0023] This invention provides a method for inkjet printing oligonucleotides, comprising the following steps: modifying the surface of a solid support with chemically active functional groups; depositing oligonucleotide synthesis reagents onto the modified solid support surface by inkjet printing to perform in-situ synthesis of oligonucleotide sequences; wherein the solvent in the oligonucleotide synthesis reagents includes one or two of glutaronitrile, acetonitrile, and propylene carbonate.
[0024] Oligonucleotide inkjet printing involves extremely small ink volumes, typically in the picoliter range. Therefore, the requirements for the inkjet solvent are relatively high. A suitable viscosity coefficient and low volatility are needed to ensure the stability of the inkjet synthesis. If the reagents are easily volatile, they will evaporate completely before reaching the solid support surface during inkjet printing, preventing the synthesis reaction from proceeding. The solvent described in this invention is a low-volatility solvent with a suitable viscosity, significantly reducing reagent evaporation and the generation of organic vapors during inkjet synthesis, thereby effectively improving the efficiency of inkjet synthesis.
[0025] In this invention, the method for modifying the surface of the solid support with chemically active functional groups preferably includes: sequentially modifying the surface of the solid support with a piranha solution, an aminosilane coupling agent ethanol solution, a cyanochlorotetrahydrofuran solution, a polyethyleneimine ethanol solution, and a carboxyl-protected thymidine pyridine solution; the solid support preferably includes a glass slide or a silicon wafer, more preferably a glass slide.
[0026] The piranha solution modification of the present invention preferably includes: ultrasonic treatment at 70-80°C for 1-3 hours, more preferably ultrasonic treatment at 75°C for 2 hours; the volume ratio of concentrated sulfuric acid to hydrogen peroxide in the piranha solution is preferably (0.5-2):(0.5-2), more preferably 1:1; after the modification, it is also preferably included washing with deionized water 3 times. The piranha solution modification of the present invention can hydroxylate the surface of the solid carrier.
[0027] The ultrasonic treatment time for modification with the aminosilane coupling agent ethanol solution according to the present invention is preferably 20-28 hours, more preferably 24 hours; the aminosilane coupling agent is preferably 3-aminopropyltriethoxysilane; the volume percentage of 3-aminopropyltriethoxysilane in the aminosilane coupling agent ethanol solution is preferably 3%-7%, more preferably 5%; after the modification, the process further includes washing with ethanol three times and baking in an oven at 110°C for 30 minutes. The aminosilane coupling agent ethanol solution modification according to the present invention can make the surface of the solid support active amino-amination.
[0028] The cyanochlorotetrahydrofuran solution modification of the present invention preferably includes: ultrasonic treatment under ice bath conditions for 0.5-2 hours, more preferably 1 hour; the mass-to-volume ratio of cyanochlorochloride in the cyanochlorotetrahydrofuran solution is preferably 0.5%-2%, more preferably 1%; after the modification, it further includes washing with tetrahydrofuran three times. The cyanochlorotetrahydrofuran solution modification of the present invention can chlorinate the surface of the solid support.
[0029] The polyethyleneimine ethanol solution modification of the present invention preferably includes: ultrasonic treatment at 20-30°C for 0.5-2 hours, more preferably ultrasonic treatment at 25°C for 1 hour; the volume percentage of polyethyleneimine in the polyethyleneimine ethanol solution is preferably 0.5%-2%, more preferably 1%; after the modification, the process further includes washing with ethanol three times. The polyethyleneimine ethanol solution modification of the present invention can increase the number of surface-active functional groups on the solid support.
[0030] The carboxyl-protected thymidine pyridine solution modification of the present invention preferably includes: ultrasonic treatment at 40-60℃ for 20-28 h, more preferably ultrasonic treatment at 50℃ for 24 h; the carboxyl-protected thymidine is preferably 5'-O-(4,4'-dimethoxytriphenylmethyl)-thymidine-3'-O-succinic acid; the volume percentage of 5'-O-(4,4'-dimethoxytriphenylmethyl)-thymidine-3'-O-succinic acid in the carboxyl-protected thymidine pyridine solution is preferably 0.5%-2%, more preferably 1%; after the modification, the process further includes washing three times with pyridine and three times with acetonitrile. The carboxyl-protected thymidine pyridine solution modification of the present invention enables the grafting of nucleic acid reagents onto the surface of a solid support for synthesis.
