Immunomodulatory peptide ha-cath and uses thereof
By synthesizing and applying the Chinese toad defensive peptide Ha-CATH, the problem of insufficient research on the active ingredients for skin repair in the Chinese rain frog has been solved, achieving a significant skin wound repair effect that is superior to the promoting effect of existing EGF.
Patent Information
- Application Number
- CN202310593140.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-05-24
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2043-05-24
Smart Images

Figure CN116333052B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical technology, specifically relating to an immunomodulatory peptide Ha-CATH and its applications. Background Technology
[0002] Amphibians, as a transitional type between aquatic and terrestrial vertebrates, inhabit complex and diverse environments. Their bare, smooth, hairless, and scale-covered skin presents them with numerous threats and challenges. To adapt to the complex environments of both terrestrial and aquatic habitats, amphibians have evolved a unique and powerful skin defense system. As an important physical barrier, the skin prevents microbial invasion and maintains body temperature and fluid homeostasis. Skin trauma can instantly destroy this barrier, posing a significant threat to health. Therefore, skin wound healing is crucial for maintaining the body's external barrier function. Skin wound healing is a dynamic process of self-repair and reconstruction of intact skin after tissue damage, strictly regulated by multiple cell types and numerous factors.
[0003] Amphibian skin plays a vital role in maintaining their survival and adapting to diverse habitats, providing essential protection for their well-being. Amphibian skin secretes a large number of bioactive molecules to defend against biotic and abiotic attacks from the environment. These active molecules participate extensively in various physiological activities and possess diverse pharmacological activities, such as antimicrobial, antitumor, antioxidant, and wound-healing effects. The Chinese rain frog (Symplocos chinensis) Hyla annectans It belongs to the genus *Heterodactylus* of the family Heterodactylidae in the order Anura of the class Amphibia. Currently, reports on the *Heterodactylus huaxiensis* mainly focus on its neuro-analgesic and antioxidant activities, in addition to its use as a whole in medicine to treat bruises and sprains. However, there are no reports on the identification and mechanism of its active ingredients that promote skin repair. Summary of the Invention
[0004] The first objective of this invention is to provide an immunomodulatory peptide, Ha-CATH; the second objective is to provide applications of the aforementioned immunomodulatory peptide, Ha-CATH.
[0005] The first objective of this invention is achieved as follows: the nucleotide sequence of the immunomodulatory peptide Ha-CATH is shown in the sequence listing SEQ ID NO: 1.
[0006] The immunomodulatory peptide Ha-CATH described in this invention is a cyclic polypeptide encoded by the defense peptide gene of the Chinese amphibian, the Chinese toad (Bufo gargarizans). It consists of 20 amino acid residues, has a molecular weight of 2361.8 Daltons, an isoelectric point of 6.04, and its amino acid sequence is KKTHKEECLECIITLLPEHP, as shown in SEQ ID NO:2: Lys Lys Thr His Lys Glu GluCys LeuGlu Cys Ile Ile Thr Leu Leu Pro Glu His Pro.
[0007] The gene encoding this immunomodulatory peptide precursor consists of 714 nucleotides, and its nucleotide sequence is shown in SEQ ID NO:1. Its sequence from the 5' end to the 3' end is as follows:
[0008] .
[0009] Nucleotides 445–504 are the gene encoding the mature immunomodulatory peptide Ha-CATH.
[0010] The application of the immunomodulatory peptide Ha-CATH of the present invention in the preparation of a therapeutic drug that promotes skin wound repair.
[0011] The beneficial effects of this invention are as follows: It provides a novel immunomodulatory peptide, Ha-CATH, which has a significant function in promoting skin wound repair and can be used in the preparation of drugs that promote skin wound repair. Attached Figure Description
[0012] Figure 1This is a schematic diagram showing the comparison of the immune-regulating peptide Ha-CATH promoting wound healing in mice according to the present invention.
[0013] Among them, A is an immunomodulatory peptide Ha-CATH promoting a mouse wound healing model, which is applied topically daily. Ha-CATH Image comparison after treatment with EGF and sterile water (vehicle negative control group);
[0014] B is for use at 2 mg / mL Ha-CATH Comparison of 20 µL each of polypeptide (sample treatment group), 100 mg / mL Epidermal Growth Factor (EGF, positive control group), and sterile water (Vehicle, negative control group) applied to mouse wounds;
[0015] Compared with the vehicle negative control group, Ha-CATH The skin wound area of mice treated with EGF was significantly reduced, with values representing mean ± standard deviation, ns, p>0.05, *p<0.05, **p<0.01. Detailed Implementation
[0016] The present invention will be further described below with reference to embodiments and accompanying drawings, but this does not limit the present invention in any way. Any modifications or substitutions made based on the teachings of the present invention shall fall within the protection scope of the present invention.
