Construction and application of a recombinant PRRSV live vaccine strain expressing the receptor-binding domain of PEDV S protein
By constructing a recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain that expresses the PEDV S protein receptor RBD domain, the problem of existing vaccines being unable to effectively prevent co-infection of PED and PRRS was solved, achieving safe and efficient dual immune protection and reducing the risk of viral infection and immune stress.
Patent Information
- Application Number
- CN202210822960.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2022-07-06
- Filing Date
- 2022-07-12
- Publication Date
- 2026-05-12
- Estimated Expiration
- 2042-07-12
AI Technical Summary
Existing vaccines are ineffective in preventing mixed infections of porcine epidemic diarrhea (PED) and porcine reproductive and respiratory syndrome (PRRS), and single-dose vaccination leads to increased immune stress and economic costs. Existing PRRSV attenuated vaccine vectors have limited capacity to accommodate exogenous genes and pose a risk of genetic instability.
A recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain was constructed, expressing a fusion antigenic epitope peptide of the PEDV S protein receptor RBD domain. The PRRSV vaccine strain was used as a vector to deliver the exogenous gene. An appropriately sized PEDV S protein RBD domain was selected as the target antigen to reduce antibody-dependent enhancement (ADE) and improve the efficiency of immune protection.
This vaccine strain can stably express the PEDV RBD domain, induce neutralizing antibodies against PEDV, reduce viral infectivity, provide safe and efficient dual immune protection, reduce redundant antigenic epitopes, and improve the stability and safety of the recombinant virus.
Smart Images

Figure CN116535517B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biology, and specifically to the construction and application of a PRRSV live vector vaccine strain that recombinantly expresses a dominant antigenic epitope peptide of the PEDV S protein receptor RBD domain. Background Technology
[0002] Porcine epidemic diarrhea (PED) is a highly contagious intestinal infectious disease causing enormous economic losses to the global pig industry. It is widespread and severely impacts newborn piglets, resulting in significant economic damage for pig farmers worldwide. Porcine epidemic diarrhea virus (PEDV) is the primary pathogen causing the disease. PEDV can infect pigs of all ages and cause clinical symptoms, but the severity and mortality of infected pigs are inversely proportional to age. It has the greatest impact on newborn piglets under 10 days old, primarily manifesting as watery diarrhea, vomiting, dehydration, emaciation, and death. Morbidity and mortality rates in newborn piglets can reach as high as 80-100%. PEDV is an enveloped, single-stranded, positive-sense RNA virus belonging to the order Heliovirales, family Coronaviridae, genus Coronavirus, and subgroup α-coronavirus. In late 2010, a new variant of PEDV emerged, exhibiting high pathogenicity and rapid transmission in newborn piglets, leading to widespread outbreaks of acute diarrhea in piglet populations with persistently high morbidity and mortality rates. Due to the rapid spread and high infectivity of this mutated PEDV, it has become the leading viral infectious disease posing the greatest threat to newborn piglets. Currently, PEDV isolates prior to 2010 are classified as subgroup G1, while PEDV variants after 2010 are classified as subgroup G2.
[0003] The PEDV genome is approximately 28 kb long, containing 5' and 3' untranslated regions (UTRs) and at least seven open reading frames (ORFs): ORF1a, ORF1b, spike protein (S), accessory protein ORF3, envelope protein (E), membrane protein (M), and nucleocapsid protein (N). ORF1, located at the 5' end and occupying about two-thirds of the genome length, encodes two polyproteins, pp1a and pp1ab. pp1a and pp1ab are cleaved by papain and 3C-like serine proteases into 16 non-structural proteins, NSP1-16. These NSPs are primarily involved in viral replication, transcription, translation, and viral protein processing. The PEDV S glycoprotein, located on the surface of the viral particle, is a homotrimeric membrane glycoprotein composed of two subunits, S1 and S2. S1 mediates PEDV binding to the host receptor, while S2 induces membrane fusion and PEDV invasion. The N-terminus (NTD) of the S1 protein has neuraminidase binding activity, while the C-terminus (CTD) contains the cell receptor-binding domain (RBD), which is mainly responsible for recognizing host cell surface receptors and mediating viral adsorption. Antibodies against the PEDV RBD can inhibit the PEDV S protein from recognizing host cell receptors. Therefore, the RBD region is also a major target of host immune defense during viral infection and is often used as a target for vaccine development.
[0004] Porcine Reproductive and Respiratory Syndrome (PRRS) is an economically significant infectious disease characterized by respiratory illness in pigs of all ages and reproductive disorders in sows. The causative agent of PRRS is Porcine Reproductive and Respiratory Syndrome Virus (PRRSV). Since its first report in 1987, PRRSV has been one of the major challenges facing the global swine industry, and it continues to mutate, leading to new epidemics. It is reported that in the United States alone, PRRSV infection causes approximately $664 million in losses to the swine industry annually. PRRSV is also a single-stranded positive-sense RNA virus. The primary target cells for PRRSV infection are monocytes and macrophages, most typically alveolar macrophages (PAMs). There are two main genotypes of PRRSV: PRRSV1 and PRRSV2. While the nucleotide and amino acid homology between these two genotypes is only 60% and 56%, respectively, the clinical symptoms, pathological damage characteristics, and tissue tropism caused by both types are similar. PRRSV1 is prevalent in Europe, while PRRSV2 is prevalent in the Americas and Asia. However, there are reports of both types of strains being isolated simultaneously in Europe, North America, and Asia. Currently, the PRRSV2 strain is the dominant strain circulating in pig herds in my country. Due to the ease with which PRRSV mutates and recombines, the clinically prevalent PRRSV strains are complex and diverse, exhibiting the coexistence of different subtypes, including classic CH-1a type PRRSV, highly pathogenic PRRSV, NADC30-like, and NADC34-like PRRSV. Furthermore, new variant strains derived from recombination of these different strains also exist. Therefore, PRRSV is one of the most troublesome viruses in my country's pig farming industry.
[0005] Co-infection with PRRSV and PEDV is relatively common in my country. To control PRRS and PED, in addition to strengthening biosafety management measures, vaccination is currently one of the most commonly used and effective strategies for preventing PRRS and PED. Vaccination can minimize the economic losses caused by PRRSV and PEDV infection. Currently, vaccines used to prevent PRRS and PED mainly include live vaccines and inactivated vaccines. While inactivated PRRSV vaccines are safe, they provide limited immune protection, while live vaccines provide effective immune protection. However, there is currently no vaccine that can simultaneously prevent PED and PRRS infection against different pathogens. Frequent immunizations relying on a single vaccine not only increase vaccination costs but also cause excessive immune stress in pig herds, affecting pig production performance. Therefore, it is necessary to design a multivalent vaccine to simultaneously prevent infection with two different pathogens, PRRSV and PEDV. The S protein, located on the surface of the viral particle, mediates receptor recognition and membrane fusion and contains neutralizing antigenic epitopes that can induce the production of neutralizing antibodies, making it an ideal antigen for developing coronavirus candidate vaccines. However, not all epitopes in the S protein can induce neutralizing antibodies. Studies have confirmed that many epitopes in the intact S or S1 proteins also induce non-neutralizing antibodies. These non-neutralizing antibodies also include those associated with antibody-dependent enhancement (ADE) of viral infection or harmful immune responses, presenting numerous potential uncontrollable risk factors, which is detrimental to the development of safe and effective vaccines. PEDV invasion of host cells mainly relies on the S protein using its receptor-binding domain (RBD) to bind to host cell receptors, allowing the virus to enter the host cell. Therefore, neutralizing antibodies targeting the S protein RBD region can block the binding of the S protein to its receptor, thereby preventing PEDV infection. The PRRSV attenuated vaccine strain HuN4-F112 has been widely used clinically to prevent infection with highly pathogenic PRRSV, and it has been confirmed that the PRRSV genome is suitable as a vector for expressing exogenous genes. However, the size of the exogenous gene it can accommodate is limited. Introducing an excessively large exogenous gene can lead to mutation or loss, easily causing genetic instability in recombinant viruses. Therefore, selecting an exogenous gene of appropriate size is crucial for constructing recombinant vaccines. This study aims to construct a PRRSV attenuated vaccine strain based on the PRRSV live vaccine strain HuN4-F112. This strain selectively targets the CTD domain of the PEDV S protein, which primarily contains the RBD domain, as the target antigen, reducing redundant antigenic epitopes and minimizing the risk factors of ADE (antibody-deprivation effect). The strain stably recombinantly expresses the dominant antigenic region of the PEDV S protein. This vaccine strain can induce the body to produce neutralizing antibodies that specifically target the PEDV RBD domain, preventing the virus from recognizing host cell receptors and thus reducing the virus's infectivity. This provides technical support for the prevention and control of PRRS and PED. Summary of the Invention
[0006] In order to solve the above-mentioned technical problems, the objective of this invention is:
[0007] A fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor is provided. The dominant antigenic region of the S protein RBD domain is determined by analyzing the amino acid sequence of the S gene of the prevalent PEDV variant strain FJzz1 published in Gene Bank (accession number: MK288006). The C-terminal domain (1495-2377 nt, encoding amino acid positions: aa 496-792) of the S gene was selected. This region is mainly distributed on the surface of the S protein extracellular domain trimer and contains the potential RBD domain of PEDV, with the highest antigenicity index of 3.4. The signal peptide sequence of the S gene is introduced at its anterior end, and the target gene is named RBD1, as shown in SEQ ID NO.1.
[0008] Furthermore, the present invention provides the application of the fusion antigenic epitope peptide of the above-mentioned S protein receptor RBD domain, wherein the application is to develop a bivalent genetically engineered live vaccine against PRRS and PED.
[0009] Furthermore, the present invention provides a recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain expressing a fusion antigenic epitope peptide of the S protein receptor RBD domain, characterized in that it expresses the aforementioned fusion antigenic epitope peptide of the S protein receptor RBD domain.
