Construction method of homologous silencing system of bud dormancy gene of peony plant

By constructing a homologous silencing system for bud dormancy genes in peony plants, the VIGS operation problem caused by the large underground rhizome system of peony plants was solved, and the function of bud dormancy genes in peony plants was efficiently verified, which promoted germplasm innovation in southern China.

CN116334131BActive Publication Date: 2026-04-10ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310283596.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-03-22
Publication Date
2026-04-10
Estimated Expiration
2043-03-22

AI Technical Summary

Technical Problem

The underground rhizome system of peony plants is large and prone to decay, making it difficult to perform virus-induced gene silencing (VIGS) operations. This leads to difficulties in verifying the function of genes related to bud dormancy, which affects the innovation of germplasm in southern regions.

Method used

By designing primers based on the full-length transcriptome of dormant peony underground buds, constructing Agrobacterium tumefaciens with the pTRV vector, miniaturized bacterial culture and low-temperature treatment, combined with specific culture conditions, a homologous silencing system for bud dormancy genes in peony plants was achieved.

Benefits of technology

This study enabled efficient verification of the function of bud dormancy genes in peony species, promoted research on the molecular mechanism of dormancy characteristics in peony species, and supported germplasm innovation in southern China.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116334131B_ABST
    Figure CN116334131B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of plant gene function, and aims to provide a construction method of a homologous silencing system of a Paeonia lactiflora bud dormancy gene, comprising the following steps: designing amplification primers according to gene annotation and a conserved sequence region in a Paeonia lactiflora bud dormancy full-length transcriptome, and constructing a conserved sequence fragment of a target gene into Agrobacterium tumefaciens containing a pTRV vector; taking a rhizome of a treated Paeonia lactiflora annual seedling as an infection material, and placing the infection material in Agrobacterium tumefaciens liquid containing pTRV1, pTRV2 and pTRV2-target gene fragments to perform infection treatment; potting the rhizome and moving the rhizome into a culture room to perform culture, observing phenotype and expression amount differences between the rhizome and a control group in a growth process, and confirming that the homologous silencing system is successfully constructed. The present application first completes miniaturization treatment and batch bacterial liquid infection of an underground rhizome system of Paeonia lactiflora, establishes a virus-mediated homologous function silencing system of a Paeonia lactiflora bud dormancy gene, and realizes the purpose of verifying functions of bud dormancy and even germination and growth related genes.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of plant gene function research, and particularly relates to a construction method of a homologous silencing system of a bud dormancy gene of a Paeonia lactiflora plant. BACKGROUND

[0002] The Paeoniaceae family only has the Paeonia genus, which is mainly composed of the Sect.Paeonia and the Sect.Moutan. The former are all herbaceous plants, and the latter are all woody plants. Among them, the Sect.Paeonia contains more than 30 kinds of Paeonia lactiflora, P.obovata, P.mairei, P.anomala and other bulbous-root ornamental plants, which have important ornamental, medicinal, oil and tea values. The Paeonia lactiflora is a traditional Chinese flower and a world famous flower. Most of the Paeonia plants prefer cold and dry conditions, and are mainly produced in North China, Northwest China and Northeast China. After the temperature decreases in autumn, the Paeonia plants enter a dormant period, the aboveground stems and leaves begin to wither, and the dormant buds on the underground storage organs such as rhizomes survive the winter. The buds go through the physiological dormancy caused by endogenous factors and the ecodormancy induced by external environment, germinate in the spring of the next year, sprout and bloom, and then wither and enter dormancy again in autumn.

[0003] The winter temperature in most of the Jiangnan, South China and central regions of China is relatively high, and the cold accumulation cannot be met, which easily causes the physiological dormancy of buds to be removed, seriously affects the germination and growth in the spring of the next year, and finally leads to the obstruction of flowering and fruiting, and the serious degradation of rhizomes. Climate warming also aggravates the severity of the problem, which is the main limiting factor for breeding Paeonia plant varieties in southern China.

[0004] It is the key work to breed Paeonia plant varieties in southern China to study the physiological dormancy release mechanism of Paeonia buds, especially to explore the functions of physiological dormancy related genes of the buds, and to select low cold requirement germplasm with a short physiological dormancy period by means of molecular breeding and other means on the basis. With the global climate anomaly, the research on bud dormancy related genes has become a hot field in international plant science research. However, it is very difficult to construct a genetic transformation system of Paeonia plants, and it has not been realized to verify the functions of various genes by means of overexpression technology after homologous transgene.

[0005] In recent years, the transient homologous verification mainly by virus-induced gene silencing (VIGS) has been gradually applied to the Paeoniaceae plants including Paeonia. VIGS is a post-transcriptional gene silencing phenomenon, which can cause specific degradation of endogenous mRNA sequences, so as to verify the gene function through the changes in plant phenotype or physiological indicators. The VIGS technology has the advantages of rapidness, high efficiency, high throughput and the like, and is widely applied to the functional gene researches in the aspects of plant growth and development, disease and insect resistance, metabolic regulation and the like, and is also preliminarily applied to the gene function verification related to flower color formation, flower stem strength and plant resistance of Paeoniaceae plants. However, if the functional verification is carried out on the bud dormancy related genes of Paeonia plants, the Agrobacterium tumefaciens liquid immersion needs to be carried out on the underground rhizome, and the whole VIGS operation is completed. However, the underground rhizome system of adult Paeonia plants is very large, and the fleshy rhizome is easy to rot, so it is difficult to complete the liquid immersion operation.

