Use of nucleic acid molecules for the preparation of a medicament for the treatment of liver diseases
By inhibiting hepatocyte apoptosis through miR-302s nucleic acid molecules targeting Bcl2l11, the treatment challenges of liver diseases, especially acute liver failure, have been solved, resulting in improved liver function and increased survival rates.
Patent Information
- Application Number
- CN202310654911.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-06-05
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2043-06-05
AI Technical Summary
The role of the miR-302 family in hepatocytes is unclear in the current technology, and there is no research on its related functions in liver diseases, especially the lack of effective means for its application in the treatment of acute liver failure.
Using miR-302s and related nucleic acid molecules, by targeting the pro-apoptotic gene Bcl2l11, the apoptosis signaling pathway in hepatocytes is inhibited, and various drug dosage forms such as tablets, capsules, granules, suspensions, oral liquids and injections are prepared for the treatment of liver diseases.
miR-302s can block the mitochondrial apoptosis signaling pathway in hepatocytes, inhibit early hepatocyte apoptosis in acute liver failure, reduce local inflammatory response, improve liver function, and increase survival rate, providing a new approach to the treatment of liver diseases.
Smart Images

Figure CN116617244B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biology and medicine, and in particular to the use of a nucleic acid molecule in the preparation of a medicament for treating liver diseases. BACKGROUND
[0002] MicroRNA (miRNA) is a kind of endogenous, single-stranded small molecule RNA with a length of about 20-24 bases, which is generated by Dicer enzyme processing from a single-stranded RNA precursor (pre-miRNA) with a hairpin structure of about 70-90 bases. The seed sequence of miRNA, defined as the 2nd-8th nucleotide at the 5' end of miRNA, is the most evolutionarily conserved fragment on miRNA. miRNA pairs completely or incompletely with the 3' end non-coding region of the target gene mRNA through the seed sequence, causing the degradation or inhibition of protein translation of the target gene mRNA, thereby participating in the regulation of genes. Each miRNA can regulate the expression of multiple target genes, and multiple miRNAs can also regulate the expression of the same gene. It is estimated that miRNA regulates one-third of human genes, and has multiple important functions in cells. Studies have found that miRNA plays an important role in regulating biological processes such as body development, cell proliferation, differentiation and death, and is involved in the occurrence and development of various diseases such as tumors, cardiovascular diseases, neural diseases, and immune diseases. It has been reported that miRNA can be used as a diagnostic marker for some diseases, for example, miR-122 is highly expressed in the serum of patients with acute liver failure, and even appears abnormal elevation before the conventional liver function indicators ALT and AST. It can be used as an early diagnostic molecule. In recent years, some studies have begun to use miRNA as a new means of disease treatment.
[0003] In view of this, the present application is proposed. SUMMARY
[0004] The main purposes of the present application include using miR-302s and related nucleic acid molecules to prepare a medicament for treating liver diseases, and providing a new idea for the treatment of clinical liver diseases.
[0005] In the first aspect of the present application, the use of a nucleic acid molecule in the preparation of a medicament for treating liver diseases is provided;
[0006] The nucleic acid molecule has one or more of the conditions shown in (a) to (e):
[0007] (a) the nucleic acid molecule comprises any one or more of the miR-302s members;
[0008] (b) the nucleic acid molecule comprises a mimic or a derivative of any one or more of the miR-302s members, the mimic or the derivative having a core fragment as set forth in SEQ ID No. 1 and having the same or similar function as any one or more of the miR-302s members;
[0009] (c) the nucleic acid molecule comprises an miRNA precursor, the miRNA precursor being capable of being processed into any one or more of the miR-302s members, the mimic or the derivative in a host;
[0010] (d) the nucleic acid molecule comprises a polynucleotide fragment, the polynucleotide fragment being capable of being transcribed into the miRNA precursor in a host;
[0011] (e) the nucleic acid molecule comprises an expression vector, the expression vector containing the polynucleotide fragment.
[0012] In some embodiments of the present application, the nucleic acid molecule is selected from one or more of miR-302a-3p, miR-302b-3p, miR-302c-3p and miR-302d-3p.