[0031] This invention discloses a method for modifying the surface of a solid support with chemically active functional groups, enabling inkjet synthesis on its surface. Through chemical modification with specific polymers, the surface nucleic acid molecule loading is significantly increased. A special compound linkage method allows for efficient inkjet synthesis of oligonucleotides on the surface, and the synthesized sequence can be cleaved from the solid support surface via a melting process. Existing oligonucleotide synthesizers use carriers packed in 96-well plates, synthesizing only 96 different types of oligonucleotides at a time. This invention employs a chip-based approach, utilizing inkjet printing technology to synthesize hundreds of thousands of oligonucleotides simultaneously, theoretically with no limit to the synthesis quantity.
[0032] In this invention, the in-situ synthesis of the oligonucleotide sequence preferably employs a phosphorous amide solid-phase chemical synthesis method. The phosphorous amide method used in this invention can complete the coupling reaction within 30 seconds, and the coupling efficiency is above 99%.
[0033] This invention preferably employs a micro-piezoelectric inkjet method to deposit nucleic acid synthesis reagents onto the surface of a solid support, following a cyclical process of: deprotection → cleaning → inkjet → cleaning → capping → cleaning → oxidation → cleaning for in-situ synthesis of oligonucleotides. The inkjet synthesis process is carried out under an inert gas environment. Because the inkjet volume in this synthesis method is extremely small, at the nanoliter level, the requirements for the inkjet solvent are relatively high. A suitable viscosity coefficient and low volatility are needed to ensure the stability of the inkjet synthesis. If the reagent is easily volatile, it will evaporate completely before reaching the surface of the solid support, preventing the synthesis reaction from proceeding.
[0034] This invention maintains high synthesis efficiency by selecting a suitable solvent system and precisely controlling the inkjet volume of nucleic acid reagents. Inkjet synthesis can synthesize sequences of at least 100 bp in length and achieve the synthesis of tens of thousands of oligonucleotides on a 1 square centimeter chip surface. Currently, first-generation synthesizers on the market can only simultaneously synthesize a maximum of 96 oligonucleotides.
[0035] The present invention preferably includes a quality control process after inkjet synthesis: solid-phase carrier surface shearing, purification, mass spectrometry, and sequencing to detect the synthesized sequence.
[0036] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0037] Example 1
[0038] Solid support surface modification
[0039] (1) A 25mm×75mm glass slide was selected as the solid substrate. The solid substrate was hydroxylated with piranha solution (concentrated sulfuric acid and hydrogen peroxide in a volume ratio of 1:1). The solid substrate was ultrasonically treated at 75℃ for 2 hours. After treatment, it was washed with deionized water 3 times before use.
[0040] (2) The surface of the glass slide in step (1) was modified with active amination by 5% 3-aminopropyltriethoxysilane ethanol solution, treated under ultrasonic conditions for 24 hours, and after treatment, it was washed with ethanol 3 times and dried in an oven at 110℃ for 30 minutes before use.
[0041] (3) Soak the glass slide from step (2) in a 1% cyanochlorotetrahydrofuran solution, sonicate it under ice bath conditions for 1 hour, and clean it with tetrahydrofuran 3 times before use;
[0042] (4) Soak the glass slide from step (3) in a 1% polyethyleneimine ethanol solution, sonicate it at room temperature for 1 hour, and then wash it with ethanol 3 times before use.
[0043] (5) Soak the glass slide from step (4) in a 1% solution of 5'-O-(4,4'-dimethoxytriphenylmethyl)-thymidine-3'-O-succinic acid pyridine, sonicate at 50°C for 24 hours, clean with pyridine 3 times and acetonitrile 3 times, and then store it in a vacuum desiccator.
[0044] Example 2
[0045] Oligonucleotide inkjet printing
[0046] (1) Glutaronitrile was selected as the solvent for nucleic acid monomers to prepare inkjet solvent, wherein 20 mL of glutaronitrile (viscosity of 2.1 mPa.s) was added for each gram of nucleic acid monomers. Other reagents in the oligonucleotide synthesis reagent were general commercial reagents.