[0006] Therefore, it is necessary to establish a simple, efficient and reasonable VIGS gene silencing system, which can significantly promote the molecular mechanism research of the dormancy characteristics of Paeonia plants, and has important theoretical and practical significance for the southern germplasm innovation of Paeonia and other traditional Chinese flowers. SUMMARY

[0007] The technical problem to be solved by the present application is to overcome the defects in the prior art, and to provide a construction method of a homologous silencing system of bud dormancy genes of Paeonia plants.

[0008] To solve the technical problem, the solution of the present application is:

[0009] The present application provides a construction method of a homologous silencing system of bud dormancy genes of Paeonia plants, characterized in that the method is based on the uniqueness of the full-length transcriptome of the underground bud dormancy of Paeonia, and the large underground rhizome system of Paeonia herbaceous plants is miniaturized during the bacterial liquid infection, so as to realize the functional silencing research of bud dormancy regulation genes; and the method specifically comprises the following steps:

[0010] (1) designing amplification primers according to the gene annotation and conserved sequence region in the full-length transcriptome of Paeonia bud dormancy; cloning the conserved sequence fragment of the target gene by using the amplification primers, and constructing the conserved sequence fragment into Agrobacterium tumefaciens containing a pTRV vector;

[0011] The full-length transcriptome of Paeonia bud dormancy is global shared data published on the NCBI website, and the accession number is PRJNA487256; the source is the three-generation full-length transcriptome during the bud dormancy of Paeonia and the two-generation transcriptome data at different bud dormancy periods obtained by combining the single molecule real-time and second-generation sequencing technologies, and the specific content includes sequence full length, functional annotation and expression amount result.

[0012] (2) In early September to mid-October, the rhizomes of Paeonia lactiflora annual seedlings are selected, the above-ground residual stems and leaves are removed and 1-3 underground dormant buds are retained; after being potted, they are transferred to a cold storage at 4℃ for 3-5 weeks of light-free low-temperature treatment;

[0013] (3) The rhizomes after low-temperature treatment are taken out, washed and all the root hairs are removed; after a plurality of small holes are made at the base of the bud scale of the top dormant bud of the rhizome, the rhizome is used as the prepared infection material;

[0014] (4) Agrobacterium tumefaciens liquid containing pTRV1, pTRV2 and pTRV2-target gene fragment is prepared, and the infection material is placed in the liquid for infection treatment; the rhizome is potted and moved into a culture room for culture, and the phenotype and expression difference from the control group in the growth process are observed to confirm that the homologous silencing system is successfully constructed.

[0015] As a preferred scheme of the present application, in the step (2), all herbaceous Paeonia lactiflora germplasm in the Paeonia lactiflora family that can normally seed and whose seeds can germinate and develop into rhizomes in the next year are selected.

[0016] As a preferred scheme of the present application, in the step (2), the annual seedling rhizome refers to a fleshy finger-shaped rhizome containing dormant buds at the top, which is formed in summer and autumn after sowing in the previous year, winter dormancy and spring germination in the next year.

[0017] As a preferred scheme of the present application, in the step (2), the rhizome is selected according to the following standards: the root length is 8-12 cm and the root thickness is 0.6-1.2 cm; there is only one obvious main root without or with few lateral root branches, and the root hairs are rich; the root part is free of diseases, pests and mold decay, and the upper part of the root neck has 1-3 dormant buds.

[0018] As a preferred scheme of the present application, in the step (2), early September to mid-October is the best period for low-temperature treatment of Paeonia lactiflora; during this period, the above-ground stems and leaves of Paeonia lactiflora have withered, ending the previous annual cycle; and the daily average temperature is relatively high during this period, which can ensure that the low-temperature treatment is carried out under the premise that the cold accumulation is zero, and ensure that the cold accumulation obtained by the rhizome comes from artificial quantitative low-temperature treatment.

[0019] As a preferred scheme of the present application, in the step (2), if the function of the target gene to be infected is estimated to inhibit dormancy release, the 4℃ low-temperature treatment time is controlled to be 3-4 weeks; if the function of the target gene to be infected is estimated to promote dormancy release, the 4℃ low-temperature treatment time is controlled to be 4-5 weeks.

[0020] As a preferred scheme of the present application, in the step (3), all the root hairs on the small stems are removed before infection, which facilitates the subsequent statistics of the long roots; the depth of the puncture part by the syringe needle is 0.5 cm, which is the joint between the bud scale base and the main part of the small stem; the bud cannot be directly punctured to prevent ulceration.

[0021] As a preferred scheme of the present application, in the step (4), the specific operation of the infection treatment comprises:

[0022] (1) A 1L beaker is used to hold the bacterial solution of Agrobacterium tumefaciens GV3101, and a plurality of root stems are arranged in the beaker in a longitudinal manner with the head upwards and the root downwards, and the highest part of the root stem should be lower than the upper edge of the beaker by 5 cm or less; the parts to be infected, including the root stem, the dormant bud at the top and the puncture part, should all be submerged in the bacterial solution;

[0023] (2) The beaker is moved to a vacuum pumping device, and a vacuum pump is started to pump vacuum and keep for at least 30 minutes, and then the air is released for 20 minutes.

[0024] As a preferred scheme of the present application, in the step (4), when the root stem is cultured, it is divided into two stages:

[0025] (1) First, dark culture for 3 days under the condition of humidity 60% and temperature 20-21℃;

[0026] (2) Adjust to alternate dark culture and light culture, control humidity 60%; when light culture, temperature 25℃, light 4000lxs, time length 14-16h; when dark culture, temperature 18℃, time length 10-8h.