[0010] Furthermore, this invention provides the application of the recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain, which uses the PRRS vaccine strain as a vector to deliver exogenous genes from PED, thereby protecting pigs from both PRRSV and PED. This will improve the efficiency of PRRSV vaccine use and is suitable for the development of novel genetically engineered vaccines.
[0011] Furthermore, the N-terminus or C-terminus of the antigen epitope peptide may also be coupled with a polypeptide label; preferably, the polypeptide label is a biotinylated label or a fluorescent label.
[0012] Furthermore, the application of the aforementioned antigenic epitope peptides in the preparation and development of bivalent genetically engineered live vaccines against PRRS and PED is provided.
[0013] Furthermore, the present invention provides a recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain expressing the dominant antigenic region of the PEDV S protein, characterized in that the dominant antigenic region of the PEDV S protein is the above-mentioned S protein fusion antigen epitope peptide.
[0014] Furthermore, this invention provides the application of the recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain, which uses the PRRS vaccine strain as a vector to deliver exogenous genes from PED, thereby protecting pigs from both PRRSV and PED. This will improve the efficiency of PRRSV vaccine use and is suitable for the development of novel genetically engineered vaccines.
[0015] The present invention also provides the use of the above-mentioned antigenic epitope peptide in the preparation of medicaments for the prevention or treatment of PRRS and PED.
[0016] The present invention further provides the application of the above-mentioned antigenic epitope peptide as a screening target for drugs against PRRS and PED infection.
[0017] Furthermore, in one embodiment of the present invention, a pharmaceutical composition for the prevention or treatment of PRRS and PED infections is also provided, comprising the above-described antigenic epitope peptide and pharmaceutically acceptable excipients.
[0018] In one embodiment of the invention, an adjuvant is also included, wherein the adjuvant may be AddaVax.
[0019] Furthermore, in one embodiment of the invention, the pharmaceutical composition is a nasal dosage form; preferably a spray, nasal drops, powder, gel, or microsphere formulation.
[0020] The present invention further provides a diagnostic reagent for PRRS and PED infections, comprising the above-mentioned antigenic epitope peptide, wherein the antigenic epitope peptide is coated on a detection carrier selected from any one of polystyrene microplates, colloidal gold strips, magnetic beads, and microfluidic chips.
[0021] Beneficial effects
[0022] The recombinant antigen provided in this invention mainly targets the receptor-binding domain (RBD) of the PEDV S protein, reducing the large number of redundant antigenic epitopes in the intact S protein, lowering the risk factors of antibody-dependent enhancement (ADE), and improving the safety of the vaccine.
[0023] The antigens selected by the constructed recombinant virus can stimulate the body to produce neutralizing antibodies that focus on the RBD region of the prevalent variant PEDV, thereby improving the targeting of the antibodies induced by the recombinant antigen.
[0024] The recombinant virus constructed introduced the RBD domain gene of the circulating PEDV variant, which is 960 bp in size. This is the gene size that the PRRSV genome can accommodate. The resulting recombinant virus is not prone to mutation and deletion, thus ensuring the stability of the recombinant virus.
[0025] Furthermore, the recombinant viral PRRSV pHuN4-F112-SRBD1 vaccine strain provided in this invention can stably express the fusion antigenic epitope peptide of the PEDV S protein receptor RBD domain in cell culture, and can serve as a candidate strain for the future development of novel genetically engineered live vector vaccines for the prevention of PRRS and PED.
[0026] The recombinant virus constructed and inoculated into pigs did not cause abnormal clinical manifestations or pathological damage, and was safe for pigs.
[0027] The recombinant virus inoculation test pigs constructed can simultaneously induce specific immune responses against PRRSV and PEDV. The generated neutralizing antibodies can effectively neutralize the circulating variant of PEDV and reduce the infectivity of PEDV. Attached Figure Description
[0028] Figure 1 Electrophoretic identification diagrams of SRBD1 gene fragment amplification, where A shows the results of PCR amplification using RBD1-F1 / RBD1-R1 and RBD1-F2 / RBD1-R2 primers; B shows the results of PCR amplification using RBD1-F3, RBD1-R3, RBD1-F4, and RBD1-R4 primers.
[0029] Figure 2 Identification of infectious clonal plasmid pHuN4-F112-SBD1;
[0030] Figure 3 The results of cytopathic effects of the rescued virus are shown in Figure A, where cells infected with the rescued recombinant virus rHuN4-F112-SBD1 48 hours ago show cytopathic effects, and normal cells are the control.
[0031] Figure 4 RT-PCR results of recombinant virus rHuN4-F112-SBD1;
[0032] Figure 5 IFA identification of recombinant virus rHuN4-F112-SBD1;
[0033] Figure 6 Western blot identification of proteins expressed by recombinant virus rHuN4-F112-SBD1;
[0034] Figure 7 Identification of plaque morphology in recombinant virus rHuN4-F112-SBD1;
[0035] Figure 8 Multi-step growth curves of recombinant virus rHuN4-F112-SBD1 and parental virus strain HuN4-F112;
[0036] Figure 9 IFA identification of recombinant virus rHuN4-F112-SBD1 from different generations;
[0037] Figure 10 ELISA antibody detection of swine serum immunized with recombinant virus rHuN4-F112-SBD1, where A represents PRRSV ELISA antibody detection of swine serum immunized with recombinant virus rHuN4-F112-SBD1, and B represents PEDV ELISA antibody detection of swine serum immunized with recombinant virus rHuN4-F112-SBD1. Detailed Implementation
[0038] The terminology used in this invention, unless otherwise specified, generally has the meanings commonly understood by those skilled in the art. The invention is further described in detail below with reference to specific embodiments and data. It should be understood that these embodiments are merely illustrative of the invention and should not be construed as limiting the scope of protection of the invention. Those skilled in the art can make non-essential improvements and adjustments to the invention based on the above description.
[0039] Virus strains, antibodies and main reagents
[0040] The PEDV FJzz1 isolate (Chen et al., 2019), the PRRSV HuN4-F112 attenuated vaccine strain, and the infectious clonal plasmid containing the full-length cDNA of HuN4-F112 were all isolated and preserved in our laboratory (Zhou et al., 2011; Zhang et al., 2011). The anti-PRRSV N protein monoclonal antibody and the anti-PEDV S protein monoclonal antibody were prepared and preserved in our laboratory.
[0041] Main reagents: RNA extraction kit, PCR product gel extraction kit, and plasmid DNA extraction kit were purchased from Omega; 2×LA Taq Premix, DL2000 DNA Marker, DL5000 DNA Marker, pMD18-T vector, and low-melting-point agarose were purchased from Takara; AscⅠ, EcoRI Ⅴ, and SwaⅠ restriction endonucleases were purchased from NEB; SP6 promoter in vitro transcription kit mMESSAGE mMACHINE R SP6 instruction manual was purchased from Ambion; RevertAid FirstStrand cDNA Synthesis Kit, DMRI-C transfection kit, and FITC-labeled goat anti-mouse IgG fluorescent secondary antibody were all purchased from Thermo Scientific.
[0042] 1.2 Selection of the dominant antigenic region of the PEDV S gene
[0043] Because current vaccines primarily target either the intact S protein or the S1 protein, studies have shown that not all epitopes in the S protein can induce neutralizing antibodies. Many non-neutralizing epitopes exist, which can induce a large number of non-neutralizing antibodies. These non-neutralizing antibodies also include those associated with antibody-dependent enhancement (ADE), posing potential risks and negatively impacting vaccine safety. To mitigate these risks, this study analyzed the S gene sequence of the prevalent PEDV variant FJzz1 strain (accession number: MK288006) published in Gene Bank using DNASTAR software. The focus was on the C-terminal domain (1495-2377 nt, encoding amino acid positions: aa 496-792) of the S1 subunit, a region primarily located on the surface of the S protein extracellular domain trimer. Figure 1A) It contains the potential RBD domain for the PEDV S protein to bind to the host cell receptor, which not only makes it highly targeted but also minimizes redundant antigenic epitopes, reducing safety risks. Simultaneously, we introduced the signal peptide sequence of the S gene at its front end to guide the newly synthesized exogenous protein from the recombinant virus to subcellular organelles. To improve the expression efficiency of the introduced exogenous gene, we optimized the selected target gene codons to codons preferred by mammals, specifically pigs.The target gene was named RBD1, as shown in SEQ ID NO.1 (ATGAAGTCTTTAACTTACTTCTGGTTGTTCTTACCAGTACTTTCAACACTTAGCCTACC ACAAGATGTCACCAGGACTTCTTTTGTTACTTTGCCATCATTTAATGATCATTCTTTTGTTAATATTACTGTCTCTGCTGCTTTTGGTGGTCATAGTGGTGCCAACCTTATTGCATCTGACACTACTATCAATGGGTTTAGTTCTTTCTGTGTTGACACTAGACAATTTACCATTTCACTGTTTTATAACGTTACAAACAGTTATGGTTACGTGTCTAAATCACAGGACAGTAATTGCCCTTTTACCTTGCAATCTGTTAATGATTACCTGTCTTTTAGCAAATTTTGTGTTTCTACCAGCCTTTTGGCTAGTGCCTGTACCATAGATCTTTTTGGTTACCCTGAGTTTGGTAGTGGTGTTAAGTTCACGTCCCTTTACTTTCAATTCACAAAGGGTGAGTTGATTACTGGCACGCCTAAACCACTTGAAGGTGTTACGGACGTTTCTTTTATGACTCTGGATGTGTGTACCGAGTATACTATCTATGGCTTTAAAGGTGAGGGTATCATTACCCTTACAAATTCTAGCTTTTTGGCAGGTGTTTATTATACATCTGATTCTGGACAGTTGTTAGCTTTTAAGAATGTCACTAGTGGTGCTGTTTATTCTGTTACGCCATGTTCTTTTTCAGAGCAGGCTGCATATGTTGATGATGATATAGTGGGTGTTATTTCTAGTTTGTCTAGCTCCACTTTTAACAGTACTAGGGAGTTGCCTGGTTTCTTCTACCATTCTAATGATGGCTCTAATTGTACAGAGCCTGTGTTGGTGTATAGTAACATAGGTGTTTGTAAATCTGGCAGTATTGGCTATGTCCCATCTCAGTCTGGCCAAGTCAAGATTGCACCCACGGTTACTGGGAATATCAGTATTCCCACCAACTTTAGTATGAGTATTTAA).