[0013] In some embodiments of the present application, the liver disease is acute liver failure.
[0014] In some embodiments of the present application, the medicament comprises the nucleic acid molecule and a pharmaceutically acceptable excipient.
[0015] In some embodiments of the present application, the medicament is in the form of a tablet.
[0016] In some embodiments of the present application, the medicament is in the form of a capsule.
[0017] In some embodiments of the present application, the medicament is in the form of a granule.
[0018] In some embodiments of the present application, the medicament is in the form of a suspension.
[0019] In some embodiments of the present application, the medicament is in the form of an oral solution.
[0020] In some embodiments of the present application, the medicament is in the form of an injection.
[0021] In a second aspect of the present application, there is provided a method for protecting liver cells in vitro, the method comprising the step of culturing liver cells in a culture medium supplemented with the nucleic acid molecule as defined in the first aspect.
[0022] In some embodiments of the present application, the liver cells are D-galactosamine (D-gal)-induced damaged liver cells.
[0023] In some embodiments of the present application, the liver cells are mouse primary hepatocytes (mPH).
[0024] In some embodiments of the present application, the concentration of the nucleic acid molecule is 10 nM-100 nM.
[0025] Compared with the conventional technology, the present application has the following beneficial effects:
[0026] The present application finds that miR-302s can block the activation of the mitochondrial apoptosis signaling pathway of liver cells, inhibit the apoptosis of liver cells in the early stage of acute liver failure, reduce the local inflammatory response, thereby avoiding the massive death of liver cells, ultimately improving the liver function of liver failure mice, reducing the damage of liver tissue, and improving the survival rate. Based on this, the present application uses miR-302s and related nucleic acid molecules to prepare a drug for treating liver diseases, and provides a new idea for the treatment of liver diseases in clinical practice. BRIEF DESCRIPTION OF DRAWINGS
[0027] In order to more clearly illustrate the technical solutions in the embodiments of the present application, more completely understand the present application and its beneficial effects, the drawings needed in the embodiment description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of these drawings.
[0028] Figure 1 The cell viability detection result of the mimics of the miR-302s of the embodiments of the present application in vitro has a protective effect on liver cell damage;
[0029] Figure 2 The luciferase reporter gene experiment result of the miR-302b-3p targeting Bcl2l11 of the embodiments of the present application;
[0030] Figure 3 The Western blot detection and cell viability detection result of the in vitro verification experiment of the miR-302b-3p playing a liver cell protection role by targeting Bcl2l11 of the embodiments of the present application;
[0031] Figure 4 The staining schematic diagram of the mitochondrial membrane potential (MMP), reactive oxygen species (ROS) and apoptosis protein Caspase-3 cleavage body cl-Caspase3 (cl-Casp3) of the mPH in different treatment groups in the in vitro verification experiment of the miR-302b-3p playing a liver cell protection role by targeting Bcl2l11 of the embodiments of the present application;
[0032] Figure 5 Survival curves of the control group and the miR-302b-3p treatment group in an in vivo experiment of miR-302b-3p protecting mice with acute liver failure according to an embodiment of the present invention;
[0033] Figure 6 The serum ALT and AST levels in the control group and the miR-302b-3p treatment group were measured in an in vivo experiment of miR-302b-3p protecting mice with acute liver failure according to an embodiment of the present invention.
[0034] Figure 7 These are histopathological images of the control group and the miR-302b-3p treatment group in the mouse experiment of miR-302b-3p treating acute liver failure according to an embodiment of the present invention.
[0035] Figure 8 The results of Western blot analysis of liver tissue proteins in the modeling control group and the miR-302b-3p treatment group in the mouse experiment of miR-302b-3p treatment for acute liver failure in this embodiment of the invention are shown. Detailed Implementation
[0036] The present invention will be further described in detail below with reference to the accompanying drawings, embodiments, and examples. It should be understood that these embodiments and examples are for illustrative purposes only and are not intended to limit the scope of the invention. The purpose of providing these embodiments and examples is to enable a more thorough and complete understanding of the disclosure of the present invention. It should also be understood that the present invention can be implemented in many different forms and is not limited to the embodiments and examples described herein. Those skilled in the art can make various modifications or alterations without departing from the spirit of the present invention, and the equivalent forms obtained also fall within the protection scope of this application. Furthermore, numerous specific details are set forth in the following description to provide a fuller understanding of the present invention. It should be understood that the present invention can be implemented without one or more of these details.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used herein in the description of the invention is for descriptive purposes only and is not intended to be limiting of the invention.