[0027] Principle of the invention:

[0028] Homologous verification by transgenic overexpression is an important method for studying gene function, but the application results in the research of peony and other herbaceous plants are extremely rare. Because there are problems such as easy pollution, browning, and vitrification in the tissue culture of peony and other plants, it is difficult to construct a genetic transformation system. In addition, the efficiency of transgenic overexpression on peony callus and bottle seedlings is very low, and the survival rate of transplanting after being taken out of the bottle is lower. Therefore, there are still many technical bottlenecks in the practical operation content for studying the gene function of peony and other plants by using transgenic technology.

[0029] With the development of molecular biology experiments, virus-induced gene silencing (VIGS) and other homologous transient verification began to be used in plants with difficult genetic transformation systems. This is a post-transcriptional gene silencing phenomenon, which uses a virus vector (such as tobacco rattle virus, tobacco rattle virus, TRV) carrying the target gene sequence to infect the target plant. With the replication and transcription of viral nucleic acid in host cells, the target mRNA sequence short fragments complementary to it can be specifically degraded or methylated, causing the loss or variation of the target gene function, causing changes in plant phenotype and physiological level, and ultimately determining the function of the target gene. Plants silenced by VIGS technology cannot inherit the changed traits, but the gene function can be verified by short-term phenotype and physiological observation, which does not rely on transgenic operation and has the advantages of rapidness, high efficiency, high throughput, etc.

[0030] In recent years, VIGS has been preliminarily applied in gene function homologous verification of Paeoniaceae plants such as peony and Japanese peony, but it is mostly concentrated in the functional research of anthocyanin, flower stem strength and resistance related genes. The tissues infected by the virus are mostly petals, leaves and stems, which are tissues generated during the growth period of Paeoniaceae plants, have small volume, and are easy to operate by soaking in the infection solution; and because of direct soaking of the target tissue itself, it is easy to cause changes in petal color, flower stem strength, and differences in leaf damage, etc. However, it is very difficult to use VIGS technology to carry out functional research on bud dormancy related genes of Paeoniaceae plants. The aboveground stems and leaves of Paeoniaceae plants wither during dormancy, and VIGS operation of bud dormancy genes can only be performed on the underground rhizome system, and the function of the genes can be determined by the germination of the dormant buds the next year.

[0031] However, although the idea of infecting the underground rhizome system of Paeoniaceae plants with bacteria is simple, the actual operation is very difficult, which is the main reason for limiting the application of this technology in the study of bud dormancy of Paeoniaceae plants.

[0032] Most species of Paeonia are perennial plants with a large rhizome system, and a few species are bulbous plants. The rhizome system is composed of a multi-branched fleshy underground stem and a large number of root hairs. For example, the 2-year-old Paeonia lactiflora rhizome often has 2-4 lateral root branches, the root length is more than 15 cm, and the root diameter is usually 1.5-2.0 cm or more. The underground main root of 3-4-year-old semi-mature Paeonia lactiflora can reach more than 20 cm. The underground main root of 5-6-year-old mature Paeonia lactiflora plants that bloom profusely can reach more than 40 cm, with a diameter of 5-8 cm, and the lateral root branches are often polarized, and the root hairs are also extremely numerous. After the large rhizome system is excavated, the matrix on the surface of the rhizome needs to be removed and cleaned, and a sufficient amount of rhizome needs to be placed in a larger container for infection. Therefore, it is difficult to implement the operation of submerging the rhizome in the infection solution and vacuum extraction in the actual scene. More importantly, the fleshy root system of mature Paeonia lactiflora plants has a high water content, and after the infection, disinfection, and potting, the roots will rot seriously, which will lead to the death of the plants and the difficulty in obtaining the ideal phenotype, thereby failing to complete the functional verification of the bud dormancy gene.

[0033] Therefore, the "miniaturization" of the Paeonia lactiflora rhizome system can enable batch operations such as bacterial liquid infection in a reasonable and limited space, which is a key technical problem that must be overcome to realize the VIGS technology. The present application realizes the VIGS technology system for constructing the functional verification of the bud dormancy, germination, and growth-related genes of Paeonia lactiflora plants by improving the low-temperature treatment process of the rhizome, the plasmid construction process, the infection detail operation, and the post-care conditions.

[0034] Based on the above principles, the applicant's research and development team overcomes the limitations of the prior art and applies the TRV-VIGS system to the functional research of the Paeonia lactiflora bud dormancy gene. By determining the reasonable Paeonia lactiflora infection receptor, the low-temperature treatment period and duration, the plasmid construction detail operation, the bacterial liquid infection method, the post-care conditions, and the observation index selection, the technical problem of the VIGS operation of Paeonia lactiflora herbaceous plants due to the large rhizome system is effectively solved. The technical solution of the present application is suitable for more than 30 perennial herbaceous flowers including Paeonia lactiflora, which helps to accurately verify the gene function of Paeonia lactiflora plant bud dormancy and analyze the molecular regulation mechanism, and promotes the molecular breeding and germplasm innovation of Paeonia lactiflora and other traditional Chinese flowers.

[0035] In the present application, the inventor team creatively proposes two solutions: first, based on the uniqueness of the full-length transcriptome of Paeonia lactiflora underground bud dormancy, the complete sequence, annotation and expression results can provide convenience for primer design, gene cloning and sequencing verification in the study of the silencing of bud dormancy related functional genes of Paeonia lactiflora; second, the combination of annual small rootstock Paeonia lactiflora plants and conventional volume containers in the laboratory (such as ordinary beakers not larger than 1L) realizes efficient and convenient miniaturization operation of large rootstock system during bacterial liquid infection, which is the core innovative content of the present application.