[0044] 1.3 Primer Design
[0045] First, based on the S gene sequence of the prevalent PEDV variant strain FJzz1 (accession number: MK288006), and the Nsp12 and ORF2 gene sequences of HuN4 strain (accession number: EF635006), four pairs of fusion PCR primers for amplifying the dominant antigenic region RBD1 gene fragment of the FJzz1 strain S gene were designed using Primer 5.0 software. The primers were named RBD1-F1 / RBD1-R1, RBD1- The primer pairs F2 / RBD1-R2, RBD1-F3 / RBD1-R3, and RBD1-F4 / RBD1-R4 are used to amplify a fragment of 1066 bp using primers RBD1-F1, RBD1-R1, RBD1-F2, and RBD1-R2, and a fragment of 1222 bp using primers RBD1-F3, RBD1-R3, RBD1-F4, and RBD1-R4 (the sequences of the four primer pairs are shown in SEQ ID NO.2-9). An AscⅠ restriction site is introduced in RBD1-F4, and an EcoRⅤ restriction site is introduced in RBD1-R4.
[0046] Meanwhile, based on the PRRSV HuN4 strain genome sequence (accession number: EF635006), specific primers JD1 and JD2 (primer sequences shown in SEQ ID NO. 10-11) were designed for identifying the inserted fragments of recombinant plasmids or recombinant viruses. The parental PRRSV strain (764 bp) and the recombinant strain with the inserted target gene (1864 bp) can be distinguished based on fragment size. All primers were synthesized by Shanghai Paisennong Biotechnology Co., Ltd.
[0047] 1.4 Amplification of the target fragment
[0048] Genomic RNA of the prevalent PEDV variant strain FJzz1 was extracted using the Total RNA Kit I from Omega. The RNA was then reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit. Using the FJzz1 strain cDNA as a template, PCR amplification was performed using primers RBD1-F1 / RBD1-R1 and RBD1-F2 / RBD1-R2. The PCR reaction system consisted of 50 μl of 2×LATaq Premix 25 μl, primers RBD1-F1, RBD1-R1, RBD1-F2, and RBD1-R2 each (10 pmol / L), 1.0 μl of cDNA template, and 20.0 μl of ddH2O. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for 35 cycles, followed by a final extension at 72℃ for 10 min, and finally, storage of the amplified product at 4℃. After 1% agarose gel electrophoresis, the PCR product was excised and purified using a gel extraction kit. Agarose gel electrophoresis showed that the amplified RBD1 gene containing the signal peptide was approximately 1000 bp in size. Figure 1 B). Subsequently, using the gel-recovered PCR product as a template, PCR amplification was continued using RBD1-F3, RBD1-R3, RBD1-F4, and RBD1-R4 as primers. The PCR reaction system was 50 μl, including 25 μl of 2×LATaq Premix, 1.0 μL each of primers RBD1-F3, RBD1-R3, RBD1-F4, and RBD1-R4 (10 pmol / L), 1.0 μL of cDNA template, and 20.0 μL of ddH2O. The PCR reaction program was as follows: 98℃ pre-denaturation for 30 s, 98℃ denaturation for 10 s, 58℃ annealing for 30 s, 72℃ extension for 1.5 min, for 35 cycles, followed by a final extension at 72℃ for 10 min, and finally, the amplified product was stored at 4℃. After performing 1% agarose gel electrophoresis on the PCR products, the gel was cut, and the PCR products were recovered and purified using a gel extraction kit to obtain the SRBD1 gene. Agarose gel electrophoresis showed that the SRBD1 gene fragment was amplified with AscⅠ and EcoRⅤ restriction enzyme sites fused to the 5' and 3' ends, respectively, and its gene size was approximately 1200 bp. Figure 1 C). This gene fragment was used as the target gene for subsequent gene cloning. An Asc I restriction site was introduced at the 5' end and an EcoR V restriction site was introduced at the 3' end.
[0049] Construction of an infectious clone of the full-length cDNA of 1.5SRBD1 recombinant PRRSV HuN4-F112
[0050] The full-length cDNA clone plasmid pHuN4-F112 containing HuN4-F112 was double-digested with restriction endonucleases AscⅠ and EcoRⅤ. The digestion system consisted of 50 μl of the following: 3 μl each of AscⅠ and EcoRⅤ, 5 μl of 10× Buffer, 3 μg of pHuN4-F112 plasmid, and ddH₂O to bring the total volume to 50 μl. The digestion reaction was carried out at 37°C for 3 h. The digestion products were mixed with loading buffer and separated by electrophoresis on a 0.8% agarose gel. The digestion products were then purified using an Omega gel extraction kit.
[0051] The purified PCR product SRBD1 was ligated with the AscⅠ / EcoRⅤ double digestion product pHuN4-F112 using homologous recombinase. The homologous recombination ligation system consisted of 10 μl of 5×In-Fusion HD Enzyme premix, 6 μl of SRBD1 gel-recovered product, 2 μl of pHuN4-F112 plasmid double digestion gel-recovered product, and 1 μl of ddH₂O. The mixture was then incubated at 50℃ for 60 min and then at 4℃ for 5 min. The ligation product was then transformed into TOP10 competent cells. The transformed product was plated on LB solid medium containing Amp resistance and incubated overnight at 37°C. Single colonies were then picked and cultured in LB liquid medium containing Amp resistance at 37°C in a shaker. Plasmids were extracted using a plasmid DNA extraction kit and then identified by PCR using primers JD1 and JD2. The PCR reaction system was 20 μl, including 10 μl of 2×LATaq Premix, 1.0 μL each of primers JD1 and JD2 (10 pmol / L), 1.0 μL of plasmid template, and 7.0 μL of ddH2O. The PCR reaction program was as follows: 98℃ pre-denaturation for 30s, 95℃ denaturation for 10s, 58℃ annealing for 30s, 72℃ extension for 2min, for 35 cycles, followed by a final extension at 72℃ for 10min. The obtained PCR amplification products were observed by 1% agarose gel electrophoresis to screen for positive plasmids. The results showed that the positive pHuN4-F112-SRBD1 recombinant plasmid could amplify a specific band of approximately 1800bp. Figure 2The recombinant plasmid identified as positive by PCR was sequenced, and the results showed that the inserted exogenous gene was consistent with the original sequence, indicating that the full-length infectious clone plasmid of recombinant pHuN4-F112-SRBD1 was successfully obtained. Further sequencing identification was performed (sequencing was completed by Shanghai Paisenno Biotechnology Co., Ltd.). Finally, the plasmid that was correctly identified by PCR and sequencing was named pHuN4-F112-SRBD1, and its full-length nucleotide sequence is shown in SEQ ID NO. 12.