[0038] Terminology
[0039] Unless otherwise stated or in case of contradiction, the terms or phrases used herein shall have the following meanings:
[0040] The terms "and / or," "or / and," and "and / or" as used herein include any one of two or more of the related listed items, as well as any and all combinations of the related listed items. These arbitrary and all combinations include any two related listed items, any more related listed items, or a combination of all related listed items. It should be noted that when at least three items are connected by at least two conjunctions selected from "and / or," "or / and," and "and / or," it should be understood that in this application, the technical solution undoubtedly includes technical solutions connected by "logical AND," and also undoubtedly includes technical solutions connected by "logical OR." For example, "A and / or B" includes three parallel solutions: A, B, and A+B. For example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, a technical solution that is connected by "logical OR"), as well as any and all combinations of A, B, C, and D, that is, combinations of any two or three of A, B, C, and D, and also combinations of all four of A, B, C, and D (that is, a technical solution that is connected by "logical AND").
[0041] In this invention, terms such as "multiple", "various", "multiple times", and "multi-source" are used, and unless otherwise specified, they refer to a quantity greater than or equal to 2. For example, "one or more" means one or more types.
[0042] The terms “combinations of,” “any combination of,” and “any combination of” used in this article include all suitable combinations of any two or more of the listed items.
[0043] In this document, the term "suitable" as used in phrases such as "suitable combination," "suitable method," and "any suitable method" refers to the ability to implement the technical solution of this invention, solve the technical problem of this invention, and achieve the expected technical effect of this invention.
[0044] In this article, terms such as "preferred," "better," "more suitable," and "ideal" are merely used to describe implementation methods or examples that achieve better results, and should be understood not to limit the scope of protection of this invention.
[0045] In this invention, terms such as "further," "even more," and "particularly" are used for descriptive purposes and to indicate differences in content, but should not be construed as limiting the scope of protection of this invention.
[0046] In this invention, "optionally," "optionally," and "optional" mean that they are optional, that is, they are selected from either "with" or "without." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "option" is independent.
[0047] In this invention, the terms "first aspect," "second aspect," "third aspect," "fourth aspect," etc., are used for descriptive purposes only and should not be construed as indicating or implying relative importance or quantity, nor should they be construed as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first," "second," "third," "fourth," etc., serve only as a non-exhaustive enumeration and should be understood not to constitute a closed limitation on the quantity.
[0048] In this invention, the technical features described in an open-ended manner include both closed-ended technical solutions composed of the listed features and open-ended technical solutions that include the listed features.
[0049] In this invention, numerical intervals (i.e., numerical ranges) are involved. Unless otherwise specified, the selected numerical distributions within the aforementioned numerical intervals are considered continuous and include the two endpoints (i.e., the minimum and maximum values) of the numerical range, as well as every value between these two endpoints. Unless otherwise specified, when a numerical interval refers only to integers within that interval, it includes the two endpoint integers of the numerical range, as well as every integer between the two endpoints. In this document, this is equivalent to directly listing every integer. For example, if t is an integer selected from 1 to 10, it means that t is any integer selected from the group of integers consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. Furthermore, when multiple ranges are provided to describe features or characteristics, these ranges can be merged. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all subranges to which they are included.
[0050] Unless otherwise specified, the temperature parameters in this invention can be either constant temperature treatment or variations within a certain temperature range. It should be understood that the constant temperature treatment allows temperature fluctuations within the precision range controlled by the instrument. Fluctuations are permitted within ranges such as ±5℃, ±4℃, ±3℃, ±2℃, and ±1℃.