[0047] (2) Reagent delivery was precisely controlled using inkjet printing. In situ synthesis of oligonucleotides was performed following a cyclical process: deprotection (TCA trichloroacetic acid) → washing (can acetonitrile) → inkjet printing (nucleic acid monomer, glutaronitrile) → washing (can acetonitrile) → capping (capA, capB) → washing (can acetonitrile) → oxidation (OXI iodine solution) → washing (can acetonitrile). An inkjet synthesis experiment was conducted on a 25mm × 75mm slide obtained in Example 1, with 1000 sites, for the following three sequences:
[0048] Sequence 1: CCCGTGTCGTTAGTTTTCATGCGTGTCGGTCCGGTGACCGT GAGCTGCCGTGCTTATTCG (60bp);
[0049] Sequence 2: CCCGTGTCGTTAGTTTTCATGCGTGTCGGTCCGAATGCGTGACCGTGAGCTGCCGTGCTTATTCG (65bp);
[0050] Sequence 3: CCCGTGTCGTTAGTTTTCATGCGTGTCGGTCCGATTGCAATGCGTGACCGTGAGCTGCCGTGCTTATTCG (70 bp).
[0051] Example 3
[0052] Oligonucleotide inkjet printing
[0053] The specific implementation method is the same as in Example 2, except that glutaronitrile is replaced with 4% acetonitrile and 96% glutaronitrile (viscosity 1.86 mPa·s).
[0054] Comparative Example 1
[0055] The specific implementation method is the same as in Example 2, except that glutaronitrile is replaced with acetonitrile.
[0056] Comparative Example 2
[0057] Compared with Example 1, the synthesis method is the same as that of Example 2, and the specific slide modification method is as follows:
[0058] (1) A 25mm×75mm glass slide was selected as the solid substrate. The solid substrate was hydroxylated with piranha solution (concentrated sulfuric acid and hydrogen peroxide in a volume ratio of 1:1). The solid substrate was ultrasonically treated at 75℃ for 2 hours. After treatment, it was washed with deionized water 3 times before use.
[0059] (2) The surface of the glass slide in step (1) was modified with active amination by 5% 3-aminopropyltriethoxysilane ethanol solution, treated under ultrasonic conditions for 24 hours, and after treatment, it was washed with ethanol 3 times and dried in an oven at 110℃ for 30 minutes before use.
[0060] (3) Soak the glass slide from step (4) in a 1% solution of 5'-O-(4,4'-dimethoxytriphenylmethyl)-thymidine-3'-O-succinic acid pyridine, sonicate at 50°C for 24 hours, clean with pyridine 3 times and acetonitrile 3 times, and then store it in a vacuum desiccator.
[0061] Experimental Example 1
[0062] Synthetic sequence detection
[0063] (1) Chip unchaining
[0064] After inkjet synthesis, the chip was placed in a self-made depolymerization fixture, and about 400 μL of concentrated ammonia was added to completely immerse the chip surface. The chip was then placed in a 65°C oven for depolymerization for 16 hours.
[0065] (2) Product recycling
[0066] After the dechaining apparatus has cooled to room temperature, the concentrated ammonia water is collected into a 1.5 mL centrifuge tube and concentrated to dryness in a vacuum concentrator at 60 °C. Then, 50 μL of deionized water is added and the mixture is dissolved at 4 °C for at least 1 hour before use.
[0067] (3) Product purification
[0068] 1) Add 1 / 10 volume of sodium acetate (3 mol / L) to the recovered DNA sample and mix thoroughly to make a final concentration of 0.3 mol / L.
[0069] 2) Add twice the volume of ice-cold ethanol and mix thoroughly again. Place in a -20°C freezer for at least 20 minutes.
[0070] 3) Centrifuge at 12000g for 10 minutes, carefully remove the supernatant, and aspirate all droplets from the tube wall.
[0071] 4) Add 70% ethanol to half the volume of the centrifuge tube, centrifuge at 12000g for two minutes, carefully remove the supernatant, and aspirate all droplets from the tube wall.
[0072] 5) Place the opened EP tube on the lab bench at room temperature and wait for the residual liquid to evaporate completely.
[0073] 6) Add an appropriate amount of TE buffer (PU=8.0) to dissolve the DNA precipitate.
[0074] 4. Quality Inspection
[0075] 1) The concentration of the synthesized product was detected using a Qubit 2.0 fluorometer.
[0076] 2) Calculate the synthesis efficiency using formula (1):
[0077]
[0078] Where R1 is the detection concentration of sequence 1, R2 is the detection concentration of sequence 2, R3 is the detection concentration of sequence 3, and X is the synthesis efficiency.
[0079] After concentration determination, 50 μL of product was recovered. The product concentrations and synthesis efficiencies of Examples 2 and 3 are shown in Table 1.
[0080] Table 1. Concentrations and synthesis efficiencies of each sequence product in Examples 2 and 3.