[0052]
[0053] GGCTGAGCATCTCAAGCGCTACTCTCCGCCTGCCGAAGGGAACTGTGGTTGGCACTGCATTTCCGCCATCGCCAACCGGATGGTGAATTCC
[0054] AACTTTGAGACCACCCTTCCTGAAAGAGTAAGGCCTTCAGATGACTGGGCCACTGACGAGGATCTTGTGAACATCATCCAAATCCTCAGGC
[0055] TCCCTGCGGCCTTGGACAGGAACGGCGCTTGCGGTAGCGCCAAGTACGTGCTTAAACTGGAGGGTGAGCATTGGACTGTCTCTGTGATCCC
[0056] TGGGATGTCCCCTACTTTGCTCCCCCTTGAATGTGTTCAGGGTTGTTGTGAGCATAAGGGCGGTCTTGTTTCCCCGGATGCGGTCGAAATT
[0057] TCCGGATTTGATCCTGCCTGCCTTGACCGACTGGCTAAGGTAATGCACTTGCCTAGCAGTACCATCCCAGCCGCTCTGGCCGAATTGTCCG
[0058] ACGACTCCTACCGTCCGGTTTCCCCGGCCGCTACTACGTGGACTGTTTCGCAATTCTATGCTCGTTATAGAGGAGGAGATCATCATGACCA
[0059] GGTGTGCTTGGGGAAAATCATCAGCCTTTGTCAAGTTATTGAGGATTGCTGCTGCCATCAGAATAAAACCAACCGGGCTACTCCGGAAGAG
[0060] GTCGCGGCAAAGATTGATCAGTACCTCCGTGGCGCAACAAGTCTTGAGGAATGCTTGGCCAAACTTGAGAGAGTTTCCCCGCCGAGCGCTG
[0061] CGGACACCTCCTTTGATTGGAATGTTGTGCtTCCTGGGGTTGAGGCGGCGAATCAGACAACCGAACAACCTCACGTCAACTCATGCTGCAC
[0062] CCTGGTCCCTCCCGTGACTCAAGAGCCTTTGGGCAAGGACTCGGTCCCTCTGACCGCCTTCTCACTGTCCAATTGCTATTACCCTGCACAA
[0063] GGTGACGAGGTTCATCACCGTGAGAGGTTAAATTCCGTACTCTCTAAGTTGGAAGAGGTTGTCCTGGAAGAATATGGGCTCATGTCCACTG
[0064] GACTTGGCCCGCGACCCGTGCTGCCGAGCGGGCTCGACGAGCTTAAAGACCAGATGGAGGAGGATCTGCTAAAACTAGCCAACACCCAGGC
[0065] GACTTCAGAAATGATGGCCTGGGCGGCTGAGCAGGTCAATTTAAAAGCTTGGGTCAAAAGCTACCCGCGGTGGACACCACCACCCCCTCCA
[0066] CCAAGAGTTCAACCTCGAAGAACAAAGTCTGTCAAAAGCTTGCCAGAGGGCAAGCCTGTCCCTGCTCCGCGCAGGAAGGTCAGATCCGATT
[0067] GCGGCAGCCCGGTTTTGATGGGCGACAATGTCCCTAACGGTTCGGAAGAAACTGTCGGTGGTCCCCTCAATTTTCCGACACCATCCGAGCC
[0068] GATGACACCTATGAGTGAGCCCGTACTTATGCCCGCGTCGCGACGTGCCCCCAAGCTGATGACACCTTTGAGTGGGTCGGCACCAGTTCCT
[0069] GCACCGCGTAGAACTGTGACAACAACGCTGACGCACCAGGATGAGCCTCTGGATTTGCCTGCGTCCTCACAGACGGAATATGAGGCTTTCC
[0070] CCCTAGCACCATCGCAGAACATGGGCATCCTGGAGGCGGGGGGGCAAGAAGTTGAGGAAGTCCTGAGTGAAATCTCGGATATACTAAATGA
[0071] CACCAACCCTGCACCTGTGTCATCAAGCAGCCCCCTGTCAAGTGTTAAGATCACACGCCCAAAATACTCAGCTCAAGCCATCATCGACTCT
[0072] GGCGGGCCTTGCAGTGGGCATCTCCAAAAGGAAAAAGAAGCATGCCTCAGCATCATGCGTGAGGCTTGTGATGCGTCCAAGCTTGGTGATC
[0073] CTGCTACGCAGGAGTGGCTCTCTCGCATGTGGGATAGGGTTGACATGCTGACTTGGCGCAACACGTCTGCTTACCAGGCGTTTCGCATCTT
[0074] AAGTGGCAGGTTTGAGTTTCTCCCAAAGATGATTCTCGAGACACCGCCGCCCCACCCGTGCGGGTTTGTGATGTTACCTCGCACGCCTGCA
[0075] CCTTCCGTGAGTGCAGAGAGTGACCTCACCATTGGTTCAGTGGCCACCGAGGATGTTCCACGCATCCTCGGGAAAATAGGAGACACTGACG
[0076] AGCTGCTTGACCGGGGTCCCTCGGCACCCTCCAAGGGAGAACCGGTCAGTGACCAACCTGCCAAAGATCCCCGGATGTCGCCGCGGGAGTC
[0077] TGACGAGAGCATGATAGCTCCGCCCGCAGATACAGGTGGTGTCGGCTCATTCACTGATTTGCCGTCTTCAGATGGTGTGGATGTGGACGGG
[0078] GGGGGGCCGTTAAGAACGGTAAAAACAAAAGCGGGGAGGCTCTTAGACCAACTGAGCTGCCAGGTTTTTAGCCTCGTTTCCCATCTCCCTA
[0079] TTTTCTTCTCACACCTCTTCAAATCTGACAGTGGTTATTCTCCGGGTGATTGGGGTTTTGCAGCTTTTACTCTATTTTGCCTCTTTCTATG
[0080] TTACAGTTACCCATTCTTCGGTTTTGCTCCCCTCTTGGGTGTATTTTCTGGGTCTTCTCGGCGTGTGCGAATGGGGGTTTTTGGCTGCTGG
[0081] TTGGCTTTTGCTGTTGGTCTGTTCAAGCCTGTGTCCGACCCAGTCGGCACTGCTTGTGAGTTTGACTCGCCAGAGTGTAGGAACGTACTTC
[0082] ATTCTTTTGAGCTTCTCAAACCTTGGGACCCTGTCCGCAGCCTTGTTGTGGGCCCCGTCGGTCTCGGCCTTGCCATTCTTGGCAGGTTACT
[0083] GGGCGGGGCACGCTATATCTGGCACTTTTTGCTTAGGCTTGGCATTGTTACAGACTGTATCTTGGCTGGAGCTTATGTGCTTTCTCAAGGT
[0084] AGGTGTAAAAAGTGCTGGGGATCTTGTGTAAGAACTGCTCCTAATGAGATCGCCTTCAACGTGTTCCCTTTTACACGTGCGACCAGGTCGT
[0085] CACTCATCGACCTGTGCGATCGGTTTTGCGCACCAAAAGGCATGGACCCCATTTTTCTCGCCACTGGGTGGCGTGGGTGCTGGACCGGCCG
[0086] GAGTCCCATTGAGCAACCTTCTGAAAAACCCATCGCGTTCGCCCAGCTGGATGAGAAGAGGATTACGGCTAGAACTGTGGTCGCTCAGCCT
[0087] TATGATCCCAACCAGGCCGTAAAGTGCTTGCGGGTATTACAGGCGGGTGGGGCGATGGTGGCCGAGGCAGTCCCAAAAGTGGTCAAAGTTT
[0088] CCGCTATTCCATTCCGAGCTCCTTTCTTTCCCGCTGGAGTGAAAGTTGATCCTGAGTGCAGAATCGTGGTTGATCCCGATACTTTTACTAC
[0089] AGCCCTCCGGTCTGGCTATTCCACCGCGAACCTCGTCCTTGGTACGGGGGACTTTGCCCAGCTGAATGGACTAAAGATCAGGCAAATTTCC
[0090] AAGCCTTCAGGGGGAGGCCCACACCTCATTGCTGCCTTGCATGTTGCCTGCTCGATGGCGTTACACATGCTTGCTGGTGTTTATGTAACTG
[0091] CAGTGGGGTCCTGCGGTACCGGCACCAACGATCCGTGGTGCACTAACCCGTTTGCCGTCCCTGGCTACGGACCTGGCTCTCTTTGCACGTC
[0092] TAGATTGTGCATCTCCCAACACGGCCTCACCTTGCCCTTGACAGCACTTGTGGCGGGATTCGGCCTTCAAGAGATTGCCTTGGTCGTTTTG
[0093] ATTTTTGTCTCCATCGGAGGCATGGTTCATAGGTTGAGTTGTAAGGCTGACATGTTGTGCATCTTACTCGCAATCGCTAGTTATGTTTGGG
[0094] TACCTCTTACCTGGTTGCTTTGTGTGTTTCCTTGTTGGTTGCGCTGGTTCTCTTTGCACCCCCTCACCATCCTGTGGTTGGTGTTTTTCTT
[0095] GATTTCTGTAAATATACCCTCGGGAATCTTGGCCGTGGTGTTATTGGTTTCTCTCTGGCTTTTAGGTCGTTATACTAACATTGCTGGTCTC
[0096] GTCACCCCCTATGACATTCATCATTACACCAGTGGTCCCCGCGGTGTCGCCGCCTTGGCCACCGCACCAGATGGAACCTACTTGGCTGCCG
[0097] TCCGCCGTGCTGCGCTGACTGGTCGTACCATGCTGTTCACCCCGTCTCAGCTCGGGTCCCTCCTTGAGGGCGCTTTCAGAACTCAAAAGCC
[0098] CTCACTGAACACCGTCAATGTGGTCGGGTCCTCCATGGGCTCTGGCGGAGTGTTCACTATTGACGGGAAAATCAAGTGCGTGACTGCCGCA
[0099] CATGTCCTTACGGGTAACTCAGCTAGGGTTTCTGGGGTCGGCTTCAATCAAATGCTTGACTTTGATGTAAAAGGGGACTTCGCCATAGCTG
[0100] ATTGCCCGAATTGGCAAGGGGTTGCTCCCAAGGCCCAGTTCTGCGAGGATGGGTGGACTGGTCGCGCCTATTGGCTGACATCCTCTGGCGT
[0101] TGAACCCGGTGTTATTGGGAATGGGTTCGCCTTCTGCTTCACCGCGTGTGGCGATTCTGGATCCCCAGTGATTACCGAAGCCGGTGAGCTT
[0102] GTCGGCGTTCACACAGGATCAAACAAACAAGGAGGAGGCATTGTCACGCGCCCCTCAGGCCAGTTTTGTAATGTGAAGCCCATCAAGCTGA
[0103] GCGAGTTGAGTGAATTCTTCGCTGGACCTAAGGTCCCGCTCGGTGATGTGAAAATTGGCAGTCACATAATTAAAGACACATGCGAGGTGCC
[0104] TTCAGATCTTTGTGCCCTGCTTGCTGTCAAACCCGAACTGGAAGGAGGCCTTTCCACAGTTCAACTTCTGTGTGTGTTTTTCCTCCTGTGG
[0105] CGAATGATGGGGCATGCCTGGACGCCCTTGGTTGCTGTGGGGTTTTTCATCCTGAATGAGATTCTCCCAGCTGTCCTGGTCCGGAGTGTTT
[0106] TCTCCTTTGGGATGTTTGTGCTATCTTGGCTCACACCATGGTCTGCACAAGTCCTGATGATCAGGCTTCTGACAGCAGCCCTTAACAGAAA