[0051] In this invention, % (w / w) and wt% both represent weight percentage, % (v / v) refers to volume percentage, and % (w / v) refers to mass-volume percentage.
[0052] All references to this invention are incorporated herein by reference as if each document were individually incorporated by reference. Unless they conflict with the inventive purpose and / or technical solution of this application, the referenced documents involved in this invention are incorporated in their entirety and for all purposes. When references are made in this invention, the definitions of relevant technical features, terms, nouns, phrases, etc., are also incorporated herein by reference. When references are made in this invention, examples and preferred embodiments of the relevant technical features cited may also be incorporated herein by reference, but only to the extent that they enable the implementation of this invention. It should be understood that when the cited content conflicts with the description in this application, this application shall prevail or modifications shall be made adaptively based on the description in this application.
[0053] The miR-302 family, including miR-302a-3p, miR-302b-3p, miR-302c-3p, miR-302d-3p, and miR-367-3p, are miRNAs highly expressed in embryonic stem cells. Four members—miR-302a-3p, miR-302b-3p, miR-302c-3p, and miR-302d-3p—share the same seed sequence and are generally referred to as miR-302s, suggesting they have similar or identical functions. The miR-302 family possesses multiple functions, including regulating reprogramming, inhibiting tumor development, proliferation, invasion, and metastasis, maintaining stem cell self-renewal and pluripotency, promoting regeneration and repair, suppressing inflammation, and regulating anti-infective immune responses. The miR-302 family plays different roles depending on the cell type. For example, miR-302b / c can promote the proliferation and regeneration of alveolar epithelial cells from local epithelial progenitor cells, thereby improving lung function, accelerating host recovery, and increasing survival rate, and has a therapeutic effect on mice infected with Streptococcus pneumoniae. In mesenchymal stem cells, miR-302s promote the proliferation of human adipose tissue-derived mesenchymal stem cells by inhibiting the expression of cyclin-dependent kinase inhibitor 1A (CDKN1A / p21) and the inflammatory chemokine CCL5, and protect cells from oxidative-induced apoptosis. The miR-302 family inhibits the Hippo pathway by inhibiting kinases Mst1, Lats2, and Mob1b, inducing cardiomyocyte proliferation and thus promoting the regeneration and repair of damaged myocardium. However, the role of miR-302s in hepatocytes is unclear, and there are no reports on its related functions in liver diseases. This invention provides an application of miR-302s and related nucleic acid molecules in inhibiting hepatocyte apoptosis signaling pathways and treating acute liver failure, offering a new approach to the clinical treatment of liver diseases.
[0054] First aspect of the present application
[0055] This application relates to the use of a nucleic acid molecule in the preparation of a drug for treating liver diseases;
[0056] The nucleic acid molecule has one or more of the conditions shown in (a) to (e):
[0057] (a) The nucleic acid molecule contains any one or more members of the miR-302s;
[0058] (b) The nucleic acid molecule comprises a mimic or derivative of any one or more of the miR-302s members, the mimic or derivative having the core fragment shown in SEQ ID No. 1 and having the same or similar function as any one or more of the miR-302s members;
[0059] (c) The nucleic acid molecule contains a miRNA precursor, which can be processed in the host into any one or more members of the miR-302s members, mimics or derivatives thereof;
[0060] (d) The nucleic acid molecule contains a polynucleotide fragment that can be transcribed within the host to form the miRNA precursor;
[0061] (e) The nucleic acid molecule comprises an expression vector containing the polynucleotide fragment.
[0062] SEQ ID No. 1: 5'-AAGUGCU-3'.
[0063] In one example, the nucleic acid molecule is selected from one or more of miR-302a-3p, miR-302b-3p, miR-302c-3p, and miR-302d-3p.
[0064] In this application, "drug" includes any agent, compound, composition, or mixture that provides physiological and / or pharmacological effects in vivo or in vitro, and often provides beneficial effects. The scope of the physiological and / or pharmacological effects produced by a "drug" in vivo is not particularly limited; it may have systemic effects or only local effects. The activity of the "drug" is not particularly limited; it may be an active substance that can interact with other substances or an inert substance that does not interact with other substances.