[0036] Compared with the prior art, the present application has the following beneficial effects:

[0037] 1. The present application uses the annual rootstock developed from the seeds sown in the next year as the infection receptor, which first completes the miniaturization treatment and batch bacterial liquid infection of the large underground rootstock system of Paeonia lactiflora plants in the industry, and establishes a virus-mediated Paeonia lactiflora bud dormancy gene homologous functional silencing system, which can realize the verification of the functions of bud dormancy and even germination and growth related genes.

[0038] 2. Although the present application uses Paeonia lactiflora as a template material, its results can also be applied to Paeonia lactiflora plants, i.e. more than 30 species of herbaceous plants of Paeonia lactiflora group of Paeonia lactiflora family.

[0039] 3. The present application can significantly promote the molecular mechanism research of dormancy characteristics of Paeonia lactiflora plants, and has important theoretical and practical significance for the southern germplasm innovation of Paeonia lactiflora and other traditional Chinese flowers. BRIEF DESCRIPTION OF DRAWINGS

[0040] Figure 1 is an example diagram of the core operation link of the present application, i.e. the process of placing the annual seedling rootstock into an ordinary system beaker for infection: (A) arrangement and length measurement of the infection receptor small rootstock; (B) 4℃ low temperature treatment; (C) white root growth after treatment, the root must be removed before infection, which grows at this time and is beneficial for observation; (D) hole punching at the base of bud scale; (E) longitudinal placement of small rootstock into a large beaker; (F) and (G) Agrobacterium infection, compared with adult large root system, this part realizes the infection and gene silencing of the “miniaturized” rootstock and dormant bud, which is the key step of the present application; (H) vacuum extraction, squeezing the bacterial liquid into the small rootstock receptor; (I) culture in the culture room, waiting for the appearance of the phenotype.

[0041] Figure 2 is the phenotype difference of the dormancy bud germination of ‘Huangbai Paeonia lactiflora’ after DAM and ABI5 gene silencing.

[0042] Figure 3 is the expression amount of DAM and ABI5 genes after silencing under the empty control. DETAILED DESCRIPTION

[0043] The Paeonia lactiflora bud dormancy full-length transcriptome described in the present application is based on 3 Paeonia lactiflora varieties 'Hangbai-shaoyao', 'Zhu-guang' and 'Mei-ju' from different regions in south and north China, underground bud samples collected at 8 important dormancy stages from autumn and winter to the next spring, and the Paeonia lactiflora underground bud dormancy three-generation full-length transcriptome and second-generation transcriptome data obtained by joint sequencing using Single Molecule Real-Time Sequencing (SMRT Sequencing) technology and Next Generation Sequencing (NGS) technology, which can provide complete sequences, accurate annotations and expression results for functional gene selection and primer design. The transcriptome data has 630G and has been uploaded to the NCBI website (accession number PRJNA487256), which is a global shared data.

[0044] The homologous silencing system construction method for Paeonia lactiflora bud dormancy genes provided by the present application is based on Paeonia lactiflora, but can also be applied to more than 30 herbaceous plants in Paeonia lactiflora, i.e., more than 30 herbaceous plants in Paeonia lactiflora of Paeoniaceae Paeonia lactiflora.

[0045] The method specifically comprises the following steps:

[0046] (1) Selecting silencing materials

[0047] The silencing material used in the present application is the rhizome of annual seedling of Paeonia lactiflora. It is confirmed by repeated experiments of the inventor team that all Paeonia lactiflora germplasm (varieties or wild species) which can normally set seeds, seed germination and develop into rhizomes in the next year can be used as experimental materials of the present application. The Paeonia lactiflora germplasm of high petal type and palace type mostly does not set seeds, or sets seeds but the seeds do not germinate, and thus is not suitable for being used as silencing materials.

[0048] (2) Preparing high-quality rhizomes

[0049] The infected material is the rhizome of annual seedling, i.e., the fleshy finger-shaped rhizome with 1-3 dormant buds at the top formed in the next summer and autumn after sowing in the previous year, winter dormancy and spring germination in the next year. Figure 1 A).

[0050] The best selection of the rhizome used in the present application is as follows: 1) the root length is 8-12 cm and the root thickness is 0.6-1.2 cm; 2) there is only one obvious main root without or with few lateral root branches, and the root hairs are rich; 3) there is no disease, insect and mold rot at the root part, and the withered stems and leaves are removed completely; and 4) there are 1-3 dormant buds at the upper part of the rhizome.

[0051] Peonies will enter the natural withering period of their above-ground stems and leaves in August and September. At this time, remove the above-ground stems and leaves of the one-year-old rhizomes, put them in a 1-gallon pot, plant 3-5 rhizomes in each pot, and place them outdoors to experience natural light and temperature and other environmental factors, while waiting for subsequent low-temperature treatment.

[0052] (3) Low temperature treatment conditions

[0053] The best time to move potted rhizomes into the freezer is between early September and mid-October, during which time repotting is possible. For one-year-old rhizomes, the time to remove the above-ground stems and leaves can be either August or between early September and mid-October, but repotting must be completed within this period.

[0054] Artificial low-temperature processing environments can be achieved using a 4°C climate chamber or freezer. Figure 1 B) Treat the potted rhizomes in the dark at low temperatures for 3-5 weeks. Generally, peony plants will meet their chilling requirements and complete physiological dormancy after 4 weeks of treatment at 4℃. If the target gene is predicted to inhibit dormancy release, treat for 3-4 weeks; if it is predicted to promote dormancy release, treat for 4-5 weeks.

