Molecular markers and methods for watermelon population structure analysis and variety identification
By using KASP technology to screen 44 core SNP markers in watermelon breeding, the problems of narrow genetic background and low variety identification efficiency in watermelon breeding have been solved. This has enabled efficient and accurate detection of watermelon population structure analysis and variety identification, providing an efficient breeding auxiliary tool.
Patent Information
- Application Number
- CN202310269942.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-03-13
- Publication Date
- 2026-04-17
- Estimated Expiration
- 2043-03-13
AI Technical Summary
Existing technologies in watermelon breeding suffer from problems such as narrow genetic background, low efficiency in variety identification, and difficulty in accurately determining purity, especially in the evaluation of watermelon germplasm resources and the identification of hybrid seed purity.
Based on 414 watermelon whole-genome resequencing data and 131 self-tested ZJU series germplasm data, one million SNP loci were identified. Using the KASP technology platform, 44 core SNP markers and matching primers were screened for watermelon variety DNA fingerprinting, germplasm resource genotyping, and variety purity detection.
It enables efficient analysis of watermelon population structure and variety identification, improves variety identification rate and purity detection accuracy, and provides an efficient breeding auxiliary tool.
Smart Images

Figure CN116356069B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of molecular marker development for vegetable agronomic traits and molecular marker-assisted breeding technology. Specifically, it relates to a specific marker suitable for screening and breeding watermelon varieties, providing high-throughput auxiliary technology for subsequent variety protection and breeding of improved varieties. Background Technology
[0002] Watermelon belongs to the Cucurbitaceae family and originated in Africa. It is an important economic crop. Due to its short growth cycle and large market demand, it plays an important role in the production and consumption of fruits and vegetables in the world[1]. With the changes in people's lifestyles and material needs, people's demand for the quality of watermelon products has gradually increased, and the market's requirements for the quality, ripeness, yield, and storage and transportation resistance of watermelons are also getting higher and higher[2,3].
[0003] Germplasm resources are the foundation for breeding work. Due to the repeated use of some core parent germplasm in watermelon breeding, the genetic background becomes increasingly narrow, which is a major bottleneck in watermelon breeding at present [4]. In addition to the impact on the genetic background, there are often cases of the same species with different names or the same name with different species in the market. Furthermore, the purity of hybrids is related to the quality of seeds and is directly related to farmers' income. Judging the similarities and differences of varieties and purity through phenotypic observation has problems of poor reliability and low throughput. Screening and constructing specific molecular marker groups will help improve the efficiency of breeding work in germplasm resource evaluation, hybrid parent selection and hybrid seed purity identification [5,6].
[0004] Commonly used methods for variety identification include morphological identification, biochemical marker identification, and molecular marker identification, each with its own advantages and disadvantages [7]. Morphological identification mainly involves DUS testing based on plant morphological characteristics, which has the characteristics of long identification cycle and susceptibility to environmental influence. Biochemical marker identification is mainly divided into isoenzyme markers and protein markers, but is easily affected by plant development status. Compared with other identification methods, molecular marker identification has obvious advantages. Molecular markers can be used to quickly distinguish the genetic background of various watermelon germplasm resources [8], select watermelon varieties that meet the conditions, and shorten the breeding cycle. Commonly used molecular markers include RFLP, RAPD, SSR, etc. Various molecular markers are used to construct DNA fingerprint maps for the protection and germplasm identification of plants such as broccoli [9], cabbage
[10] , kale
[11] , cucumber
[12] , and apple
[13] . Because of the limited number of SSR markers and detection throughput, high detection cost, and time-consuming and labor-intensive data reading, SNPs directly use sequence variations as markers, which can directly distinguish the differences between the genetic material of two individuals and can better make up for the defects of SSR markers [14-16], and have gradually replaced the status of SSR. As a third-generation molecular marker, SNPs are numerous, widely distributed, and easy to genotype. KASP is a recently developed and popular single nucleotide polymorphism (SNP) genotyping method. It only requires a small number of SNP markers to genotype different samples, and is suitable for detection of multiple samples and few loci. It has the characteristics of high efficiency, flexibility, accuracy and low cost
[17] . Xu Yong
[18] et al. published an improved watermelon reference genome and 414 whole genome resequencing data representing all existing species of the genus Watermelon, which laid an important foundation for the use of SNP markers to identify our unique watermelon varieties.
[0005] Zhemi No. 8 is a new greenhouse watermelon variety bred by the College of Agriculture and Biotechnology of Zhejiang University in cooperation with Zhejiang Wuwangnong Seed Industry Co., Ltd.
[19] . It is an early-mid-maturing variety with excellent taste and quality and good storage and transportation performance. The male parent of Zhemi No. 8 is ZJU155, and the female parent of Zhemi No. 8 is ZJU156.
[0006] The references mentioned above are as follows:
[0007] 1. Wang Juanjuan, Li Li, Shang Huaiguo. Current Status and Countermeasures of Watermelon and Melon Industry in my country [J]. China Melon and Vegetable, 2020, 33(05):69-73. 2. Yu Yuhong, Ma Yunliang, Zhao Xiaolong, Li Chao, Zhang Lin, Geng Shaoyuan. Principal Component Analysis and Aggregate Analysis of Fruit Traits of 154 Watermelon Breeding Materials
[0008] Class analysis [J]. Chinese Vegetables and Melons, 2019, 32(11):6-12.
[0009] 3. Cheng Rui, Xu Binghua, Zhang Chaoyang, Xu Wenzhao, Gu Yan, Huang Dayue, Sun Yudong. Statistical analysis of the characteristics and directions of watermelon breeding in my country in the past 10 years based on literature [J]. Chinese Fruit Trees, 2021, (02): 79-82.