[0081]
[0082] As shown in Table 1, the solvent of this invention can significantly increase the concentration of the synthesized sequence and improve the synthesis efficiency. In Comparative Example 1, acetonitrile was used, but its high volatility prevented it from being used for inkjet printing of oligonucleotides.
[0083] Experiment Example 2
[0084] Analysis of synthetic sequence length
[0085] The length of the synthesized sequence in Example 3 was analyzed using capillary electrophoresis:
[0086] Capillary electrophoresis for detecting DNA fragment size inherently has an error margin of less than 10 bp. Specific example 3 shows the detection results as follows: Figure 3-5 As shown.
[0087] from Figure 3-5 As can be seen from the spectrum, peaks 65, 69, and 76 in the three spectra correspond to synthesized sequences 1, 2, and 3, respectively, which are within the theoretical error range. Therefore, the in-situ synthesis of oligonucleotides by inkjet printing method in Example 3 of this invention was successful.
[0088] Example 4
[0089] Synthesis of 2000 99nt oligonucleotide sequences
[0090] This embodiment further verifies the actual effect of the oligonucleotide synthesis chip designed in this invention. In this embodiment, 2000 different sequences with a length of 99nt are synthesized simultaneously in one synthesis to identify its synthesis effect.
[0091] The main operating steps are as follows:
[0092] 1. The oligonucleotide synthesis chip is placed on a self-developed automated synthesis device. This device includes a displacement platform for placing the chip base, a printhead for inkjet liquid dispensing above the chip, and a chip-pressing cavity for dispensing other synthetic reagents. After pressing the chip down, a sealed synthesis reaction chamber is formed in the chip reaction area, enabling reagent dispensing, evacuation, and chip drying. The entire automated synthesis device is located in a strictly sealed environment, facilitating the control of the anhydrous and oxygen-free environment required for the synthesis reaction.
[0093] 2. High-purity argon gas is introduced into a sealed environment to replace the gas in the sealed environment. High-precision oxygen and humidity sensors are used to monitor the oxygen and moisture content in the environment, and a pressure sensor is used to monitor the pressure in the sealed environment until the system is stable.
[0094] 3. Use a syringe pump to inject the deprotection reagent into the reaction chamber of the synthesis chip, ensuring the chamber is filled with the reagent, and incubate the reaction for 40 seconds. Then, blow in argon gas to purge the reagent from the reaction chamber.
[0095] 4. Use a syringe pump to inject cleaning reagent into the reaction chamber of the synthesized chip, and blow in argon gas to purge the cleaning reagent from the reaction chamber. Repeat this cleaning step 3 times.
[0096] 5. Using an inkjet printhead, deliver the required nucleotide reagents and solvent (propylene carbonate, viscosity: 2.5 mPa·s) to each microwell reaction chamber on the surface of the synthesis chip. The mass-to-volume ratio of solvent to mononucleotide is 20 mL / g. Then, using the inkjet printhead, deliver the activation reagent to each microwell reaction chamber on the surface of the synthesis chip and incubate the reaction for 200 s. Finally, blow in argon gas to purge the reagents from the reaction chamber.
[0097] 6. Use a syringe pump to inject cleaning reagent into the reaction chamber of the synthesized chip, and blow in argon gas to purge the cleaning reagent from the reaction chamber. Repeat this cleaning step 3 times.
[0098] 7. Using a syringe pump, inject a 1:1 volume ratio of capA and capB reagents onto the surface of the synthesized chip, ensuring a slight excess of reagents fills the chip reaction unit. Incubate the reaction for 20 seconds. Then, purge with argon gas to completely purge the reagents from the reaction unit.
[0099] 8. Use a syringe pump to inject cleaning reagent into the reaction chamber of the synthesized chip, and blow in argon gas to purge the cleaning reagent from the reaction chamber. Repeat this cleaning step 3 times.
[0100] 9. Using a syringe pump, inject iodine solution as an oxidant onto the surface of the synthesized chip, ensuring a slight excess of the reaction reagents fills the chip reaction unit. Incubate the reaction for 30 seconds. Then, purge with argon gas to completely purge the reagents from the reaction unit.
[0101] 10. Use a syringe pump to inject cleaning reagent into the reaction chamber of the synthesized chip, and blow in argon gas to purge the cleaning reagent from the reaction chamber. Repeat this cleaning step 3 times.
[0102] 11. The above c-j is a synthesis cycle. The c-j cycle is repeated according to the synthesis sequence to complete the sequence synthesis. The nucleotide reagents added in each cycle are shown in Table 2.