[0107] CAGATGGTCTCTTGGTTTTTACAGCCTTGGTGCAGTAACCAGTTTTGTCGCAGATCTTGCGGTAACTCAAGGGCATCCGTTACAGGTGGTA
[0108] ATGAACTTAAGCACCTATGCCTTCCTGCCCCGGATGATGGTTGTGACCTCGCCAGTCCCAGTGATCGCGTGTGGTGTTGTGCACCTCCTTG
[0109] CCATAATTTTGTACTTGTTTAAGTACCGCTGCCTTCACAATGTCCTTGTTGGCGATGGGGTGTTCTCTTCGGCTTTCTTCTTGCGATACTT
[0110] TGCCGAGGGAAAGTTGAGGGAAGGGGTGTCGCAATCCTGCGGGATGAGTCATGAGTCGCTGACTGGTGCCCTCGCCATGAGACTCACTGAC
[0111] GAGGACTTGGATTTCCTTACGAAATGGACTGATTTTAAGTGCTTTGTTTCTGCGTCCAACATGAGGAATGCAGCGGGCCAATTTATCGAGG
[0112] CTGCTTATGCAAAAGCACTAAGAGTTGAACTTGCTCAGTTGGTACAGGTTGACAAGGTCCGAGGCACCATGGCCAAACTCGAGGCTTTTGC
[0113] CGATACCGTGGCACCCCAACTCTCGCCCGGTGACATTGTTGTTGCCCTTGGCCACACGCCTGTTGGCAGCATCTTCGACCTAAAGGTTGGT
[0114] AGCACCAAGCATACTCTCCAAGCCATTGAGACTAGAGTCCTTGCCGGGTCCAAAATGACTGTGGCGCGTGTCGTTGACCCAACCCCCGCAC
[0115] CCCCACCCGTACCTGTGCCCATCCCTCTCCCACCGAAAGTTCTGGAGAACGGTCCCAATGCCTGGGGGGATGAGGACCGTTTGAACAAGAA
[0116] GAAGAGGCGCAGGATGGAAGCCGTCGGCATTTTTGTCATGGACGGGAAAAAGTACCAGAAATTTTGGGACAAGAATTCCGGTGATGTGTTT
[0117] TATGAGGAGGTCCATATTAGCACAGACGAGTGGGAGTGCCTTAGAACTGGCGACCCTGTCGACTTTGATCCTGAGACAGGGATTCAGTGTG
[0118] GGCATATCACCATTGAAGATAAGGTTTACAATGTCTTCACCTCCCCATCTGGCAGGAGATTCTTGGTCCCCGCCAACCCCGAGAATAGAAG
[0119] AGCTCAGTGGGAAGCCGCCAAGCTTTCCGTGGAGCAAGCCCTTGGTATGATGAACGTCGACGGCGAACTGACTGCCAAAGAACTGGAGAAA
[0120] CTGAAAAGAATAATTGACAAACTCCAAGGCCTGACTAAGGAGCAGTGTTTAAACTGCTAGCCGCCAGCGGCTTGACCCGCTGTGGTCGCGG
[0121] CGGCTTAGTTGTTACTGAGGCAGCGGTAAAAATAGTCAAATTTCACAACCGGACCTTCACCCTAGGACCTGTGAACTTAAAAGTGGCCAGT
[0122] GAGGTTGAGCTAAAAGACGCGGTTGAGCACAACCAACATCCGGTTGCCAGACCGGTTGATGGTGGTGTTGTGCTCCTGCGCTCTGCAGTTC
[0123] CTTCGCTTATAGATGTCTTGATCTCCGGCGCTGATGCATCTCCTAAGTTACTCGCCCGCCACGGGCCGGGAAACACTGGGATTGATGGCAC
[0124] GCTTTGGGATTTTGAGGCCGAGGCTACTAAAGAGGAAGTTGCACTCAGTGTGCAAATAATACAGGCTTGTGATATTAGGCGCGGCGACGCG
[0125] CCTGAAATTGGTCTCCCTTATAAGTTGTACCCTGTTAGGGGCAACCCTGAGCGGGTAAAAGGAGTTTTACAGAATACAAGGTTTGGAGACA
[0126] TACCTTACAAAACCCCTAGTGACACTGGAAGCCCGGTGCACGCGGCTGCCTGCCTCACGCCTAATGCTACTCCGGTGACTGATGGGCGCTC
[0127] CGTCTTGGCTACAACCATGCCCTCTGGCTTTGAGTTGTATGTGCCGACCATTCCAGCGCCCGTCCTTGATTATCTTGATTCTAGGCCTGAC
[0128] TGCCCTAAACAGTTAACAGAGCACGGTTGTGAGGATGCTGCATTAAGAGACCTCTCCAAGTATGATTTGTCCACCCAAGGCTTTGTTTTGC
[0129] CTGGAGTTCTTCGCCTCGTGCGGAAGTACCTGTTCGCCCACGTGGGTAAGTGCCCGCCCGTTCATCGGCCTTCCACTTACCCTGCTAAGAA
[0130] TTCTATGGCTGGAATAAATGGGAACAGGTTTCCAACCAAGGACATTCAGAGCGTCCCTGAAATCGACGTTCTGTGCGCACAGGCTGTGCGA
[0131] GAAAACTGGCAAACTGTTACCCCTTGTACCCTCAAGAAACAGTACTGTGGGAAGAAGAAGACTAGGACAATACTTGGCACCAATAACTTTA
[0132] TTGCGTTGGCCCATCGGGCAGCGTTGAGTGGTGTTACCCAGGGCTTCATGAAAAAAGCGTTCAACTCGCCCATCGCCCTCGGGAAAAACAA
[0133] ATTTAAGGAGCTACAAGCCCCGGTCCTAGGCAGGTGCCTTGAAGCTGATCTTGCGTCCTGCGATCGATCCACACCTGCAATTGTCCGCTGG
[0134] TTTGCCGCCAATCTTCTTTATGAACTCGCCTGTGCTGAGGAGCATCTACCGTCGTACGTGCTGAACTGCTGCCACGACTTACTGGTCACGC
[0135] AGTCCGGCGCGGTGACTAAGAGAGGTGGCCTGTCGTCTGGCGACCCGATTACCTCTGTGTCAAACACCATTTACAGCTTAGTGATATATGC
[0136] ACAGCACATGGTGCTCAGTTACTTCAAAAGTGGTCACCCTCATGGCCTTCTGTTTCTGCAAGACCAGCTAAAGTTTGAGGACATGCTCAAG
[0137] GTTCAACCCCTGCTCGTCTATTCGGACGACCTTGTGTTGTATGCCGAGTCTCCCTCCATGCCAAACTACCACTGGTGGGTTGAACATCTGA
[0138] ATCTTATGCTGGGTTTCCAGACGGACCCAAAGAAGACAACCATCACAGACTCACCATCATTCCTAGGTTGCAGGATAATAAATGGGCGCCA
[0139] GCTAGTCCCTAACCGTGACAGGATCCTCGCGGCCCTTGCCTACCATATGAAGGCAAGTAATGTTTCTGAATACTACGCCTCGGCGGCTGCA
[0140] ATACTCATGGACAGCTGTGCTTGTTTAGAGTATGATCCTGAATGGTTTGAAGAGCTCGTGGTTGGGATAGCGCAGTGCGCCCGCAAGGACG
[0141] GCTACAGCTTTCCTGGCCCACCGTTCTTCTTGTCCATGTGGGAAAAACTCAGGTCCAATCATGAGGGGAAGAAGTCCAGAATGTGCGGGTA
[0142] CTGCGGGGCCCCGGCTCCGTACGCCACTGCCTGTGGTCTCGATGTCTGTGTTTACCACACCCACTTCCACCAGCATTGTCCTGTTATAATC
[0143] TGGTGTGGCCACCCGGCGGGTTCTGGTTCTTGTAGTGAGTGCGAACCCCCCCTAGGAAGAGGCACAAGCCCTCTAGATGAGGTGTTAGGAC
[0144] AAGTTCCGTACAAGCCTCCGCGGACTGTGATCATGCATGTGGAGCAGGGTCTCACCCCTCTTGACCCAGGTAGATACCAGACTCGCCGCGG
[0145] ATTAGTCTCCGTTAGGCGTGGCATCAGGGGAAATGAAGTCGACCTACCAGACGGTGATTACGCTAGTACCGCCTTGCTCCCTACTTGTAAA
[0146] GAGATCAACATGGTCGCTGTCGCCTCTAACGTGTTGCGCAGCAGGTTTATCATCGGCCCACCCGGTGCTGGGAAAACACACTGGCTTCTTC
[0147] AACAAGTCCAGGATGGTGATGTCATTTACACGCCAACTCACCAGACCATGCTCGACATGATTAGGGCTTTGGGGACGTGCCGGTTCAACGT
[0148] TCCAGCAGGTACAACGCTGCAATTCCCTGCCCCCTCCCGTACCGGCCCATGGGTTCGCATCTTGGCCGGCGGTTGGTGTCCTGGCAAGAAC
[0149] TCCTTCCTGGATGAAGCGGCGTATTGCAATCACCTTGATGTCTTGAGGCTTCTCAGTAAAACAACTCTCACTTGCCTAGGGGACTTCAAAC
[0150] AACTCCACCCTGTGGGTTTTGACTCCCATTGCTATGTATTTGACATCATGCCTCAGACCCAATTAAAGACCATCTGGAGGTTCGGGCAGAA
[0151] TATCTGTGATGCCATTCAACCAGATTACAGGGACAAACTTATGTCCATGGTCAACACGACCCGTGTGACCTACGTGGAAAAACCTGTCAgG
[0152] TATGGGCAAGTCCTCACCCCCTACCACAGGGACCGAGAGGACGGCGCCATTACTATCGACTCCAGTCAAGGCGCCACATTTGATGTGGTTA
[0153] CACTGCATTTACCCACTAAAGATTCACTCAACAGGCAAAGAGCTCTTGTTGCTATCACCAGGGCAAGACATGCTATCTTCGTGTATGACCC
[0154] ACACAGGCAATTGCAGAGCATGTTTGATCTCCCCGCGAAAGGCACACCCGTCAACCTTGCAGTGCACCGTGACGAACAGCTGATCGTATTA
[0155] GACAGAAACAACAGAGAAATCACGGTTGCTCAGGCTCTAGGCAATGGAGATAAATTCAGGGCCACAGATAAGCGCGTTGTAGATTCTCTCC
[0156] GCGCTATTTGCGCAGACCTGGAAGGGTCGAGCTCCCCGCTCCCCAAGGTCGCGCATAACTTGGGATTCTATTTCTCACCTGATTTGACTCA
[0157] GTTTGCTAAACTCCCGGCAGAACTTGCACCCCACTGGCCCGTGGTGACAACCCAGAACAATGAAAGGTGGCCAGATCGGCTGGTAGCCAGC
[0158] CTTCGCCCTATCCATAAATATAGCCGCGCGTGCATTGGTGCCGGCTATATGGTGGGGCCCCTCGGTGTTTTTAGGCACCCTGGGGTGTGT
[0159] CATACTATCTCACAAAATTGTTAGAGGCGAGGCTCAAATGCTTCCGGAGACAGTCTTCAGCACTGGCCGAATTGAGGTAGATTGCCGAGA
[0160] GTATCTTGATGATCGGGAGCGAGAAGTTGCTGAGTCCCTCCCCACATGCCTTCATCGGCGATGTCAAAGGTACCACCGTTGGGGGATGTCAT
[0161] CACGTTACCTCCAAATACCTTCCGCGCTTCCTTCCCAAGGAATCAGTTGCGGTGGTCGGGGTTTCGAGCCCCGGGAAAGCCGCGAAAGCAG