[0065] In one example, the drug may be a liquid formulation or a solid formulation. Liquid formulations refer to formulations containing a liquid phase, and non-limiting examples include solutions, suspensions, emulsions, etc. Non-limiting examples of solid formulations include tablets, capsules, granules, pills, etc.
[0066] In one example, depending on the method of administration, it could be an oral preparation, injection, drops, patch, tube feeding preparation, etc.
[0067] In one example, the excipients chosen may differ depending on the dosage form.
[0068] In this application, "excipients" include, but are not limited to, mannitol, sorbitol, sodium metabisulfite, sodium bisulfite, sodium thiosulfate, cysteine hydrochloride, thioglycolic acid, methionine, vitamin C, disodium EDTA, sodium calcium EDTA, carbonates, acetates, phosphates or aqueous solutions of monovalent alkali metals, hydrochloric acid, acetic acid, sulfuric acid, phosphoric acid, amino acids, sodium chloride, potassium chloride, sodium lactate, xylitol, maltose, glucose, fructose, dextran, glycine, starch, sucrose, lactose, mannitol, silicon derivatives, cellulose and its derivatives, alginate, gelatin, polyvinylpyrrolidone, glycerol, Tween 80, agar, calcium carbonate, calcium bicarbonate, surfactants, polyethylene glycol, cyclodextrin, phospholipids, kaolin, talc, calcium stearate, and magnesium stearate.
[0069] In this application, "pharmaceutically acceptable" means those ligands, materials, compositions, and / or dosage forms that are suitable for administration to patients within the bounds of reasonable medical judgment and that are commensurate with a reasonable benefit / risk ratio.
[0070] In this application, "pharmaceuticalally acceptable excipient" means a pharmaceutically acceptable material, composition, or carrier, such as a liquid or solid filler, diluent, excipient, solvent, or encapsulating material. As used herein, the term "pharmaceuticalally acceptable carrier" includes buffers compatible with drug administration, sterile water for injection, solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic agents and absorption delay agents, and the like. Each substance must be "pharmaceuticalally acceptable" in the sense of compatibility with other components in the formulation and harmlessness to the patient. Suitable examples include, but are not limited to: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch, potato starch and substituted or unsubstituted β-cyclodextrins; (3) cellulose and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth gum; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn... Rice oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerol, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffers, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethanol; (20) phosphate buffer; and (21) other non-toxic compatible substances used in pharmaceutical formulations.
[0071] In one example, the drug contains an effective amount of the nucleic acid molecule.
[0072] In this application, "effective amount" refers to the dose by which the component corresponding to the term achieves treatment, prevention, reduction and / or relief of a specific disease, condition and / or symptom in a subject. In this invention, unless otherwise specified, it refers to the dose by which liver disease, condition and / or symptom are treated, prevented, reduced and / or relieved.
[0073] In this application, "subject" refers to an animal, preferably a mammal, and more preferably a human. Subjects include, but are not limited to, consumers of health products and patients with diseases, conditions, and / or symptoms. The subject in this invention is preferably a mammal. The term "mammal" primarily refers to warm-blooded vertebrate mammals, including but not limited to: cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, mice (such as rats and mice), pigs, cattle, sheep, horses, and humans, preferably primates, and more preferably humans.
[0074] In one of the examples, the subjects were mammals.
[0075] In one example, the subjects were either humans or mice.
[0076] In this application, "patient" refers to an animal, preferably a mammal, and more preferably a human. The term "mammal" mainly refers to warm-blooded vertebrate mammals, including but not limited to: such as cats, dogs, rabbits, bears, foxes, wolves, monkeys, deer, rats, pigs, cattle, sheep, horses, and humans, preferably primates, and more preferably humans.
[0077] Second aspect of the present application
[0078] This application discloses a method for in vitro protection of hepatocytes, the method comprising culturing hepatocytes in a culture medium supplemented with nucleic acid molecules as defined in the first aspect.
[0079] In one example, the hepatocytes are D-gal-induced damaged hepatocytes.