[0010] 4. Yi Licong, Wang Yunqiang, Jiao Chunhai, Yao Minghua, Gong Yu, Wang Shujing, Dai Zhaoyi. Genetic diversity analysis of watermelon germplasm resources based on SNP markers [J]. China Melon and Vegetable, 2020, 33(12):8-13.
[0011] 5. You Jiaqi, Li Chaohan, Yang Hongjuan, Zhu Lihua, Song Ronghao, Li Shaolong, Gu Weihong. A new watermelon variety 'Heijin' based on SSR markers.
[0012] Purity identification of 'Shenmi 968' [J]. Molecular Plant Breeding: 1-9.
[0013] 6. Cheng Weishun, Luo Qian, Hong Juan, Wang Suping, Huang Xiang, Du Lei, Jiang Li, Zhang Lihong, Chen Gang. Study on the identification of purity of watermelon hybrids using fluorescently labeled SSR[J]. China Fruits and Vegetables, 2020, 40(12):36-41.
[0014] 7. Sun, Bo. Research on watermelon variety identification based on core SSR markers [D]. Hunan: Hunan Agricultural University, 2019.
[0015] 8. Yan Lingwen. Establishment of a molecular marker system for background selection of watermelon germplasm resources [D]. Heilongjiang: Northeast Agricultural University, 2021. 9. Shen Y, Wang J, Shaw RK, et al. Development of GBTS and KASP Panels for Genetic Diversity, Population Structure, and Fingerprinting of a Large Collection of Broccoli (Brassica oleracea L. var. italica) in China. Frontiers in Plant Science. 2021, 12: 655-254.
[0016] 10. Li Zhiyuan, Yu Hailong, Fang Zhiyuan, et al. Development of SNP markers for cabbage and construction of DNA fingerprint profiles for major varieties [J]. Chinese Agricultural Science, 2018, 51(14):17.
[0017] 11.Yang S, Yu W, Wei
[0018] 12.Zhang,J.,Yang,J.,Zhang,L.et al.A new SNP genotyping technologyTarget SNP-seq and its application in genetic analysis of cucumbervarieties.Science Reports.2020,10:5623.
[0019] 13. Chen,
[0020] 14.RASHEED A,HAO YF,XIA XC,et al.Crop breeding chips and genotypingplatforms:
[0021] Progress,challenges,and perspectives.Molecular Plant,2017,10(8):1047-1064.
[0022] 15. Feng Zishan, Wu Xiaohua, Li Yanwei, Lu Zhongfu, Wang Jian, Wu Xinyi, Wang Baogen, Ye Zihong, Li Guojing, Wang Ying. A method for rapid identification of the purity of Calabash hybrid F_(1) based on KASP markers [J]. Molecular Plant Breeding: 1-8.
[0023] 16. Liu Lihua, Liu Yangna, Zhang Mingming, Li Hongbo, Pang Binshuang, Zhao Changping. Construction and comparative analysis of SNP and SSR fingerprint profiles of 75 wheat varieties in my country [J]. China Agricultural Science and Technology Guide, 2020, 22(05):15-23.
[0024] 17. Wang Fuqiang, Zhang Jian, Wen Changlong, Fan Xiucai, Zhang Ying, Sun Lei, Liu Chonghuai, Jiang Jianfu. Grape variety identification based on KASP markers [J].
[0025] Chinese Journal of Agricultural Science, 2021, 54(13):2830-2846.
[0026] 18. Guo, S., Zhao, S., Sun, H. et al. Resequencing of 414 cultivated and wild watermelon accessions identifies selection for fruit quality traits. Nature Genetics. 2019, 51: 1616–1623. 19. Watermelon varieties Zhemi No. 8 and Zhemi No. 10 [J]. Zhejiang Agricultural Sciences, 2019, 60(05): 852. Summary of the Invention
[0027] The technical problem to be solved by this invention is to provide a molecular marker and its usage that is suitable for watermelon population structure analysis and variety identification.
[0028] Based on 414 publicly available whole-genome resequencing data of watermelon
[18] and 131 unpublished self-tested ZJU series watermelon germplasm genome data, this invention has mined more than one million SNP loci. Further analysis of these loci and using the KASP technology platform, according to the identification and screening rules set by this invention, 44 core SNP markers and matching KASP primers were identified and screened, covering 11 watermelon chromosomes. The molecular markers obtained by this invention can be used for constructing DNA fingerprint maps of watermelon varieties, genotyping of watermelon germplasm resources, and detection of watermelon variety purity / authenticity.