[0162] TTTGCACATTGACGGATGTGTACCTCCCCAGACCTTGAAGCGTACCTCTACCCAGAGACCCAGTCCAGGTGCTGGAAGTGATGTTGGACTT
[0163] TAAGGAGGTTCGACTGATGGTATGGAAGACAAGACGGCCTATTTTCAACTTGAAGGCCGTCATTTTACCTGGTATCAACTTGCAAGCTAC
[0164] GCCTCATACATCCGAGTTCCTGTTAATTCTACTGTGTACTTGGACCCCTGCATGGGCCCTGCTCTTTGCAACAGAAGGGTTGTCGGGTCCA
[0165] CCCATTGGGGAGCTGACCTCGCAGTCACCCCTTATGATTACGGTGCCAAAATTATTCTGTCTAGTGCATACCATGGTGAAATGCCTCCAGG
[0166] TTACAAAATTCTGGCGTGCGCGGAGTTCTCGCTTGATGACCCAGTAAGGTACAAACACACCTGGGGATTTGAATCGGATACAGCGTATCTG
[0167] TACGAGTTTACTGGAAATGGTGAGGACTGGGAGGATTACAATGATGCGTTTCGGGCGCGCCAGAAAGGGAAAATTTATAAAGCTAATGCCA
[0168] TCAGCATGAGGTTTCATTTTCCCCCGGGCCCTGTCATTGAACCAACTTTAGGCCTGAATTGAAATGAAGTCCCTTACCTACTTCTGGCTGT
[0169] TCCTCCCTGTTCTTTCGACATTGTCCCTGCCTCAGGACGTAACCCGCACTAGCTTTGTGACACTTCCATCTTTCAATGACCACAGTTTTGT
[0170] TAACATCACGGTGTCCGCGGCATTTGGTGGACACTCAGGGGCCAACCTCATCGCATCAGATACCACCATCAACGGCTTTTCGTCATTCTGT
[0171] GTTGACACAAGGCAGTTTACCATATCTTTATTTTATAATGTGACCAATTCCTATGGCTATGTTTCTAAAAGTCAAGATTCTAACTGCCCTT
[0172] TCACACTGCAGAGTGTGAATGACTATCTGAGCTTTTCAAAATTCTGCGTATCCACATCGCTTTTGGCCAGCGCCTGTACCATTGACCTGTT
[0173] TGGCTACCCAGAATTTGGCTCTGGAGTCAAGTTCACTTCACTGTATTTCCAGTTCACCAAGGGAGAATTAATAACAGGCACACCCAAGCCT
[0174] CTGGAAGGTGTAACAGATGTCTCCTTCATGACATTGGATGTGTGCACGGAATACACTATCTACGGCTTCAAGGGGGAGGGAATCATCACTT
[0175] TAACCAACTCTTCTTTCCTGGCGGGCGTTTATTATACCTCAGACTCTGGCCAGCTCTTAGCCTTTAAGAACGTGACCAGCGGGGCTGTGTA
[0176] CTCCGTTACGCCCTGCAGCTTCTCTGAGCAGGCAGCTTACGTGGACGATGATATAGTGGGTGTGATCTCTTCTCTTTCAAGCAGCACCTTT
[0177] AACAGTACCCGGGAGCTGCCGGGGTTCTTCTATCATTCGAATGATGGTAGTAACTGTACGGAGCCTGTACTGGTATATTCCAATATAGGCG
[0178] TTTGCAAAAGCGGCAGCATCGGGTACGTCCCCTCCCAATCAGGCCAAGTGAAAATTGCCCCCACCGTCACGGGTAACATTTCCATCCCTAC
[0179] GAACTTCTCCATGTCTATTTAAGTTCCGTGGCAACCCCTTTAACCAGAGTTTCAGCGGAACGATGAAATGGGGTCTATGCAAAGCCTCTTT
[0180] AACAAAATTGGCCAACTTTTTGTGGATGCTTTCACGGAATTTCTGGTGTCCATTGTTGATATCATCATATTTTTGGCCATTTTGTTTGGCT
[0181] TCACAATCGCCGGTTGGCTGGTGGTCTTCTGCATCAGACTGGTTTGCTCCGCGGTACTCCGTGCGCGCTCTACCGTTCACCCTGAGCAATT
[0182] ACAGAAGATCTTATGAGGCCTTTCTTTCTCAGTGTCAGGTGGACATTCCCACCTGGGGCGTCAAACACCCTTTGGGGGTGCTTTGGCACCA
[0183] TAAGGTGTCAACCCTGATTGATGAAATGGTGTCGCGTCGAATGTACCGCGTCATGGATAAAGCAGGGCAGGCTGCCTGGAAACAGGTGGTG
[0184] AGCGAGGCTACATTGTCTCGCATTAGTGGTTTGGATGTGGTGGCTCACTTTCAACATCTTGCCGCTATTGAAGCCGAGACTTGTAAATATT
[0185] TGGCTTCCCGGCTACCCATGCTGCACAACCTGCGCTTGACAGGGGCAAATGTAACCATAGTGTATAATAGTACTTTGGATCAGGTGTTTGC
[0186] CATTTTCCCAACCCCTGGTTCCCGGCCAAAGCTTCACGATTTTCAGCAATGGCTAATAGCTGTACATTCCTCCATATTTTCCTCCGTTGCA
[0187] GCTTCTTGTACTCTTTTTGTTGTGCTGTGGTTGCGAATTCCAATGCTACGTTCTGTTTTTGGTTTCCGCTGGTTAGGGGCAATTTTTCTTT
[0188] TGAACTCGTGGTGAATTACACGGTATGCCCGCTTTGCCCAACCCGGCAGGCAGCCGCTGAGATCCTTGAGCCCGGCAAGTCTTTTTGGTGC
[0189] AGGATAGGGCATGACCGATGTAGTGAGAACGATCATGACGAACTAGGGTTCATGGTTCCGCCTGGCCTCTCCAGCGAAGGCCACTTGACCA
[0190] GTGTTTACGCCTGGTTGGCGTTCCTGTCCTTCAGCTACACGGCCCAGTTCCATCCCGAGATATTTGGGATAGGGAATGTGAGTCAAGTTTA
[0191] TGTTGACATCAAGCACCAATTCATCTGCGCTGTTCACGACGGGGATAACGCCACCTTGCCTCGCCATGACAATATTTCAGCCGTATTTCAG
[0192] ACCTACTACCAACACCAGGTCGACGGCGGCAATTGGTTTCACCTGGAATGGCTGCGTCCTTTCTTTTCCTCTTGGTTGGTTTTAAATGTTT
[0193] CGTGGTTTCTCAGGCGTTCGCCTGCAAGCCATGTTTCAGTTCGAGTCTTTCGGACATCAAAACCAACACCACCGCAGCATCAAACTTCGTT
[0194] GTCCTCCAGGACATCAGCTGCCTTAGGCATGGCGACTCGTCCTCTCCGACGATTCGCAAAATTCCTCAGTGCCGCACGGCGATAGGGACGC
[0195] CCGTGTACATCACCATCACTGCCAATGTCACAGATGAAAATTATCTACATTCTTCTGATCTCCTCATGCTTTCTTCTTGCCTTTTCTATGC
[0196] TTCCGAGATGAGTGAAAAGGGATTCAAAGTGGTGTTTGGCAATGTGTCAGGCGTCGTGGCTGTGTGCATCAACTTTACCAGCTACGTCCAA
[0197] CACGTCAAGGAGTTTACCCAACGCTCCTTAGTGGTCGATCATGTGCGACTGCTTCATTTCATGACACCTGGGACAATGAGGTGGGCAACCG
[0198] TTTTAGCCTGTCTTTTTGCCATCCTACTGGCAATTTGAATGTTCAAGTATGTTGGGGAAGTGCTTGACCGCGTGCTGTTGCTCGCGATTGC
[0199] TTTTTTTGTGGTGTATCGTGCCGTTCTATCTTGCTGTGCTCGTCAACGCCAGCAACGACAACAGCTCTCATATTCAGTTGATTTATAACTT
[0200] AACGTTATGTGAGCTGAATGGCACAGATTGGCTGGCACAAAAATTtGACTgGGcAGtGgAgACTTTTGTCATCTTCCCCGTGTTGACTCAC
[0201] ATTGTTTCCTATGGGGCACTCACCACCAGCCATTTCCTTGACACAGTTGGTCTGGCCACTGTGTCCACCGCCGGATATTATCACGGGCGGT
[0202] ATGTCTTGAGTAGCATTTACGCAGTCTGTGCTCTGGCTGCGCTGATTTGCTTTGTCATTAGGCTTGCGAAGAACTGCATGTCCTGGCGCTA
[0203] CTCTTGTACCAGATATACCAACTTCCTTCTGGACACTAAGGGCAGACTCTATCGTTGGCGGTCGCCCGTCATTGTGGAGAAAGGGGGTAAG
[0204] GTTGAGGTCGAAGGTCACCTGATCGACCTCAAGAGAGTTGTGCTTGATGGTTCCGCGGCAACCCCTTTAACCAGAGTTTCAGCGGAACGAT
[0205] GGGGTCGTCTCTAGACGACTTCTGCAATGATAGCACAGCTCCACAGAAGGTGCTTTTGGCGTTTTCCATTACCTACACGCCAGTGATGATA
[0206] TATGCTCTAAAGGTAAGTCGCGGCCGACTGCTAGGGCTTCTGCACCTTTTGATCTTCTGAATTGTGCTTTTACCTTCGGGTACATGACAT
[0207] TCGCGCACTTTGAGAGCACAAATAGGGTCGCGCTCACTATGGGAGCAGTAGTTGCACTTCTTTGGGGAGTGTACTCAGCCATAGAAACCTG
[0208] GAAATTCATCACCTCCAGATGCCGTTTGTGCTTGCTAGGCCGCAAGTACATTCTGGCCCCTGCCCACCACgTCgAAAGTGCCGCGGGCTTT
[0209] CATCCGATTGCGGCAAATGATAACCACGCATTGTCGTCCGGCGTCCCGGCTCCACTACGGTCAACGGCACATTGGTGCCCGGGTTGAAAA
[0210] GCCTCGTGTTGGGTGGCAGAAAAGCTGTTAAGCAGGGAGTGGTAAACCTTGTTAAATATGCCAAATAACAACGGCAAGCAGCAAAAGAAAA
[0211] AGAAGGGGAATGGCCAGCCAGTCAATCAGCTGTGCCAAATGCTGGGTAAGATCATCGCCCAACAAAACCAGTCCAGAGGCAAGGGACCGGG
[0212] GAAGAAAAATAGGAAGAAAAACCCGGAGAAGCCCCATTTCCCTCTAGCGACTGAAGATGACGTCAGGCATCACTTTACCCTAGTGAGCGG
[0213] CAATTGTGTCTGTCGTCGATCCAGACTGCATTCAATCAGGGCCTGGAACTTGTGCCCTGTCAGATTCAGGGAGGATAAGTTACACTGTGG
[0214] AGTTTAGTTTGCCGACGCAACATACTGTGCGTCTGATCCGCGCCACAGCATCACCCTCAGCATGATGGGCTGGCATTCTTTGGCACCTCAG
[0215] TGTTAGAATTGGGAGAATGTGTGGTGAATGGCACTGATTGACACTGTGCCTCTAAGTCACCTATTCAATTAGGGCGACCGTGTGGGGGTAAAGTTTAATTGGCGAGAACCATGCGGCCGTAATTAAA).