[0017] The nucleotide sequence of the immunomodulatory peptide Ha-CATH described in this invention is shown in the sequence listing SEQ ID NO: 1.
[0018] The amino acid sequence encoded by the immunomodulatory peptide Ha-CATH is shown in SEQ ID NO: 2.
[0019] The application of the immunomodulatory peptide Ha-CATH described in this invention is its use in the preparation of drugs that promote skin wound repair.
[0020] The invention will be further illustrated below with specific implementation examples:
[0021] Example 1
[0022] Immunomodulatory peptides Ha-CATH Chemical synthesis methods
[0023] (1) Ha was synthesized using an automated peptide synthesizer (433A, Applied Biosystems, USA). - The complete amino acid sequence of CATH was determined by high-performance liquid chromatography (HPLC) (Waters, USA). 18The synthesized sample was purified by reverse-phase column chromatography desalting. (2) The molecular weight of the synthesized sample was determined by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF). (3) The purity of the synthesized sample was identified by high-performance liquid chromatography (HPLC). The molecular weight of the chemically synthesized peptide was determined to be 2361.80 Da by MALDI-TOF, the isoelectric point of the synthesized peptide was determined to be 6.04 by isoelectric focusing electrophoresis, and the purity of the synthesized sample was determined to be >95% by HPLC. The amino acid sequence structure of the synthesized Ha-CATH was confirmed to be consistent with that of natural Ha-CATH by an automated amino acid sequencer.
[0024] Example 2: Gene Cloning of the Immunomodulatory Peptide Ha-CATH
[0025] (1) Total RNA extraction from the skin of the West China Rain Frog:
[0026] Rinse the skin on the back of the *Heliotropium indicum* with deionized water, then flash-freeze in liquid nitrogen for 10 hours. Take 100 mg of skin tissue, add 1 ml of Trizol solution, and homogenize in a 20 ml glass homogenizer for 30 minutes. Add an equal volume of phenol / chloroform solution, mix vigorously, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, and discard the precipitate. Add an equal volume of isopropanol to the supernatant, incubate at room temperature for 10 minutes, centrifuge at 12000 rpm for 10 minutes at 4°C, wash the precipitate once with 75% ethanol, air dry, and the precipitate at the bottom of the tube is the total RNA from the skin.
[0027] (2) Construction of the skin cDNA library of the Chinese rain frog:
[0028] Using CLONTECH's Creator TM SMART TM cDNA Library Construction Kit: Follow the instructions in the manual for specific operation.
[0029] Using CLONTECH's Creator TM SMART TM The cDNA Library Construction Kit is a plasmid-cDNA library construction kit. Follow the instructions carefully. Use SMARTScribe. TMFirst-strand cDNA was synthesized using reverse transcriptase, SMARTer V oligonucleotides, and 3' In-Fusion SMARTer CDS primers. Second-strand cDNA was synthesized using long-distance PCR with Advantage 2 Polymerase Mix, 5' PCR primer IIA, and 3' In-Fusion SMARTer PCR primers. The synthesized second-strand cDNA was used as a template for the following PCR to screen for cDNA encoding the polypeptide (Ha-CATH).
[0030] (3) Screening of Ha-CATH gene clones for the immunomodulatory peptide:
[0031] Based on the reported highly conserved cathelin domain sequence of amphibian cathelicidins, a 3' reverse primer Nv-CATH-R1 (5'-WSCRCAGRYCTTCACCTCC-3' (W=A / T; S=G / C; R=A / G; Y=C / T) was designed and combined with the 5' PCR primer (5'-AAGCAGTGGTATCAACGCAGAGT-3') provided in the kit to amplify the 5' fragment of the cDNA encoded by cathelicidin. PCR conditions were: 95°C pre-denaturation for 2 min, 94°C denaturation for 30 s, 52°C annealing for 40 s, 72°C extension for 45 s, repeated 30 times, followed by a final extension at 72°C for 10 min. The PCR product was purified by gel electrophoresis and cloned into the pMD19-T vector (Takara, Japan) for DNA sequencing.
[0032] Based on the 5' end sequence obtained from sequencing, primer 5'-CCATGAGGAGCTGGTGGCTGT-3' was designed and used in conjunction with the 3' PCR primer 5'-ATTCTAGAGGCCGAGGCGGCCG-3' from the library preparation kit for PCR amplification under the same conditions as above. After amplification, the target fragment was recovered using a DNA gel extraction kit, and the band size was verified by gel electrophoresis. The gel-extracted product was ligated overnight with the pMD18-T vector and transformed into *E. coli* DH5α competent cells prepared using the calcium chloride method. The next day, single clones were picked for colony PCR, and positive clones were screened for inoculation and plasmid extraction. Subsequently, the plasmid fragment size was verified by agarose gel electrophoresis, and plasmids corresponding to the correct band size were sequenced.