[0029] To address the aforementioned technical problems, this invention provides 44 core SNP markers, such as... Figure 1The 44 core SNP markers and their order are as follows: 1 is located at 31638093 bp on chromosome chr1; 2 is located at 32741354 bp on chromosome chr1; 3 is located at 32801791 bp on chromosome chr1; 4 is located at 36063959 bp on chromosome chr1; 5 is located at 26422791 bp on chromosome chr2; 6 is located at 29657545 bp on chromosome chr2; 7 is located at 36942745 bp on chromosome chr2; 8 is located at 3280836 bp on chromosome chr3; 9 is located at 7072873 bp on chromosome chr3; and 10 is located at 21745227 bp on chromosome chr3. Animal number 11 is located at 2298062 bp on chromosome 4; animal number 12 is located at 16129879 bp on chromosome 4; animal number 13 is located at 22192188 bp on chromosome 4; animal number 14 is located at 23194919 bp on chromosome 4; animal number 15 is located at 5822768 bp on chromosome 5; animal number 16 is located at 16739711 bp on chromosome 5; animal number 17 is located at 22657712 bp on chromosome 5; animal number 18 is located at 35533958 bp on chromosome 5; animal number 19 is located at 8462220 bp on chromosome 6; animal number 20 is located at 20873833 bp on chromosome 6; animal number 21 is located on chromosome 6. Chromosome 22 is located at 23191778 bp on chromosome 6; chromosome 23 is located at 254201 bp on chromosome 7; chromosome 24 is located at 9265010 bp on chromosome 7; chromosome 25 is located at 23229370 bp on chromosome 7; chromosome 26 is located at 26717084 bp on chromosome 7; chromosome 27 is located at 26735945 bp on chromosome 7; chromosome 28 is located at 30209712 bp on chromosome 7; chromosome 29 is located at 31057721 bp on chromosome 7; chromosome 30 is located at 15475257 bp on chromosome 8; chromosome 31 is located at 2125265 bp on chromosome 8. At position 4 bp; 32 is located at position 22965409 bp on chromosome 8; 33 is located at position 1544962 bp on chromosome 9; 34 is located at position 12687223 bp on chromosome 9; 35 is located at position 30737297 bp on chromosome 9; 36 is located at position 3790134 bp on chromosome 10; 37 is located at position 5083461 bp on chromosome 10; 38 is located at position 21514222 bp on chromosome 10; 39 is located at position 22866661 bp on chromosome 10; 40 is located at position 25193262 bp on chromosome 10; 41 is located at position 1041915 bp on chromosome 11.Cell 42 is located at position 5412848 bp on chromosome 11; cell 43 is located at position 26788771 bp on chromosome 11; cell 44 is located at position 28689232 bp on chromosome 11.
[0030] The nucleotide sequences of the KASP primers designed by amplifying the above SNP markers in this invention are shown in Table 1.
[0031] Table 1
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038] This invention also provides the application of the above-mentioned molecular markers in watermelon population structure analysis and variety identification.
[0039] An improvement to the application of this invention: used for assisted selection breeding of watermelon offspring.
[0040] This invention also provides a method for selecting core markers for watermelon germplasm resources, comprising the following steps:
[0041] 1) First, SNPs are initially filtered based on MAF > 0.05, heterozygosity < 0.1, deletion rate < 0.1, and the requirement of four times degenerate sites;
[0042] 2) Variety identification rate refers to the proportion of identifiable watermelon samples to the total number of samples; write a Python script to use exhaustive search to find SNPs with high variety identification rates among the filtered SNP sites to construct a core marker group, and determine whether the core SNP marker group can distinguish different watermelon varieties based on the resequencing SNP gene phenotypic data.
[0043] 3) Genomic DNA was extracted from 111 watermelon parent seedlings using the CTAB (hexadecyl trimethyl ammonnium bromide) method;
[0044] 4) Based on the differences in KASP fluorescence signals, the genotype of each watermelon to be tested is identified, that is, whether it belongs to homozygous or heterozygous genotypes. Then, it is determined whether the selected SNP molecular markers are usable, and the usable SNP molecular markers with high variety recognition rate are retained as members of the core SNP molecular marker group.
[0045] The KASP reaction system consisted of: 5.0 μl of 20–50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F-HEX:F-FAM:R = 2:2:5), for a total of 10.14 μl.
[0046] The KASP program is as follows: 94℃ pre-denaturation for 15 minutes; 94℃ for 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ annealing for 60 seconds, 31 cycles.
[0047] Genotyping results as follows Figure 8 The primer pairs showed excellent typing results for all 111 watermelon samples.
[0048] This invention also provides a method for identifying seed purity using the core SNP markers described above, comprising the following steps:
[0049] (1) Extract genomic DNA from the commercial watermelon variety to be tested and its parent watermelon genomic DNA;
[0050] (2) Select 1-2 markers from 44 SNP cores to perform KASP verification on the genomic DNA of commercial watermelon varieties;
[0051] (3) Based on the differences in KASP fluorescence signals, KASP typing was performed using an SNP typing instrument to identify the genotype of each commercial watermelon variety, i.e., to identify whether it belongs to homozygous or heterozygous genotypes. Seed purity was calculated based on the identification results. Purity = number of heterozygous samples in the test samples / all tested samples * 100%.
[0052] The KASP reaction system consisted of: 5.0 μl of 20–50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F-HEX:F-FAM:R = 2:2:5 molar ratio), for a total of 10.14 μl.
[0053] The KASP program was as follows: pre-denaturation at 94℃ for 15 minutes; denaturation at 94℃ for 20 seconds; annealing at 61℃ (-0.6℃ / cycle) for 60 seconds, 10 cycles; followed by denaturation at 94℃ for 20 seconds, annealing at 55℃ for 60 seconds, 31 cycles. Experimental results were exported from StepOne software.
[0054] According to the settings of this invention, 31 cycles of amplification are sufficient to achieve complete typing.
[0055] In summary, this invention identified and screened 441 SNP markers that classify watermelon population structure, distributed on chromosomes as follows: Figure 9 Simultaneously, 44 core SNP markers and their corresponding KASP primers were screened, covering all 11 chromosomes of watermelon. The molecular markers obtained in this invention can be used for constructing DNA fingerprint maps of watermelon varieties, genotyping of watermelon germplasm resources, and detecting the purity / authenticity of watermelon varieties.
[0056] The core SNP molecular marker group provided by this invention can provide an efficient tool for the purity identification of Zhejiang honey commercial seeds and subsequent watermelon variety breeding. Attached Figure Description
[0057] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0058] Figure 1 The locations of the 44 core markers on the 11 chromosomes are shown; the 44 core markers are distributed on the 11 chromosomes, and the location data represents the position of the core SNP markers on the chromosomes.