[0216] 1.6 Rescue of Recombinant Viruses
[0217] 1.6.1 Linearization of pHuN4-F112-SRBD1 full-length cDNA
[0218] The correctly identified recombinant PRRSV full-length cDNA clone plasmid pHuN4-F112-SRBD1 was linearized using the restriction endonuclease SwaⅠ. The linearization system consisted of 50 μl: 5 μl of 10×NEB buffer, 5 μl of restriction endonuclease SwaⅠ, 30 μg of pHuN4-F112-SRBD1 plasmid, and ddH2O to a final volume of 50 μl. The digestion was carried out overnight at 25°C. After the digestion reaction was complete, the digestion products were purified using a gel extraction kit.
[0219] 1.6.2 In vitro transcription
[0220] Linearized pHuN4-F112-SRBD1 recombinant plasmid DNA was transduced using the SP6 promoter in vitro transcription kit mMESSAGE mMACHINE. RFollowing the SP6 instruction manual, in vitro transcription was performed to synthesize full-length PRRSV genomic RNA containing the SBD1 gene. The in vitro transcription system (20 μL) consisted of: 10 μL 2×NTP / CAP, 2 μL Enzyme Mix, 2 μL 10×Reaction Buffer, 2 μg linearized pHuN4-F112-SRBD1 recombinant plasmid DNA, and ddH2O to a final volume of 20 μL. The in vitro transcription system was incubated at 37°C for 105 min, and the transcribed RNA from the pHuN4-F112-SRBD1 recombinant plasmid was collected.
[0221] 1.6.3 Transfection of in vitro transcribed RNA
[0222] RNA obtained through in vitro transcription was transfected using DMRI-C liposomes. Pre-cultured Marc-145 cells were digested with trypsin, and 2 ml of the cell suspension was transferred to 6-well cell culture plates and cultured at 37°C in a 5% CO2 incubator. When more than 80% of the cells formed a monolayer, transfection was performed according to the DMRI-C transfection reagent instructions: 12 μL of DMRI-C transfection reagent was added to 1 ml of opti-MEM medium, mixed well, and then the in vitro transcribed RNA was added and gently mixed. This mixture was then added to 6-well plates of Marc-145 cells that had been pre-washed with DMEM medium. The plates were incubated at 37°C in a 5% CO2 incubator for 6 hours. The transfection solution was discarded, and 2 ml of DMEM medium containing 2% fetal bovine serum was added. The plates were then incubated at 37°C in a 5% CO2 incubator. Cytopathic effects were observed daily. When approximately 80% of the cells showed cytopathic effects, the cell culture supernatant was collected and frozen at -80°C for later use. The results showed that cytopathic effects, such as obvious cell aggregation, could be observed in transfected cells as early as 48 hours after transfection. As time went on, the diseased cells exhibited typical cytopathic phenomena such as rounding and detachment. Figure 3 The control cells showed normal growth, and the rescued recombinant virus was named rHuN4-F112-SRBD1.
[0223] 1.6.4 Recombinant virus passage culture
[0224] After freezing and thawing the rescued virus stored at -80℃, centrifuge at 12000 rpm and 4℃ for 10 min. Take 200 μL of the supernatant and mix it with 500 μL of DMEM cell maintenance medium containing 2% fetal bovine serum. Inoculate this mixture into Marc-145 cells that have been pre-washed with PBS and incubate at 37℃ with 5% CO2 for 1-2 h. Discard the infection medium, wash the cells with PBS, and finally add DMEM cell maintenance medium containing 2% fetal bovine serum to continue culturing. Observe the cytopathic effect. When the cytopathic effect reaches more than 80%, collect the cell culture supernatant and store it at -80℃. Then, continue to passage the cells according to the above method.
[0225] 1.7 Identification of Recombinant Viruses
[0226] 1.7.1 RT-PCR identification of recombinant virus
[0227] 200 μL of fifth-generation recombinant virus culture medium was used to extract the whole-genome RNA of the virus according to the RNeasy Plus Mini Kit instructions, with the parental strain HuN4-F112 as a positive control. The recombinant virus rHuN4-F112-SRBD1 was passaged to the 5th generation, and RNA was extracted from it. Using the reverse-transcribed cDNA as a template, PCR amplification was performed using specific identification primers JD1 / JD2 to identify the inserted SRBD1 gene in the recombinant virus rHuN4-F112-SRBD1. Nucleic acid electrophoresis results showed that the target band amplified by the fifth-generation recombinant virus rHuN4-F112-SRBD1 was single, with a size of approximately 1800 bp. Figure 4 Simultaneously, the PCR amplified fragment was recovered and purified according to the gel recovery kit instructions, cloned into the pMD-18T vector, and the positive plasmid pMD-18T-SRBD1 was selected for gene sequencing identification. The results showed that the amplified specific gene was completely consistent with the original sequence of the inserted SRBD1 gene.
[0228] 1.7.2 IFA identification of recombinant viruses
[0229] Marc-145 cells were infected with the parental virus HuN4-F112 and the fifth-generation recombinant virus rHuN4-F112-SRBD1, respectively. After 24 hours of infection, the supernatant was discarded, and the cells were fixed with 80% cold ethanol. Anti-PRRSV N protein monoclonal antibody and anti-PEDV S protein monoclonal antibody were then added, and the cells were incubated at 37°C for 45 min. After washing three times with PBS, a 1:1000 dilution of goat anti-mouse FITC-labeled fluorescent secondary antibody was added, and the cells were incubated at 37°C in the dark for 45 min. After washing three times with PBS, the results were observed under an inverted fluorescence microscope. The results showed that the recombinant strain rHuN4-F112-SRBD1 was identical to the parental virus HuN4-F112 and both were specifically recognized by the PRRSV N protein monoclonal antibody, producing specific fluorescence. However, when using the anti-PEDV S protein monoclonal antibody, only the recombinant virus rHuN4-F112-SRBD1 showed specific bright green fluorescence, while the parental virus HuN4-F112 showed no fluorescence. Figure 5 This indicates that the inserted PEDV S protein dominant antigen gene SRBD1 was expressed. 1.7.3 Western blot identification of recombinant viral expressed proteins
[0230] Marc-145 cells were infected with the parental virus HuN4-F112 and the fifth-generation recombinant virus rHuN4-F112-SRBD1, respectively. After 48-72 hours of infection, when cytopathic effects were evident and reached 80%, the cells were washed three times with sterile PBS, and then lysed with RIPA cell lysis buffer containing protease inhibitors. Cell proteins were harvested. The cells were centrifuged at 12000 rpm at 4°C for 10 min, and the supernatant was collected, mixed with 5×SDS loading buffer, and boiled for 10 minutes. 10 μL of protein sample was subjected to SDS-PAGE electrophoresis and transferred to an NC membrane. The sample was then incubated for 45 min at room temperature with appropriately diluted anti-PRRSV N protein monoclonal antibody and anti-PEDV S protein monoclonal antibody, respectively. The sample was washed three times with TBST buffer for 5 min each time. Then, HRP-labeled anti-sheep rat IgG diluted 1:10000 was used as the secondary antibody, and the sample was incubated for 45 min at room temperature. After washing three times with TBST buffer, the sample was developed with ECL developing solution, and the development results were observed in a developer. The results showed that, using anti-PRRSV N protein monoclonal antibody, both the parental strain and the recombinant strain could detect PRRSV N protein expression of approximately 17 kDa. However, using anti-PEDV S protein monoclonal antibody, only the recombinant virus rHuN4-F112-SRBD1 could detect a specific target band of approximately 50 kDa. Figure 6 This indicates that the recombinant virus rHuN4-F112-SRBD1 obtained in this study does not affect the translation of PRRSV proteins, and that the SRBD1 protein can be correctly expressed and modified.