[0080] In one example, the hepatocytes are mPH. In one example, the concentration of the nucleic acid molecules is 10nM-100nM, for example, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100nM.
[0081] The embodiments of the present invention will be described in detail below with reference to examples. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. For experimental methods in the following embodiments where specific conditions are not specified, please refer to the guidelines given in this invention, or follow experimental manuals or conventional conditions in the art, or follow the conditions recommended by the manufacturer, or refer to experimental methods known in the art.
[0082] In the specific embodiments described below, the measurement parameters involving raw material components may have slight deviations within the weighing accuracy range unless otherwise specified. Temperature and time parameters are subject to acceptable deviations due to instrument testing accuracy or operational precision.
[0083] I. In vitro functional identification of miR-302s
[0084] 1. miR-302s simulant
[0085] We purchased miR-302mimic, a miR-302s analog for cells, and its control mimic NC from Guangzhou Ruibo Biotechnology Co., Ltd.
[0086] mimic NC(SEQ ID No.2):UUUGUACUACACAAAAGUACUG
[0087] miR-302a-3p (SEQ ID No.3): UAAGUGCUUCCAUGUUUUGGUGA
[0088] miR-302b-3p (SEQ ID No.4): UAAGUGCUUCCAUGUUUUAGUAG
[0089] miR-302c-3p (SEQ ID No.5): UAAGUGCUUCCAUGUUUCAGUGG
[0090] miR-302d-3p (SEQ ID No. 6): UAAGUGCUUCCAUGUUUGAGUGU
[0091] 2. miR-302s have a protective effect on hepatocytes in vitro.
[0092] mPH obtained by in situ perfusion was cultured in William's Medium E medium containing 10% (v / v) fetal bovine serum, 1% (v / v) penicillin and streptomycin, and 1 wt% glutamine. D-gal stimulation of mPH was used to construct an in vitro cell model simulating in vivo liver injury. For nucleic acid transfection, the medium was not supplemented with penicillin and streptomycin; instead, 50 nM of the miR-302s mimic or 100 nM of its control mimic NC were added. After 24 hours of culture, cell viability was assessed using a lactate dehydrogenase cytotoxicity assay kit to determine the in vitro effectiveness of the miRNA mimics. The results were expressed by the following formula: Cell viability (%) = (Absorbance of treated sample - Absorbance of control well) / (Absorbance of enzyme activity in untreated cells - Absorbance of control well) × 100.
[0093] The results showed that all four miR-302s had a protective effect against mPH and could improve mPH cell viability, with miR-302a / b / d-3p showing particularly significant effects. Figure 1 As shown.
[0094] II. miR-302s targets Bcl2l11 to regulate the hepatocyte apoptosis signaling pathway
[0095] 1. Identification of miR-302s target genes
[0096] Since the seed sequences of miR-302s are completely identical, the targeting relationship between miR-302s and Bcl2l11 was predicted using the ENCORI, Targetscan, and miRDB websites. The prediction results of the three websites all indicated that Bcl2l11 is a target gene of miR-302s in mice. We selected one member, miR-302b-3p, for dual-luciferase reporter gene experiments. Two single-target mutations (MUT1 and MUT2) and one double-target mutation (MUT1+2) were constructed targeting the two sites where miR-302b-3p binds to Bcl2l11, respectively. Using the wild-type plasmid (WT) as a control, miR-302b-3p mimic was co-transfected with the above plasmids into 293T cells. After culturing for 48 hours, the luciferase luminescence value was detected.
[0097] The results are attached. Figure 2 As shown, miR-302b-3p significantly inhibited the luciferase activity of the wild-type plasmid. The inhibitory effect on the luciferase activity of the two single mutant vectors was comparable and slightly lower than that of the wild-type plasmid, but it did not affect the luciferase activity of the double mutant plasmid. The results indicate that Bcl2l11 is a target gene of miR-302b-3p.
[0098] 2. miR-302b-3p mainly regulates the hepatocyte apoptosis signaling pathway by targeting Bcl2l11.