[0059] Figure 2 Genetic diversity analysis for 44 core markers;
[0060] The polymorphism information content (PIC) of the 44 core markers was mainly distributed in the ranges of 0.1-0.2 and 0.3-0.4, indicating good genetic diversity. The minimum allele frequency (MAF) was mostly distributed in the range of 0.1-0.5, with less than half of the SNP markers having a value below 0.1, indicating that the 44 core markers were relatively representative.
[0061] Figure 3 The population structure of watermelons was divided based on 441 markers.
[0062] Figure 4 Variants for the core SNPs of unknown-1 and unknown-2;
[0063] Blue dots represent the GG homozygous genotype, red dots represent the AA homozygous genotype, purple dots represent the GA heterozygous genotype, and black dots represent the blank control without samples. The genotyping results show clear partition boundaries, indicating that the KASP marker genotyping is reliable.
[0064] Figure 5 The UPGMA phylogenetic tree is plotted using 44 core markers.
[0065] Figure 6 To determine the purity of KASP seeds using SNP 7 on chromosome 36942745bp; blue dots represent homozygous AA genotype, red dots represent homozygous CC genotype, green dots represent heterozygous AC genotype; × represents blank control without sample or a dot that was not detected.
[0066] Figure 7 To determine the purity of KASP seeds using SNP 5 located at 26422791 bp on chromosome chr2; blue dots represent GG homozygous genotype, red dots represent CC homozygous genotype, green dots represent GC heterozygous genotype, and black dots represent blank control without samples or dots that were not detected.
[0067] Figure 8 DNA fingerprints of 111 watermelon germplasm materials were created using 44 core markers.
[0068] For example, the KASP phenotype of ZJU004 on SNP 1 is AA; on SNP 2 it is GG; on SNP 3 it is AA; and so on...; heterozygous is represented by GA; if not detected, it is represented by NA.
[0069] Figure 9 Distribution of 441 selected SNP markers for classifying watermelon population structure on chromosomes --- Population structure markers (chromosome: location): Detailed Implementation
[0070] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto:
[0071] Example 1: Population segmentation of the watermelon variety under test using 441 SNP molecular marker groups.
[0072] 1) Based on 414 publicly available whole-genome resequencing data of watermelon
[18] and 131 self-tested ZJU series watermelon germplasm genome data that have not yet been publicly available, more than one million SNP sites were obtained. Based on the plink software, the above SNPs were initially filtered by MAF (minimum allele frequency) > 0.05, heterozygosity < 0.1, deletion rate < 0.1, PIC > 0.15 and satisfying the fourfold degeneracy site.
[0073] 2) The SNP sites obtained from the initial filtering in step 1) are further processed as follows:
[0074] A Python script was written to select SNP markers that were evenly distributed on 11 chromosomes, gradually reducing the number of markers, and verifying the accuracy of the marker division structure based on the watermelon population structure of Guo et al.
[18] , and finally 441 SNP markers were selected.
[0075] 3) Use Python software to convert the VCF files of the above 545 watermelon materials into Phylip files, and then convert them into MEG files using MEGA11 to obtain the UPGMA phylogenetic tree.
[0076] 4) Using the UPGMA tree drawn from the 545 watermelon materials provided in this invention as a reference, the watermelon variety to be tested is sequenced, and the phylogenetic tree drawn together with the sequencing results of the watermelon variety to be tested and the 545 watermelon materials can roughly clarify the germplasm origin of the watermelon variety to be tested.
[0077] The distribution of 441 SNP molecular markers on chromosomes is shown in the figure. Figure 9 .
[0078] This application requires resequencing of the watermelons to be tested. It is highly efficient, and the 545 watermelon samples basically cover the existing watermelon varieties, making it representative. However, the cost is relatively high.
[0079] Experiment 1: Using the method described in Example 1, resequencing was performed on feed watermelons (C. amurus) ZJU135 and ZJU087 and cultivated watermelons (C. lanatus. Cultivar) ZJU067 and ZJU068. The sequencing results were then combined with 545 watermelon accessions for population structure analysis. The results are as follows: Figure 3 .
[0080] Based on the analysis of 441 SNP molecular markers, ZJU135 and ZJU087 belong to population 1 (C. amurus and C. colocynthis); ZJU067 and ZJU068 belong to population 5 (C. lanatus. Cultivar). The results are consistent with the actual situation, proving that the marker group is usable.
[0081] Example 2: A method for obtaining core markers of watermelon germplasm resources, comprising the following steps:
[0082] 1) Based on the 441 tags obtained in Example 1, the following filtering was performed:
[0083] A Python script was written to use an exhaustive search method to find SNPs with high variety recognition rates among the initially filtered SNP sites, constructing a core marker group. Based on the resequencing SNP gene phenotypic data, it was determined whether the core SNP marker group could distinguish different watermelon varieties; thus obtaining the SNP sites after secondary filtering.
[0084] Note: Variety identification rate refers to the proportion of identifiable watermelon samples out of the total number of samples.
[0085] 2) The core SNP markers obtained after screening in step 1) of Example 2 are few and not representative enough. Further screening using the screening method in step 1) of Example 2 on the markers obtained in step 1) of Example 1 yields 44 core markers. For example... Figure 1 As shown.