[0055] Early September to mid-October is the optimal time for low-temperature treatment to break the dormancy of peony buds. In most parts of the country, this period coincides with the relatively warm late summer or early autumn, when the above-ground stems and leaves of peonies have withered, ending the previous year's cycle; at the same time, the underground buds have not yet entered their physiological dormancy period, and the effective accumulated cold temperature for breaking dormancy is zero. This ensures that the accumulated cold temperature in the later stages all comes from artificial low-temperature treatment, which is conducive to providing different types of cold-accumulated rhizome materials for gene silencing.

[0056] (4) Cloning the target gene fragment

[0057] Based on the data annotation of the whole-length transcriptome of Paeonia lactiflora as the conserved region of the target gene transcript, amplification primers with a product length of approximately 200-300 bp were designed; and recognition bases for restriction endonucleases Xba I and SacI, as well as protective base sequences GCTCTAGA and CGAGCTC, were added to the 5' ends of the forward and reverse primers, respectively.

[0058] RNA was extracted from peony and reverse transcribed into cDNA. The target gene fragment was amplified by PCR using the primers described above. The PCR product was recovered by electrophoresis and gel excision. The pEASY-blunt vector was ligated and transformed into E. coli DH5α competent cells. After overnight incubation at 37°C in the dark, single clones were picked and identified by PCR using the primers provided with the vector. Positive clones were then confirmed by sequencing.

[0059] (5) Constructing Agrobacterium tumefaciens containing the pTRV vector of the peony target gene

[0060] Tobacco rattle virus (TRV) was selected as a vector of the target gene, and the PCR product containing the target gene fragment of Paeonia lactiflora obtained in the previous step was cloned into a plasmid, and the plasmid and pTRV2 plasmid were subjected to enzyme cutting with Xba I and Sac I two restriction endonucleases under the condition of 37 °C for 40 min; the target gene and the pTRV2 vector were subjected to electrophoresis and gel recovery, and the recovered fragments were subjected to ligation with T4 DNA ligase under the condition of 16 °C for 3 h;

[0061] The ligation product was transformed into E. coli DH5a competent cells, and after dark culture at 37 °C overnight, a single colony was picked and subjected to positive single colony PCR detection with primers pTRV2-F (5'-TGGGAGATGATACGCTGTT-3') and pTRV2-R (5'-CCTAAAACTTCAGACACG-3') designed according to the sequences on both sides of the vector cutting site; the obtained positive clone plasmid was extracted and transformed into Agrobacterium tumefaciens GV3101 using the freeze-thaw method, and after dark culture at 28 °C for two days, a single colony was picked and subjected to positive single colony PCR detection with primers pTRV2-F and pTRV2-R.

[0062] (6) Preparation of Agrobacterium tumefaciens bacterial solution

[0063] Agrobacterium tumefaciens GV3101 bacterial solution containing pTRV1, pTRV2 and pTRV2-target gene fragment was added to 5 mL Luria-Bertani (LB) medium containing 50 mg / L kanamycin and 50 mg / L rifampicin, and was placed in a shaker for 16 h of shaking culture at 28 °C and 200 rpm, and was then transferred to 150 mL LB liquid medium containing 50 mg / L kanamycin, 50 mg / L rifampicin, 10 mM MES (2-morpholinoethanesulfonic acid) and 20 μM AS (adenosine sulfate), and was placed in a shaker for 16 h of shaking culture at 28 °C and 200 rpm; when the OD 600 of the bacterial solution was 1.5-2.0, the bacterial bodies were collected after centrifugation at 4000 rpm and 25 °C for 10 min.

[0064] The bacterial bodies were resuspended in 150 mL of infection buffer containing 10 mM MgCl2, 10 mM MES and 200 μM AS; Agrobacterium tumefaciens GV3101 bacterial solution containing pTRV1 and Agrobacterium tumefaciens GV3101 bacterial solution containing pTRV2 were mixed in a volume ratio of 1:1 (used as a reference system); Agrobacterium tumefaciens GV3101 bacterial solution containing pTRV1 and Agrobacterium tumefaciens GV3101 bacterial solution containing pTRV2-target gene fragment were mixed in a volume ratio of 1:1; and the mixture was activated at 25 °C in the dark for 4 h.

[0065] (7) Agrobacterium tumefaciens-mediated infection of peony rhizomes and post-infection culture

[0066] Remove the rhizomes of potted peony plants that have been treated at 4℃ for 3-5 weeks. Before infection, remove the substrate adhering to the surface of the rhizomes, wash and dry them, then use tweezers to remove all white fibrous roots. This operation ensures that the number of sprouts and fibrous roots on the rhizomes is zero before infection, making it easier to count the number of sprouts and roots after cultivation in the culture room. Figure 1 C) To assess the effects of gene silencing on rhizome germination and rooting, thereby confirming the gene's regulatory function in breaking bud dormancy.

[0067] At the junction of the dormant bud scale base and the fleshy main body of the rhizome at the top of the rhizome, make 2-3 small holes with a standard 1ml syringe needle (to facilitate the penetration of the bacterial solution) as backup infection material. When making the holes, maintain a reasonable depth; do not insert them too deeply or penetrate the rhizome. The holes should not be made on the bud scale itself to avoid damaging the tender stem and leaf structures inside the bud scale. Figure 1 D).

[0068] The material was treated with a mixed Agrobacterium tumefaciens GV3101 bacterial solution.