[0099] We used small interfering RNA (siRNA, denoted as siR-Bcl2l11 or siB in the figure) and overexpression plasmid (pcDNA3.1 vector with Bcl2l11 coding sequence inserted for target gene overexpression, denoted as pcD-Bcl2l11 or pcB in the figure) to knock down and overexpress the target gene Bcl2l11, respectively. Using a D-gal-induced hepatocyte injury in vitro model, we examined cell viability under different treatments (single treatment groups: EVs-HPC, miR-302b-3p, siR-Bcl2l11, pcD-Bcl2l11; combination groups: miR+siB, miR+pcB). The results are shown in the attached figure. Figure 3 As shown.
[0100] Among them, EVs-HPC are exosomes secreted by hepatic progenitor cells induced by embryonic stem cells.
[0101] Cells in the above-treated groups were analyzed using cl-Caspase3 antibody, mitochondrial membrane potential (MMP) assay kit, and reactive oxygen species (ROS) assay kit. The results are as follows: Figure 4 As shown.
[0102] Combination Figure 3 and Figure 4 The results showed that after D-gal-induced injury, the expression of Bcl2l11 protein (BIM) in mPH significantly increased, leading to a decrease in MMPs and a large amount of ROS production in hepatocytes. The apoptosis effector protein Caspase-3 was cleaved and activated, resulting in hepatocyte apoptosis and eventual death. miR-302b-3p significantly inhibited BIM expression, maintained hepatocyte MMPs, reduced ROS production, and inhibited Caspase-3 cleavage activation, thereby suppressing hepatocyte death. The protective effect of miR-302b-3p on hepatocytes was similar to that of Bcl2l11 knockdown using siRNA. The combined use of miR-302b-3p and siR-Bcl2l11 did not have an additive effect, while overexpression of Bcl2l11 using pcD-Bcl2l11 significantly weakened the protective effect of miR-302b-3p on hepatocytes. The above results indicate that miR-302b-3p mainly exerts its protective effect on hepatocytes by inhibiting the apoptosis signaling pathway in the mitochondrial pathway of hepatocytes by targeting the protein expression level of Bcl2l11.
[0103] III. Modeling and Treatment of Acute Liver Failure in Mice
[0104] 1. Experimental animals: SPF-grade male Kunming mice, weighing 18 - 22 g, were purchased from Hunan Slack Jingda Experimental Animal Co., Ltd. (Production License: SYXK(Xiang)2020 - 0006). They were fed with ordinary mouse feed and freely given filtered tap water. The room temperature was 22°C ± 1°C, the humidity was 65% ± 5%, and the light / dark cycle was 12 h. The animal experiment protocol was reviewed and approved by the Animal Ethics Committee of Central South University. The experiment was strictly carried out in accordance with the National Standard of the People's Republic of China for the Ethical Review Guidelines of Laboratory Animal Welfare (GB / T35892 - 2018).
[0105] 2. miR-302b-3p mimic: The miR-302b-3p agomir, a mimic of miR-302s for animals, was purchased from Guangzhou Ribobio Co., Ltd., and normal saline was used as the control for miR-302b-3p agomir. miRNA agomir is a miRNA agonist with special chemical modifications, and the sequence of miR-302b-3p agomir is the same as that of miR-302b-3p mimic.
[0106] 3. Modeling and treatment: A mouse model of acute liver failure was constructed by intraperitoneal injection of D-gal and lipopolysaccharide (LPS), and 10 nmol of miR-302b-3p agomir was injected via the tail vein for treatment. The survival of mice was observed for 72 hours, and a survival curve was plotted. The results are as shown Figure 5 as follows. The results showed that compared with the untreated control group, miR-302b-3p agomir had a certain protective effect on mice with acute liver failure, significantly improving the survival rate of liver failure mice and significantly slowing down the death rate of liver failure mice.
[0107] 4. Analysis of treatment
[0108] (1) Observation of serum ALT / AST levels and tissue structure
[0109] The serum ALT and AST levels were measured using a standard clinical automatic analyzer in the Clinical Laboratory of Guangxiu Hospital, Hunan. The results are as Figure 6 shown. Compared with the control group, the serum ALT and AST levels in the miR-302b-3p agomir treatment group were significantly decreased, and the liver function was significantly improved.