[0086] 3) Genomic DNA was extracted from 111 homozygous watermelon parent seedlings using the CTAB (hexadecyl trimethyl ammonnium bromide) method;
[0087] Note: 111 homozygous watermelons Figure 8 As shown, these 111 watermelon varieties are clearly described in Theoretical and Applied Genetics in the article “An allelic variant in the ACS7 gene promotes primary root growth in watermelon” (2022.8).
[0088] 4) Design corresponding forward primers (F-HEX), forward primers (F-FAM), and reverse primers R for each SNP site obtained after secondary filtering in step 2). See Table 1 for details.
[0089] KASP verification was performed using the DNA obtained in step 3).
[0090] The KASP reaction system consisted of: 5.0 μl of 20–50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mx, and 0.14 μl of KASPassay Mix (F-HEX:F-FAM:R = 2:2:5 molar ratio), for a total of 10.14 μl.
[0091] The KASP program is as follows: 94℃ pre-denaturation for 15 minutes; 94℃ for 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ annealing for 60 seconds, 31 cycles.
[0092] Based on the differences in KASP fluorescence signals, the genotype of each watermelon to be tested was identified, that is, whether it belongs to homozygous or heterozygous genotypes. This allowed for the determination of the usability of selected SNP molecular markers. When a selected SNP molecular marker could be perfectly genotyped, it was considered a usable marker. Usable SNP molecular markers with high variety recognition rates were retained as members of the core SNP molecular marker group, thus obtaining 44 validated core SNP markers. Figure 3 ).
[0093] The nucleotide sequences of the KASP primers designed using SNP markers are shown in Table 1.
[0094] The KASP typing results of 111 watermelon samples are as follows: Figure 8 As shown.
[0095] Example 3: Germplasm origin determination using the 44 core KASP marker groups obtained in Example 1:
[0096] (1) Extraction of watermelon genomic DNA of unknown origin using the CTAB method;
[0097] (2) Use NanoDrop software to detect DNA concentration and adjust to 50 ng / ul;
[0098] (3) Based on the differences in KASP fluorescence signals, the 44 core molecular markers were KASP-typed using an SNP genotyping instrument, thereby identifying the genotype of the watermelon variety on each marker, i.e., identifying whether it belongs to homozygous or heterozygous genotypes.
[0099] The KASP reaction system consisted of: 5.0 μl of 20–50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F-HEX:F-FAM:R = 2:2:5 molar ratio), for a total of 10.14 μl.
[0100] The KASP program is as follows: 94℃ pre-denaturation for 15 minutes; 94℃ for 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ annealing for 60 seconds, 31 cycles.
[0101] illustrate:
[0102] PCR reactions were performed directly on an ABI Stepone quantitative PCR instrument, which includes built-in fluorescence analysis software, allowing for direct acquisition of analytical results. The KASP typing results for 111 watermelon samples are shown below. Figure 8 .
[0103] (4) Based on the KASP typing results of the watermelon variety on 44 core molecular markers, the variation information of the watermelon variety on 44 SNPs can be obtained.
[0104] (5) The variation information of this watermelon variety and 111 watermelon varieties on 44 core SNP markers is summarized into a vcf file.
[0105] (6) Use Python software to convert the VCF file to a Phylip file, and then convert it from MEGA11 to a MEG file to obtain the UPGMA phylogenetic tree.
[0106] (7) The genetic relationship between the watermelon variety to be tested and 111 watermelon materials was analyzed based on the UPGMA phylogenetic tree. Watermelon materials with closer genetic relationship were selected to determine the germplasm source of the watermelon to be tested.
[0107] This application only requires KASP validation of 44 core molecular markers of the watermelon to be tested, which can provide a preliminary determination of the origin of new germplasm or its phylogenetic relationship with known germplasm. While the accuracy of this method is slightly lower, it can be used for preliminary, rough determination of germplasm origin, thereby reducing costs and improving efficiency.
[0108] Experiment 2: Using the method described in Example 3, KASP detection was performed on unknown-1 and unknown-2, and a UPGMA phylogenetic tree was drawn based on the KASP typing results, as follows. Figure 5 :
[0109] The KASP results for unknown-1 on markers 1 through 44 are:
[0110] GGAAAAGGCCTTAAAATTGGTTAATTGGGGTTGGCCCCTTTTAAAANAGGCCCCNACCC
[0111] The KASP results for CAACCAAGGAAAAGGNAGGCCTTTTTTCC unknown-2 on markers 1 to 44 are:
[0112] GGAAAAGGCCTTCCAATTGGTTAATTGGGGTTTTCCCCTTGGAAGGNAAACCCCNACCC
[0113] CGGCCAAGGAAAACCNAGGCCTTTTTTCC
[0114] The gene phenotype of unknown-1 is most similar to that of ZJU166, and the gene phenotype of unknown-2 is most similar to that of ZJU197 and ZJU093, such as Figure 5 .
[0115] Therefore, it can be proven that unknown-1 and ZJU166 are closely related and have similar population origins; unknown-2 is closely related to ZJU197 and ZJU093 and has similar population origins.
[0116] Subsequently, gene sequencing of unknown-1 and unknown-2 confirmed the correctness of the conclusions of this invention.
[0117] Example 4: Identification of hybrid seed purity using core SNP marker groups
[0118] Based on the abundance determination of core SNPs in this invention, most self-pollinated varieties or germplasm resources in China have a high probability of containing homozygous core SNP types. As long as the hybrid parents contain more than one different homozygous SNP, the KASP marker associated with that homozygous SNP can be used for purity identification of hybrid seeds. The specific application steps are as follows:
[0119] (1) Genomic DNA of hybrid parent watermelon and F1 was extracted using the CTAB method and the DNA concentration was adjusted to 50 ng / ul;
[0120] (2) Select 1-2 SNP markers from 44 core markers that can be used for KASP typing of hybrid watermelon parents, and use 3-5 F1 samples and their parents for KASP verification to ensure that the SNP markers selected in step 2) can effectively distinguish between F1 and parents.