[0069] (a) 1) Use a suitable container (such as a 1L or larger beaker) to hold the Agrobacterium tumefaciens bacterial solution. Arrange multiple rhizomes longitudinally in the beaker with the head facing upwards and the roots downwards. The highest point of the rhizomes should be at least 5cm below the top edge of the beaker. The areas to be infected, including the rhizomes, the dormant buds at the top, and the punctured areas, should all be submerged in the bacterial solution. The rhizomes will stand upright on their own after filling the beaker, without the need for any support. Figure 1 EG).

[0070] (b)2) Transfer the container to the vacuum pump and start the vacuum pump to evacuate to -0.9 kg / cm². 2 Maintain a pressure of -0.09 MPa for at least 30 minutes, then slowly release the gas, ensuring the release is complete after 20 minutes. Figure 1 H).

[0071] This step is the key part of the invention. By miniaturizing the massive underground rhizome system of peony plants, it enables batch infection of rhizomes with Agrobacterium tumefaciens within a reasonable space, thus completing the verification of silencing genes in bud dormancy.

[0072] The rhizomes are cultured in two stages: (1) first, dark culture for 3 days under the conditions of 60% humidity and 20-21°C; (2) adjustment of the dark culture and light culture alternately; light culture is controlled under the conditions of 60% humidity, 25°C, 4000lx light, and 14-16h; dark culture is controlled under the conditions of 60% humidity, 18°C, and 10-8h Figure 1 I) After observing whether germination occurs or not and the difference in germination speed, morphological observation is carried out to determine the function of the target gene, and samples are taken for subsequent determination of gene expression.

[0073] (8) Detection of gene-silenced plants to verify the function of the target gene

[0074] The rhizomes start to show phenotypic differences under the above culture conditions within about 10-14 days, the bud scales of the rhizomes that can germinate burst open, the tender stems elongate, and the tender leaves unfold; while the rhizomes that cannot germinate remain in the dormant state. The morphological differences such as whether the rhizomes of the infected plants and the control plants germinate, the proportion of the germinated plants, the germination speed, the germination time, etc. are recorded to determine whether the function of the target gene is to inhibit or promote the release of bud dormancy, thereby realizing the direct identification of the gene function.

[0075] The plants showing the expected phenotype are selected, total RNA of the leaves is extracted and reverse transcribed into cDNA, and qPCR is used to quantitatively determine the expression of the target gene in the plants into which pTRV2 empty vector (Mock, control group) and recombinant vector containing the target gene (silencing group) are introduced, and the expression amount of the target gene generally significantly decreases in the silencing group.

[0076] According to the comparison of the expression amounts of other genes in the control group and the silencing group, the downstream target genes of the functional gene can also be predicted.

[0077] A specific implementation case:

[0078] Silencing of the key gene DORMANCY ASSOCIATED MADS-BOX (DAM) and ABSCISICACID-INSENSITIVE 5 (ABI5) of bud dormancy of ‘Hangbai-shaoyao’

[0079] The implementation case is used to better understand the present application, but does not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. The test materials used in the implementation case are obtained from conventional biochemical reagent stores unless otherwise specified.

[0080] (1) Selection of representative infected materials, preparation of vectors, E. coli and Agrobacterium

[0081] The rootstock used in this case is derived from the local specialty 'Hangbai-shaoyao' in Zhejiang Province. The original Paeonia lactiflora germplasm in the south of the Yangtze River is very rare. For example, in Zhejiang Province, the only local Paeonia lactiflora germplasm is 'Hangbai-shaoyao' produced in Jianhua, Zhejiang Province, which is one of the famous traditional Chinese medicines of "Zhe eight flavors". After nearly a thousand years of cultivation, 'Hangbai-shaoyao' can better adapt to the hot and humid climate and warm winter climate in the south of the Yangtze River; it blooms, bears fruit, and produces seeds every year, and the seeds can germinate the next year and develop into strong rootstocks in the autumn of the same year. Through annual seeding and cultivation, experimental materials can be continuously provided.

[0082] The pTRV1 and pTRV2 plasmids used in this case were donated by the Department of Horticulture, China Agricultural University; E. coli DH5a was purchased from Novizen Biotechnology Co., Ltd.; and Agrobacterium tumefaciens GV3101 was purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0083] (2) Prepare annual rootstocks and carry out low-temperature treatment

[0084] Using 'Hangbai-shaoyao' annual seedling rootstocks as the infection material, the rootstocks were collected from the nursery, all the aboveground stems and leaves were removed (A), 1-3 underground dormant buds were retained and transplanted into pots, and then placed in a 4°C cold room for 3-5 weeks of light-free low-temperature treatment (B) between early September and mid-October. Figure 1 Figure 1

[0085] (3) Design primers using full-length transcriptome to clone the conserved fragments of DAM and ABI5 genes

[0086] During the low-temperature treatment, the cloning and vector construction of the target genes were carried out simultaneously.

[0087] First, primers were designed according to the full-length transcriptome data of Paeonia lactiflora. For example, for 'Hangbai-shaoyao', the sequences of the conserved regions of the transcripts annotated as the target genes in the full-length transcriptome obtained based on SMRT Sequencing were used to design amplification primers, and the recognition bases of restriction enzymes Xba I and Sac I and the protection base sequences GCTCTAGA and CGAGCTC were added at the 5' ends of the forward and reverse primers, respectively. The final primer names and primer sequences are as follows:

[0088] Primer name Primer sequence (5'-3') PlDAM-F1 GCTCTAGAAGATCGATAATGCCACGGCG PlDAM-R1 CGAGCTCCTGCAACCTCCTTGCTCAAC PlABI5-F1 GCTCTAGAAGTGTAGAAAATGGTTGTCCCT PlABI5-R1 CGAGCTCATTGACAGCTTGGTTTTCCTCA

[0089] Using the above primers, the conserved sequence fragments of DAM and ABI5 genes were cloned.