[0110] (2) Histopathological analysis
[0111] After collecting the liver, the fresh liver tissue was fixed in 4% paraformaldehyde for paraffin embedding. Then the embedded tissue was cut into 5-μm sections and stained with hematoxylin-eosin (H&E). The results are as Figure 7As shown, the liver tissue of the control group showed extensive diffuse hemorrhage and large-scale necrosis, with severe damage to the liver lobe structure. The liver damage in the miR-302b-3p agomir treatment group was significantly reduced, and the liver lobe structure was more intact, suggesting that miR-302b-3p has therapeutic efficacy for liver damage.
[0112] (3) Detection of hepatocyte apoptosis using Western blotting technique
[0113] After liver collection, a suitable amount of fresh liver tissue was taken to extract protein. The protein concentration was then detected using a BCA protein assay kit, and Western blotting was performed. The results are shown in the attached figure. Figure 8 As shown, miR-302b-3p can reduce the cleavage activation of apoptosis signaling pathway-related proteins Caspase-9 / -3 and PARP in liver tissue, and inhibit the expression of pro-apoptotic proteins BIM and BAX.
[0114] IV. Summary
[0115] The miR-302 family is considered to be a type of miRNA specifically expressed in embryonic stem cells, typically playing a crucial role in early development, with expression levels rapidly decreasing after differentiation. While the miR-302 family has been reported to play roles in other somatic cells, it is almost not expressed in hepatocytes, and no studies have been conducted on its related roles in hepatocytes or liver diseases. This application, however, experimentally demonstrates that miR-302s inhibit hepatocyte apoptosis by targeting the pro-apoptotic gene Bcl2l11, thereby exerting a protective effect against acute liver failure in mice, providing a new approach for the clinical treatment of liver failure or other liver-related diseases.
[0116] The technical features of the above-described embodiments and examples can be combined in any suitable manner. For the sake of brevity, not all possible combinations of the technical features in the above-described embodiments and examples are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.
[0117] The above-described embodiments are merely illustrative of several implementation methods of the present invention, facilitating a detailed and specific understanding of the technical solutions of the present invention. However, they should not be construed as limiting the scope of protection of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Furthermore, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various alterations or modifications to the present invention, and the equivalent forms obtained also fall within the scope of protection of this application. It should also be understood that technical solutions obtained by those skilled in the art based on the technical solutions provided by the present invention through logical analysis, reasoning, or limited experimentation are all within the scope of protection of the appended claims. Therefore, the scope of protection of this invention patent should be determined by the content of the appended claims, and the specification and drawings can be used to interpret the content of the claims.
Claims
1. Application of nucleic acid molecules in the preparation of drugs for treating liver diseases; The nucleic acid molecule is one or more of miR-302a-3p, miR-302b-3p, miR-302c-3p, and miR-302d-3p; The liver disease described is acute liver failure.
2. The application according to claim 1, characterized in that, The drug comprises the nucleic acid molecule and pharmaceutically acceptable excipients.
3. The application according to claim 2, characterized in that, The dosage form of the drug is tablets, capsules, or granules.
4. The application according to claim 2, characterized in that, The drug is available in the form of a suspension, oral solution, or injection.
5. A method for in vitro protection of hepatocytes, characterized in that, The method includes the step of culturing hepatocytes in a culture medium containing nucleic acid molecules as described in any one of claims 1 to 4.
6. The method for in vitro protection of hepatocytes according to claim 5, characterized in that, The hepatocytes in question are hepatocytes that have suffered damage induced by D-galactosamine.
7. The method for in vitro protection of hepatocytes according to claim 5, characterized in that, The hepatocytes were primary mouse hepatocytes.
8. The method for in vitro protection of hepatocytes according to any one of claims 5 to 7, characterized in that, The concentration of the nucleic acid molecules is 10nM-100nM.
Citation Information
Patent Citations
Antiviral effect of microrna against hepatitis b virus
WO2018193902A1