[0121] (3) Randomly select a batch of seeds (generally 100-200 seeds) from the test seeds that need to be verified for hybrid purity, extract the DNA from the leaves and adjust the concentration to 50 ng / ul.
[0122] (4) KASP typing was performed on the DNA of the tested hybrid seeds using the validated KASP marker, with the DNA of the two parents serving as control samples. The specific reaction procedure is as follows:
[0123] The KASP reaction system consisted of: 5.0 μl of 20–50 ng / μl watermelon genomic DNA, 5.0 μl of KASP Master Mix, and 0.14 μl of KASP Assay Mix (F-HEX:F-FAM:R = 2:2:5 molar ratio), for a total of 10.14 μl.
[0124] The KASP program is as follows: 94℃ pre-denaturation for 15 minutes; 94℃ for 20 seconds (denaturation); 61℃ (-0.6℃ / cycle) annealing for 60 seconds, 10 cycles; then 94℃ denaturation for 20 seconds, 55℃ annealing for 60 seconds, 31 cycles.
[0125] (5) Obtain the genotype data of the test seeds and calculate the purity of the hybrid using the following formula: purity = number of heterozygous samples in the test samples / total number of test samples * 100%.
[0126] If multiple markers are used to calculate seed purity, a weighted average is calculated as the final result.
[0127] Experiment 3-1: Following the method described in Example 4, the hybrid watermelon Zhemi 8, with ZJU155 as the male parent and ZJU156 as the female parent, was tested. Zhemi 8 was obtained through regular commercial purchase, and the product label clearly stated that its purity was 98%.
[0128] In this experiment, the SNP marker with stable homozygous differences between the parents was selected as number 7, located at 36942745bp on chromosome chr2.
[0129] The KASP markers described above were used to perform KASP typing on the DNA of the tested hybrid seeds. Nine parental DNA samples (six from the maternal parent and three from the paternal parent) were used as control samples. The KASP typing results are as follows: Figure 6 The total number of samples tested was 13, of which 12 were heterozygous.
[0130] Therefore, the purity is 92.3%.
[0131] Experiment 3-2: Following the method described in Example 4, the hybrid watermelon Zhemi 8, with ZJU155 as the male parent and ZJU156 as the female parent, was tested. In this experiment, the SNP marker with stable homozygous difference between the parents was selected as No. 5, located at 26422791bp on chromosome chr2.
[0132] The KASP markers described above were used to perform KASP typing on the DNA of the tested hybrid seeds, with nine parental DNA samples (six from the maternal parent and three from the paternal parent) serving as control samples. When the KASP typing results are as follows... Figure 7 :
[0133] The total number of samples tested was 12 (one of which was not detected), and 11 of the samples were heterozygous.
[0134] Therefore, the purity is 91.7%.
[0135] The final weighted average of the two results in a purity of 92% for the selected Zhemi No. 8 seeds.
[0136] Note: Due to technical limitations, the number of test samples in Experiments 3-1 and 3-2 was relatively small, which had a greater impact on probability and lower accuracy. When the sample size is 100-200 in subsequent experiments, the seed purity after weighted average is about 98%, which is basically the same as its known purity.