[0090] (4) Construction of Agrobacterium tumefaciens containing pTRV1 vector and pTRV2 vector connected with DAM and ABI5 fragments

[0091] ​​And using E. coli to screen and expand; pTRV1, pTRV2 plasmid (pTRV2-DAM, pTRV2-ABI5) connected with DAM, ABI5 gene fragment using freeze-thaw method to transform Agrobacterium tumefaciens GV3101, 28℃ dark culture for two days, then pick single clone, use pTRV2-F and pTRV2-R primers for positive single clone PCR detection, and send sequencing to verify sequence correctness.

[0092] (5) Using Agrobacterium tumefaciens to infect 'Hangbai-Shaoren' rhizome, silencing DAM, ABI5 gene

[0093] Agrobacterium tumefaciens GV3101 containing pTRV1, pTRV2 empty, pTRV2-DAM, pTRV2-ABI5 50 μL was added to 5 mL LB culture solution containing 50 mg / L kanamycin and 50 mg / L rifampicin, and placed in a shaker at 28℃ 200 rpm for 16 h, then transferred to 150 ml LB liquid medium containing 50 mg / L kanamycin, 50 mg / L rifampicin, 10 mM MES and 20 μM AS, and placed in a shaker at 28℃ 200 rpm for 16 h; when the OD 600 of the bacterial solution was about 1.5, centrifuged at 4000 rpm, 25℃ for 10 min to collect the bacterial cells. Resuspend the bacterial cells with 150 ml of infection buffer containing 10 mM MgCl2, 10 mM MES, 200 μM AS. Mix the Agrobacterium tumefaciens GV3101 containing pTRV1 with the bacterial solution containing pTRV2, the bacterial solution containing pTRV1 with the bacterial solution containing pTRV2 with DAM gene, and the bacterial solution containing pTRV1 with the bacterial solution containing pTRV2 with ABI5 gene, according to 1:1, and activate at 25℃ in the dark for 4 h.

[0094] Before infection, remove the low-temperature treated rhizome ( Figure 1 C), remove the substrate, wash, dry and remove all root hairs; use a common 1 ml syringe needle to lightly pierce 2-3 holes on the upper root neck and dormant bud scale base of the rhizome ( Figure 1 D); arrange the rhizome vertically in a 1L or larger beaker ( Figure 1 E), with the top end below the beaker rim by 5 cm or more, completely immerse the rhizome in Agrobacterium tumefaciens GV3101 containing pTRV1, pTRV2 empty, pTRV2-DAM, pTRV2-ABI5 ( Figure 1 F-G); place the beaker in a vacuum pump and vacuum at -0.9 kg / cm 2 (-0.09 MPa) for 30 min, release the vacuum for 20 min, and ensure that the bacterial solution is completely immersed in the dormant bud and rhizome ( Figure 1H); First, plants from both the silent group and the control group were placed in a dark environment with 60% humidity and 20℃ for 3 days, and then cultured for another 10-14 days under the conditions of 60% humidity, 14h light, 25℃, 4000lxs light and 10h darkness, 18℃. Figure 1 I).

[0095] The VIGS silencing experiment described above uses two vectors, pTRV1 and pTRV2, which are used together in the VIGS system. pTRV1 acts as the "locomotive," while pTRV2 is the "carriage" connecting the target gene. The target gene fragment is inserted into the pTRV2 vector through enzyme digestion and ligation. The pTRV1 and pTRV2 bacterial cultures are generally mixed in a 1:1 ratio and then used to infect plant materials. By accurately recognizing the target gene fragments, the silencing effect of the target gene in the infected recipient is achieved.

[0096] In this example, there are 3 treatment groups, including 1 empty silent group (i.e., control group). Figure 2 The winning designation is Mock), and two functional gene silencing groups (i.e., DAM and ABI5) are used as examples.

[0097] Each of the three treatment groups was infected with a 1:1 mixture of two bacterial solutions, as follows:

[0098] Empty vector silence group: pTRV1 and pTRV2 bacterial cultures were mixed at a 1:1 ratio;

[0099] DAM silencing group: a 1:1 mixture of pTRV1 and pTRV2-DAM bacterial cultures;

[0100] ABI5 silencing group: a 1:1 mixture of pTRV1 and pTRV2-ABI5 bacterial cultures.

[0101] Specifically, the pTRV2 in the empty vector silencing group does not carry any functional gene fragments and belongs to the control group; the DAM silencing group silences the peony bud dormancy functional gene DAM, and the pTRV2 is linked with the conserved fragment of DAM obtained after amplification; the ABI5 silencing group silences the peony bud dormancy functional gene ABI5, and the pTRV2 is linked with the fragment of ABI5.