[0231] 1.7.4 Recombinant Virus TCID 50 Measurement
[0232] The recombinant strain rHuN4-F112-SRBD1 was subjected to 10 mmol / L DMEM containing 2% fetal bovine serum. -1 -10 -10 Serial dilutions were performed, and then different dilutions of the virus solution were inoculated into Marc-145 cells pre-prepared as monolayers in 96-well cell culture plates at 100 μL / well, with each dilution replicated in 8 wells. Two rows of uninoculated cells were included as negative controls. This procedure was repeated for two 96-well plates, and the plates were incubated in a 5% CO2, 37°C cell culture incubator for 4-5 days. Cytopathic effects were observed and recorded, and the viral TCID was calculated using the Reed-Muench method. 50 The results showed that its potency ranged from 6.29 × 10⁻⁶. 6 ~1.29×10 7 TCID 50 / ml.
[0233] 1.7.5 Observation of morphology of recombinant viral plaques
[0234] Marc-145 cells were pre-seeded in 6-well cell culture plates to form a cell monolayer, and then 0.01 MOI of the recombinant strain rHuN4-F112-SRBD1 was inoculated. The cells were incubated in a 5% CO2, 37°C cell culture incubator for 2 hours. The incubation solution was discarded, and the cells were washed twice with sterile PBS. Then, 1% low-melting-point agarose was added, and the cells were incubated at room temperature for 10 minutes. After the low-melting-point agarose gel had completely solidified, the cells were inverted and cultured in a 5% CO2, 37°C cell culture incubator for further incubation. Cytopathic effects were observed. After obvious cytopathic effects appeared, the cells were fixed with 4% paraformaldehyde at room temperature for 2 hours. The fixative and low-melting-point agarose gel were discarded, and the cells were stained with crystal violet solution for 5 minutes. The staining solution was discarded, and the cells were washed with deionized water. The morphology of the viral plaques was observed. The morphology and size of the plaques were similar to those of the parent strain HuN4-F112. Figure 7 ).
[0235] 1.7.6 Plotting the Multi-Step Growth Curve of Recombinant Viruses
[0236] Marc-145 cells were pre-seeded in 6-well plates and, after forming a monolayer, the recombinant virus strain rHuN4-F112-SRBD1 was inoculated into Marc-145 cells at a dose of 0.01 MOI. Cell culture supernatants were collected at 12h, 24h, 36h, 48h, 60h, and 72h post-infection. The viral titers of the supernatants collected at each time point were determined, and the TCID of the virus was calculated using the Reed-Muench method. 50Then, based on the virus's TCID at different time points 50 The proliferation curves were plotted. The results showed that the recombinant virus rHuN4-F112-SRBD1 reached its peak and plateau phase 48-60 hours post-infection, and its proliferation trend was similar to that of the parent virus strain HuN4-F112. Figure 8 ).
[0237] 1.8 Analysis of the genetic stability of recombinant viruses
[0238] The recombinant virus rHuN4-F112-SRBD1 strain was passaged continuously in Marc-145 cells according to the method described above. Plaque purification was performed every 5 passages, for at least 3 purification cycles, and the cells were then passaged continuously for 30 passages. The recombinant viruses from passages 10, 20, and 30 were selected for RT-PCR amplification and gene sequencing identification to analyze changes in the inserted SRBD1 gene. Simultaneously, IFA and Western blot analyses were performed on the recombinant viruses from different passages using monoclonal antibodies against PRRSV N and PEDV S proteins, respectively.
[0239] The results showed that the recombinant virus rHuN4-F112-SRBD1 from different generations (10th, 20th, and 30th generations) could amplify a target band of approximately 1800 bp. Gene sequence analysis showed that the SRBD1 gene in each generation of recombinant strains was consistent with the original sequence, with no deletions or mutations in the nucleotide sequence. Furthermore, IFA analysis using PRRSV N protein monoclonal antibody and PEDV S protein monoclonal antibody showed that, in addition to responding to the PRRSV N protein monoclonal antibody, each generation of recombinant virus also produced a bright green specific fluorescence against the PEDV S protein monoclonal antibody. Figure 9 Similarly, Western blot results showed that, in addition to the PRRSV N protein band, each generation of recombinant viruses could also detect the SRBD1 protein band, which is about 50 kDa in size. Even after 30 generations, the introduced SRBD1 gene could still stably express the protein, indicating that the obtained recombinant virus rHuN4-F112-SRBD1 has genetic stability.
[0240] 1.9 Immunogenicity Analysis of Recombinant Virus
[0241] Six healthy piglets around 4 weeks old, all negative for PRRSV and PEDV antigens and antibodies, were randomly divided into two groups of three. One group received an intramuscular injection of the rHuN4-F112-SRBD1 strain via the neck, with an immunization dose of 10... 5 TCID 50One group consisted of one pig, while the other group served as a negative control group, inoculated with 2 mL of DMEM. Clinical symptoms were observed daily after immunization, and serum samples were collected on days 0, 7, 14, 21, and 28 post-immunization. Pathological changes in organs were observed after necropsy 28 days post-immunization. Simultaneously, the levels of PRRSV and PEDV S protein antibodies in the collected pig serum were measured according to the instructions of the IDEXX HerdCheck*PRRS×3 ELISA kit and the porcine epidemic diarrhea virus ELISA antibody kit. Virus neutralization tests were performed on the collected pig serum using the PEDV epidemic variant strain FJzz1 according to the method reported in the literature (Lu Y et al., 2020).
[0242] The results showed that after the experimental pigs were inoculated with the recombinant virus rHuN4-F112-SRBD1 strain, both PRRSV and PEDV antibodies turned positive 14 days post-immunization, and the antibody levels subsequently increased and remained positive. Figure 10 Neutralization tests were conducted on serum from immunized pigs. The results showed that serum from pigs immunized for 28 days had an inhibitory effect on PEDV FJzz1 strain, and its antibody neutralization titer could reach 1:8-1:16. This indicates that the recombinant virus rHuN4-F112-SRBD1 can induce the body to produce specific neutralizing antibodies against PEDVS protein in experimental pigs.
[0243] The foregoing description provides some exemplary embodiments for illustrative purposes. While specific embodiments have been given in the preceding discussion, those skilled in the art will recognize that changes in form and detail may be made without departing from the broader spirit and scope of the invention. Therefore, the specification and drawings should be considered illustrative rather than restrictive. Consequently, this detailed description should not be construed as restrictive, and the scope of the invention is defined only by the included claims and the full scope of their equivalents.
Claims
1. A fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor, wherein the dominant antigenic region of the S protein RBD functional domain is determined by analyzing the amino acid sequence of the S gene of the prevalent PEDV variant strain FJzz1 (accession number MK288006) published in Gene Bank using DNASTAR software. The C-terminal domain of the S1 subunit of the S gene was selected, with nucleotide positions 1495-2377 nt and encoding amino acid positions aa 496-792. This region is mainly distributed on the surface of the S protein extracellular domain trimer and contains the potential RBD domain of PEDV, with an antigenicity index of up to 3.
4. The signal peptide sequence of the S gene is introduced at its anterior end. The target gene encoding the fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor is named RBD1, as shown in SEQ ID NO.
1.
2. The fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor as described in claim 1, wherein the N-terminus or C-terminus of the antigenic epitope peptide is further coupled with a polypeptide label; the polypeptide label is a biotinylate label or a fluorescent label.
3. The application of the fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor as described in claim 1 in the preparation of a bivalent genetically engineered live vaccine against PRRS and PED.
4. A recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain expressing the fusion antigenic epitope peptide against the S protein receptor RBD domain of PEDV as described in claim 1, characterized in that, The dominant antigenic region of the PEDV S protein is the fusion antigen epitope peptide as described in claim 1, and the full-length nucleotide sequence of the recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain is shown in SEQ ID NO.
12.
5. The use of the fusion antigenic epitope peptide of the S protein receptor RBD domain of PEDV as described in claim 1 in the preparation of a medicament for the prevention of PED.
6. The use of the recombinant PRRSV pHuN4-F112-SRBD1 vaccine strain of claim 4 in the preparation of a medicament for the prevention of PRRS and PED.
7. The application of the fusion antigenic epitope peptide targeting the RBD domain of the PEDV S protein receptor as described in claim 1 as a screening target for drugs against PED infection.
8. A pharmaceutical composition for the prevention of PED infection, comprising the fusion antigenic epitope peptide of the S protein receptor RBD domain of PEDV as claimed in claim 1 and pharmaceutically acceptable excipients.
9. The pharmaceutical composition of claim 8, wherein the pharmaceutical composition is a nasal dosage form; the dosage form is selected from any one of sprays, nasal drops, powders, gels, or microspheres.
10. A diagnostic reagent for PED infection, comprising the S protein fusion antigenic epitope peptide of claim 1, wherein the fusion antigenic epitope peptide of claim 1 targeting the RBD domain of the PEDV S protein receptor is coated on a detection carrier, wherein the detection carrier is selected from any one of polystyrene microplates, colloidal gold strips, magnetic beads, and microfluidic chips.