[0137] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. KASP primers for amplifying SNP markers suitable for watermelon population structure analysis and variety identification, characterized in that... The KASP primers are as follows: SNP01: No.1: GAAGGTGACCAAGTTCATGCTGCGGGTTCGTTGTCTTCTATAACA, No.2: GAAGGTCGGAGTCAACGGATTGCGGGTTCGTTGTCTTCTATAACG, No.3: GTGCGGGAAAAAACCTTTAGGTTTC, SNP02: No.4: GAAGGTGACCAAGTTCATGCTCGGGAAAAGGTGTTCGTGTG, No.5: GAAGGTCGGAGTCAACGGATTCGGGAAAAGGTGTTCGTGTA, No.6: CATGCCAGTATCTTGCCAAGG, SNP03: No.7: GAAGGTGACCAAGTTCATGCTTGCCGCTGGTTCTAACTTGGTA, No.8: GAAGGTCGGAGTCAACGGATTTGCCGCTGGTTCTAACTTGGTG, No.9: CTCCGAACACGATTATCGCC; SNP04: No.10: GAAGGTGACCAAGTTCATGCTAGCTGTATCAAGGAAGAGTTGCGG, No.11: GAAGGTCGGAGTCAACGGATTAGCTGTATCAAGGAAGAGTTGCGA, No.12: GACCTGGGGAAGAAAATGCAATTGG; SNP05: No.13: GAAGGTGACCAAGTTCATGCTGTTGAGGTGGGAAAGAATTTGCTC, No.14: GAAGGTCGGAGTCAACGGATTGTTGAGGTGGGAAAGAATTTGCTG, No.15: GGATCAAGTGCCTCATATTTTCCAG; SNP06: No.16: GAAGGTGACCAAGTTCATGCTACAAGAGCGACCTCGGAGTT, No.17: GAAGGTCGGAGTCAACGGATTACAAGAGCGACCTCGGAGTC, No.18: CTCTAATGGGGACATCCGAG; SNP07: No.19: GAAGGTGACCAAGTTCATGCTCTCTCCAGTAACTTTACTCAACCC, No.20: GAAGGTCGGAGTCAACGGATTCTCTCCAGTAACTTTACTCAACCA, No.21: AGAAACCCAAGCGAGGCGT; SNP08: No.22:GAAGGTGACCAAGTTCATGCTTTCTTGCCATCAATGGTGTGCTCA, No.23:GAAGGTCGGAGTCAACGGATTTTCTTGCCATCAATGGTGTGCTCG, No.24:GAGGTGGATACATGGAAATGAATGG; SNP09: No.25:GAAGGTGACCAAGTTCATGCTACCCCGTTGGTTGTACCGT, No.26:GAAGGTCGGAGTCAACGGATTACCCCGTTGGTTGTACCGC, No.27:GGGTGTCTACAAGGTCTTTGAACTT; SNP10: No.28:GAAGGTGACCAAGTTCATGCTAGAAAGTGTCCTTGTTGACCTCG, No.29:GAAGGTCGGAGTCAACGGATTAGAAAGTGTCCTTGTTGACCTCA, No.30:TCAAGCTTGGAGACTGCCG; SNP11: No.31:GAAGGTGACCAAGTTCATGCTGTCTTATGTGTATAAGTGACGCT, No.32:GAAGGTCGGAGTCAACGGATTGTCTTATGTGTATAAGTGACGCG, No.33:ACTCATGACAGCAAAACTTCCAA; SNP12: No.34:GAAGGTGACCAAGTTCATGCTGACTGCCGGAGAAGAACCA, No.35:GAAGGTCGGAGTCAACGGATTGACTGCCGGAGAAGAACCG, No.36:CCCGAAATTCTGAATCTTTCCGTTC; SNP13: No.37:GAAGGTGACCAAGTTCATGCTGGAGGTGGAGGAGAGTGATATACT, No.38:GAAGGTCGGAGTCAACGGATTGGAGGTGGAGGAGAGTGATATACA, No.39:GGAGTATAAATCACCACCACCTCCT; SNP14: No.40:GAAGGTGACCAAGTTCATGCTGTTGCAATACCAAAAATGAGGGCG, No.41:GAAGGTCGGAGTCAACGGATTGTTGCAATACCAAAAATGAGGGCA, No.42:GAAGATGAGATACAACCTCAGAAGG; SNP15: No.43:GAAGGTGACCAAGTTCATGCTGATAACAATACTTGGCTTGCCACG, No.44:GAAGGTCGGAGTCAACGGATTGATAACAATACTTGGCTTGCCACA, No.45:GGAGTTCATTGGTAGAAGAGTTTGC; SNP16: No.46:GAAGGTGACCAAGTTCATGCTAGAAAGATACCTGCTTCAAGTGGT, No.47:GAAGGTCGGAGTCAACGGATTAGAAAGATACCTGCTTCAAGTGGC, No.48:CAGCCTCAGAATCCAACTGAA; SNP17: No.49:GAAGGTGACCAAGTTCATGCTATCCTTTGCTTGAGTTCAACCATG, No.50:GAAGGTCGGAGTCAACGGATTATCCTTTGCTTGAGTTCAACCATT, No.51:ATCCAGATCCTCGGCTTCT; SNP18: No.52:GAAGGTGACCAAGTTCATGCTGATCGGAATGCACAGTTATTGGC, No.53:GAAGGTCGGAGTCAACGGATTGATCGGAATGCACAGTTATTGGT, No.54:CTTGTGATCATCCTTGAGGTGG; SNP19: No.55:GAAGGTGACCAAGTTCATGCTGAGGAAATCGTTTTTGGGTGGC, No.56:GAAGGTCGGAGTCAACGGATTGAGGAAATCGTTTTTGGGTGGT, No.57:TGTGTCGCCATTTGTGCCG; SNP20: No.58:GAAGGTGACCAAGTTCATGCTGACTCCCTTTACCTCTCTAACCTT, No.59:GAAGGTCGGAGTCAACGGATTGACTCCCTTTACCTCTCTAACCTC, No.60:GTAGACCGTGGGAGTGAAAACA; SNP21: No.61:GAAGGTGACCAAGTTCATGCTGAACCCCAATCCTCCTCT, No.62:GAAGGTCGGAGTCAACGGATTGAACCCCAATCCTCCTCG, No.63:CAATCCTTGAGTCGATTCCATTA; SNP22: No.64:GAAGGTGACCAAGTTCATGCTGTTTTGGAGTTCTTGGCAGAGGCA, No.65:GAAGGTCGGAGTCAACGGATTGTTTTGGAGTTCTTGGCAGAGGCC, No.66:CACCAATAAACCCTGGAAGTTTGCC; SNP23: No.67:GAAGGTGACCAAGTTCATGCTTCTTTCTCTTTTCCTCCTGGG, No.68:GAAGGTCGGAGTCAACGGATTTCTTTCTCTTTTCCTCCTGGA, No.69:GGAACTACGAGAAAACAAACACAC; SNP24: No.70:GAAGGTGACCAAGTTCATGCTCTCTGTCGCATATCTCCTCG, No.71:GAAGGTCGGAGTCAACGGATTCTCTGTCGCATATCTCCTCC, No.72:GATGAAGTTCTTCACGAAGAGTGGA; SNP25: No.73:GAAGGTGACCAAGTTCATGCTGGTGGGGAAGCAGTTGCAACA, No.74:GAAGGTCGGAGTCAACGGATTGGTGGGGAAGCAGTTGCAACG, No.75:CACCTGCAAGTTCCCCAAAGCTTTT; SNP26: No.76:GAAGGTGACCAAGTTCATGCTCGTCATGATCATGACCACC, No.77:GAAGGTCGGAGTCAACGGATTCGTCATGATCATGACCACT, No.78:ACTGGTCTTCCAAATAACCACC; SNP27: No.79:GAAGGTGACCAAGTTCATGCTTACAACAGAAAGTACTTAAGCGGC, No.80:GAAGGTCGGAGTCAACGGATTTACAACAGAAAGTACTTAAGCGGT, No.81:GGAAAAAATGGCTACGAAAAGACC; SNP28: No.82:GAAGGTGACCAAGTTCATGCTGATTCCCATCGGCCATTGC, No.83:GAAGGTCGGAGTCAACGGATTGATTCCCATCGGCCATTGT, No.84:CCACGTGCAGTGGAAATCTTAAACA; SNP29: No.85:GAAGGTGACCAAGTTCATGCTGGTGGTGGTGACTTGTAGTAGTAC, No.86:GAAGGTCGGAGTCAACGGATTGGTGGTGGTGACTTGTAGTAGTAT, No.87:TACAAGTCACCACCACCTCCC; SNP30: No.88:GAAGGTGACCAAGTTCATGCTCTCCTTCCCCCAACTCGAAC, No.89:GAAGGTCGGAGTCAACGGATTCTCCTTCCCCCAACTCGAAT, No.90:GCATCGGAGAGATTTGGGGATTTGA; SNP31: No.91:GAAGGTGACCAAGTTCATGCTGCTGTATTGGACCAACAATTGACG, No.92:GAAGGTCGGAGTCAACGGATTGCTGTATTGGACCAACAATTGACA, No.93:CACCCAGTCTGGGAAAAGACTT; SNP32: No.94:GAAGGTGACCAAGTTCATGCTATGAAATCTCACGCATGTTGATCC, No.95:GAAGGTCGGAGTCAACGGATTATGAAATCTCACGCATGTTGATCT, No.96:CAGGTTAATCAGGGACTAACAGTA; SNP33: No.97:GAAGGTGACCAAGTTCATGCTGATTTGGGGACAAACTCATCTGCG, No.98:GAAGGTCGGAGTCAACGGATTGATTTGGGGACAAACTCATCTGCA, No.99:CCCTCAGGTTTGCACATTTGACTTC; SNP34: No.100:GAAGGTGACCAAGTTCATGCTTGTTGGAAAACCTCCAAGAAAGTG, No.101:GAAGGTCGGAGTCAACGGATTTGTTGGAAAACCTCCAAGAAAGTT, No.102:GAGACCAACTTTGAGAGAATGGATA; SNP35: No.103:GAAGGTGACCAAGTTCATGCTCTCCCTGCACTTTCCCTATTTTCA, No.104:GAAGGTCGGAGTCAACGGATTCTCCCTGCACTTTCCCTATTTTCG, No.105:GTAGGTGAGGAAAGCTACATTGAGA; SNP36: No.106:GAAGGTGACCAAGTTCATGCTTCGAGACCGAAGTCTTGGCG, No.107:GAAGGTCGGAGTCAACGGATTTCGAGACCGAAGTCTTGGCA, No.108:CGCGATTGAGGAGCGTTCTTAAG; SNP37: No.109:GAAGGTGACCAAGTTCATGCTTATGCTAGCCAAGACCGAGCTG, No.110:GAAGGTCGGAGTCAACGGATTTATGCTAGCCAAGACCGAGCTC, No.111:AAACCTCCTTGAGACGGGGAC; SNP38: No.112:GAAGGTGACCAAGTTCATGCTTCGAAAAATGGCCACTCTCACC, No.113:GAAGGTCGGAGTCAACGGATTTCGAAAAATGGCCACTCTCACA, No.114:ATTATGAACTCTTGTCCCCAAGGG; SNP39: No.115:GAAGGTGACCAAGTTCATGCTGTGAAGCCAGTTTTGCCGAATTTT, No.116:GAAGGTCGGAGTCAACGGATTGTGAAGCCAGTTTTGCCGAATTTG, No.117:ACCTCCATGGTTAACAGAGGAA; SNP40: No.118:GAAGGTGACCAAGTTCATGCTAGCTTGAGGTGCAGGAGTC, No.119:GAAGGTCGGAGTCAACGGATTAGCTTGAGGTGCAGGAGTT, No.120:CCCCCTGTAGCTCAACCAATTTTAA; SNP41: No.121:GAAGGTGACCAAGTTCATGCTATGCAGGGGACTGCTTGTTTACTT, No.122:GAAGGTCGGAGTCAACGGATTATGCAGGGGACTGCTTGTTTACTC, No.123:CTCAGATTCCTTCTCAAACTTCAGC; SNP42: No.124:GAAGGTGACCAAGTTCATGCTACTATCCGAGAGGCTCTTCGC, No.125:GAAGGTCGGAGTCAACGGATTACTATCCGAGAGGCTCTTCGT, No.126:CCCACACATGGCTGTGAGAATAACT; SNP43: No.127: GAAGGTGACCAAGTTCATGCTGGAACATAGAACTCAGACGCAGAT, No.128:GAAGGTCGGAGTCAACGGATTGGAACATAGAACTCAGACGCAGAG, No.129:GAGATGGGCCCACACTATG; SNP44: No.130: GAAGGTGACCAAGTTCATGCTTGCATTGGGTTTTCCTTCAAATCC, No.131:GAAGGTCGGAGTCAACGGATTTGCATTGGGTTTTCCTTCAAATCT, No.132: TCATACCTGTTGAGGGGAG.
2. The application of the KASP primers for amplifying SNP markers as described in claim 1 in watermelon population structure analysis and variety identification.
3. The application according to claim 2, characterized in that: Used for assisted selection breeding of watermelon offspring.