[0102] (6) Post-infection culture, phenotypic observation and expression level determination

[0103] After 3 days of dark culture and 10-14 days of culture in a culture room, significant differences in the bud dormancy release and germination morphology of the three groups of peony rhizomes began to appear. The germination and rooting of the empty-load silenced group (Mock) were significantly earlier and the germination rate was also higher than that of the control group, thus verifying that the DAM and ABI5 genes inhibited the release of physiological dormancy in 'Hangzhou White Peony' buds. Figure 2) The expression of DAM and ABI5 in the empty vector silencing group and the expression of DAM in the DAM silencing group and the expression of ABI5 in the ABI5 silencing group were detected by qPCR, and it was found that the expression of DAM and ABI5 in the two silencing groups was significantly lower than that of DAM and ABI5 in the empty vector silencing group Figure 3

[0104] In combination with the phenotype and expression results, it is confirmed that the gene silencing experiment of DAM and ABI5 of 'Huangbai Shao' is successful based on the present application; and the biological functions of DAM and ABI5 are to maintain the physiological dormancy of the underground buds of 'Huangbai Shao', that is, to inhibit the gene of bud physiological dormancy release. Thus, a homologous silencing system based on the underground bud dormancy gene of the invasive annual root rhizome of the herbaceous plant of the peony is successfully constructed.​

Claims

1. A method for constructing a homologous silencing system of a bud dormancy gene of a Paeonia plant, characterized by, The method is based on the uniqueness of the full-length transcriptome of Paeonia lactiflora underground bud dormancy, and the large underground rhizome system of Paeonia lactiflora herbaceous plants is miniaturized when infected with bacterial liquid, thereby realizing the functional silencing of bud dormancy regulation genes; specifically comprising the following steps: (1) According to the gene annotation and conserved sequence region in the full-length transcriptome of Paeonia lactiflora bud dormancy, design amplification primers; use the amplification primers to clone the conserved sequence fragments of the target gene, and construct them into Agrobacterium tumefaciens containing pTRV vector; The Paeonia lactiflora bud dormancy full-length transcriptome is a global shared data published on the NCBI website, with accession number PRJNA487256; its source is the three-generation full-length transcriptome and two-generation transcriptome data of Paeonia lactiflora during bud dormancy obtained by combined sequencing of single molecule real-time and next-generation sequencing technology, which includes sequence full-length, functional annotation and expression results; (2) Between early September and mid-October, select all herbaceous Paeonia lactiflora germplasm that can normally seed, and the seeds can germinate and develop into rhizomes the next year; take the rhizomes of one-year-old seedlings, remove the remaining stems and leaves above ground and retain 1-3 dormant buds underground; After potting, transfer to a cold room at 4°C for 3-5 weeks of light-free low-temperature treatment; The one-year-old seedling rhizome refers to the fleshy finger-shaped rhizome formed in the summer and autumn season after sowing the previous year, winter dormancy and spring germination the following year, and containing dormant buds at the top; (3) Take out the low-temperature treated rhizome, wash and remove all root hairs; After making a few small holes at the base of the bud scale of the dormant bud at the top of the rhizome, use it as the prepared infection material; (4) Prepare Agrobacterium tumefaciens liquid containing pTRV1, pTRV2, and pTRV2-target gene fragments, and infect the infection material in the liquid; pot the rhizome and move it to the culture room for culture, observe the phenotype and expression difference with the control group during growth, and confirm the success of the homologous silencing system construction.

2. The method of claim 1, wherein, In step (2), the rhizome is selected according to the following standards: root length is 8-12 cm, root thickness is 0.6-1.2 cm; there is only one obvious main root, no lateral root branching or few branching, and the root hairs are abundant; the root part is free of diseases, pests and mold rot, and there are 1-3 dormant buds on the upper part of the root neck.

3. The method of claim 1, wherein, In step (2), the best period for low-temperature treatment of Paeonia lactiflora is from early September to mid-October; During this period, the aboveground stems and leaves of Paeonia lactiflora have withered, ending the previous annual cycle; and the daily average temperature is relatively high, which can ensure that the low-temperature treatment is carried out under the premise that the cold accumulation is zero, and ensure that the cold accumulation obtained by the rhizome is from artificial quantitative low-temperature treatment.

4. The method of claim 1, wherein, In step (2), if the estimated function of the target gene to be infected is to inhibit dormancy release, the 4°C low-temperature treatment time is controlled at 3-4 weeks; if the estimated function of the target gene to be infected is to promote dormancy release, the 4°C low-temperature treatment time is controlled at 4-5 weeks.

5. The method of claim 1, wherein, In the step (3), all the root hairs on the small stems are removed before infection, which facilitates the subsequent statistics of the long roots; the syringe needle is used to puncture the part of the small stems with a depth of 0.5 cm, which is the joint between the bud scale base and the main part of the small stem; the bud cannot be directly punctured to prevent ulceration.

6. The method of claim 1, wherein, In the step (4), the specific operation of the infection treatment comprises: (1) a 1 L beaker is used to hold the bacterial liquid of the Agrobacterium tumefaciens GV3101, and a plurality of the small stems are arranged in the beaker in a longitudinal direction with the head upward and the root downward, and the highest part of the small stems should be lower than the upper edge of the beaker by 5 cm or less; the parts to be infected, including the small stems, the dormant buds at the top and the punctured parts, should all be submerged in the bacterial liquid; (2) the beaker is moved to a vacuum pumping device, the vacuum pump is started to pump vacuum and kept for at least 30 minutes, and then the air is released for 20 minutes.

7. The method of claim 1, wherein, In the step (4), when the small stems are cultured, two stages are included: (1) first, dark culture is carried out for 3 days under the conditions of a humidity of 60% and a temperature of 20-21°C; (2) the dark culture and the light culture are alternated, and the humidity is controlled to be 60%; when the light culture is carried out, the temperature is 25°C, the light is 4000 lxs, and the time length is 14-16 h; when the dark culture is carried out, the temperature is 18°C, and the time length is 10-8 h.