[0103] Table 2 Synthetic Sequences
[0104]
[0105]
[0106] 12. After synthesis, remove the synthesized chip and place it in a gas phase ammonolysis apparatus for 2 hours for lysis. Use deionized water to elute the oligonucleotides from the chip to obtain an oligonucleotide solution.
[0107] 13. The obtained oligonucleotide solution was quantified using qPCR, a next-generation sequencing library was constructed, and the quality of the synthesized 2000 sequences was analyzed using a next-generation sequencer. An overall quality standard analysis was then performed.
[0108] The composite indexes are evaluated as follows:
[0109] The probe ratio can be fully synthesized, and the higher the synthesis ratio, the higher the inkjet printing synthesis success rate (two gradients can be viewed):
[0110] (1) The proportion of probes whose full length is synthesized: that is, the proportion of the total probe data to the number of probes whose complete probe can be contained in a single read.
[0111] (2) The proportion of probes whose 95% length is synthesized: that is, the proportion of probes whose 95% length can be completely contained by a single read;
[0112] The number of reads covered by each probe reflects the reliability and accuracy of probe sequencing; the percentage of length deviation between the synthesized probe and the template; the percentage of base mismatches in the total length of the synthesized probe compared to the template; and the percentage of indel length in the total length of the synthesized probe compared to the template. Specific results are shown in Table 3.
[0113] Table 3. Synthesis Efficacy of 2000 99nt Oligonucleotide Sequences
[0114]
[0115] As shown in Table 3, the effective number of synthesized probes accounted for 77.5%, the average coverage per probe was 641, the mismatch rate of synthesized probes was 2.3%, and the indel rate was 1.7%. Based on the sequencing data, the overall inkjet printing synthesis was successful, and the novel reagents meet the requirements of inkjet printing synthesis of oligonucleotides.
[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A method for oligonucleotide inkjet printing, characterized in that, Includes the following steps: The surface of a solid support is modified with chemically active functional groups; oligonucleotide synthesis reagents are deposited onto the modified solid support surface by inkjet printing to perform in-situ synthesis of oligonucleotide sequences. The solvent in the oligonucleotide synthesis reagent is 4% acetonitrile and 96% glutaronitrile; The viscosity of the solvent is 1.86 mPa·s; The method for modifying the surface of the solid support with chemically active functional groups includes: sequentially modifying the surface of the solid support with piranha solution, aminosilane coupling agent ethanol solution, melamine tetrahydrofuran solution, polyethyleneimine ethanol solution, and carboxyl-protected thymidine pyridine solution. The volume ratio of concentrated sulfuric acid to hydrogen peroxide in the piranha solution is (0.5~2):(0.5~2); the volume percentage of the aminosilane coupling agent ethanol solution is 3%~7%; the mass-volume ratio of the melamine chloride tetrahydrofuran solution is 0.5%~2%; the volume percentage of the polyethyleneimine ethanol solution is 0.5%~2%; and the volume percentage of the carboxyl-protected thymidine pyridine solution is 0.5%~2%.
2. The method according to claim 1, characterized in that, The mass-to-volume ratio of solvent to oligonucleotide in the oligonucleotide synthesis reagent is 20 mL / g to 40 mL / g.
3. The method according to claim 1, characterized in that, The piranha solution modification includes ultrasonic treatment at 70-80℃ for 1-3 hours.
4. The method according to claim 1, characterized in that, The ultrasonic treatment time for the aminosilane coupling agent modified with ethanol solution is 20-28 hours.
5. The method according to claim 1, characterized in that, The modification with melamine chloride tetrahydrofuran solution includes ultrasonic treatment under ice bath conditions for 0.5 to 2 hours.
6. The method according to claim 1, characterized in that, The modification with the polyethyleneimine ethanol solution includes ultrasonic treatment at 20-30°C for 0.5-2 hours.
7. The method according to claim 1, characterized in that, The modification of the carboxyl-protected thymidine pyridine solution includes: ultrasonic treatment at 40~60℃ for 20~28h.
8. The method according to claim 1, characterized in that, The oligonucleotide sequence was synthesized in situ using a phosphorusamide solid-phase chemical synthesis method.
Citation Information
Patent Citations
A high-density, high-stability nucleic acid chip and its preparation method
CN107227344B
A solid-phase support for in situ synthesis of nucleic acids and its preparation method
CN110511973B
Oligonucleotide synthesis using high boiling point solvents
CN1286691A