[0033] (4) Sequence determination of the immunomodulatory peptide Ha-CATH gene:
[0034] Plasmid DNA was extracted and its nucleotide sequence was determined using the dideoxy sequencing method. The instrument used was an Applied Biosystems 373A fully automated nucleotide sequencer, and the sequencing primers were BcaBEST. TM Sequencing Primer RV-M and BcaBEST TM Sequencing Primer M13-47, BcaBEST TM Sequencing Primer RV-M sequence: 5`GAGCGGATAACAATTTCAC ACAGG 3', BcaBEST TM Sequencing Primer M13-47: 5'CGCCAGGGTTTTCCCAGTCACGAC 3'.
[0035] Gene sequencing results show that the gene encoding the immunomodulatory peptide precursor of the Chinese tree frog consists of 714 nucleotides (SEQ ID NO: 1) (GenBank Accession Number: OQ992774), and the sequence from the 5' end to the 3' end is as follows:
[0036] .
[0037] Nucleotides 445–504 are the gene encoding the mature immunomodulatory peptide Ha-CATH.
[0038] Example 3 Chemical Synthesis Method of Immunomodulatory Peptide Ha-CATH
[0039] (1) Ha was synthesized using an automated peptide synthesizer (433A, Applied Biosystems, USA). - The complete amino acid sequence of CATH was determined by high-performance liquid chromatography (HPLC) (Waters, USA). 18 The synthesized sample was desalted and purified by reverse-phase column chromatography;
[0040] (2) The molecular weight of the synthesized sample was determined by matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF).
[0041] (3) The purity of the synthesized sample was identified by high performance liquid chromatography (HPLC). The molecular weight of the chemically synthesized peptide was determined to be 2361.80 Da by MALDI-TOF, and the isoelectric point of the synthesized peptide was determined to be 6.04 by isoelectric focusing electrophoresis. The purity of the synthesized sample was determined to be >95% by HPLC. The amino acid sequence structure of the synthesized Ha-CATH was confirmed to be consistent with that of natural Ha-CATH by an automated amino acid sequencer.
[0042] Example 4: Application of the immunomodulatory peptide Ha-CATH in the preparation of a drug for promoting skin wound repair.
[0043] Six-week-old BALB / c mice (20-30g) were anesthetized with 1% sodium pentobarbital (0.1mL / 20g), and the hair on the mid-back was removed and disinfected with alcohol swabs. Two symmetrical circular full-thickness excision wounds, each 8 mm in diameter, were made on the back using a skin biopsy device. Each mouse's back wound was infused with 20 μL of the antimicrobial peptide Ha-CATH (20 μL, 2 mg / mL), sterile water (20 μL), and Epidermal Growth Factor (EGF, 20 μL, 100 mg / mL) as negative and positive controls, respectively. Each mouse was placed in a separate cage to prevent wound contact infection. During rearing, ample food and water, suitable temperature and humidity, and 12 h / 12 h light were provided. Administered medication once daily at a fixed time, and wound healing was recorded. Wound healing was observed and photographed on postoperative days 0, 2, 4, and 8.
[0044] The results are as follows Figure 1 As shown: Compared with the vehicle group, both the Ha-CATH treatment group and the positive control EGF group effectively promoted wound healing in mice. Figure 1 A). The wound healing rates on days 2, 4, 6, and 8 in the Ha-CATH group were 57.68%, 66.67%, 82.67%, and 93%, respectively; in the vehicle group, they were 25.45%, 35.23%, 37.31%, and 53.9%; and in the EGF group, they were 50.67%, 51.95%, 67%, and 75.31%. Figure 1(B) Around day 8, the wounds in the treatment group had largely healed, showing a significant difference compared to the control group. The experimental results indicate that the immunomodulatory peptide Ha-CATH has a significant effect on promoting skin wound healing, and its effect is better than that of epidermal growth factor (EGF). The immunomodulatory peptide Ha-CATH can be used in the preparation of drugs that promote skin wound repair.
[0045] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An immunomodulatory peptide, Ha-CATH, characterized in that, The nucleotide sequence encoding the immunomodulatory peptide Ha-CATH is shown in the sequence listing SEQ ID NO: 1; The amino acid sequence of the immunomodulatory peptide Ha-CATH is shown in SEQ ID NO:
2.
2. The application of the immunomodulatory peptide Ha-CATH according to claim 1, characterized in that... The application of the immunomodulatory peptide Ha-CATH in the preparation of drugs that promote skin wound repair.
Citation Information
Patent Citations
R. grahami rnmunoregulating polypeptide, gene and variant and its application in medicine production
CN101037473A
Analgesic peptide FI, gene of same, and applications thereof
WO2014198095A1