A SNP molecular marker related to abnormal pig sex development of NOBOX gene, primer and application

By developing SNP molecular markers and primers related to the NOBOX gene, breeding pigs carrying pathogenic genes were screened, filling the gap in the detection of abnormal sex development in pigs. This enabled early, low-cost, and highly accurate breeding screening, reducing economic losses and the risk of disease transmission.

CN116694755BActive Publication Date: 2026-05-05FOSHAN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202310761195.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-06-25
Publication Date
2026-05-05
Estimated Expiration
2043-06-25

AI Technical Summary

Technical Problem

The lack of effective SNP molecular markers in the current technology for detecting abnormal sex development in pigs (38,XX-DSD) has led to the spread of the disease in pig herds and serious economic losses. Moreover, existing SNP markers have only been used in humans and goats and have not been effectively utilized in pigs.

Method used

We developed SNP molecular markers and primers related to the NOBOX gene. By detecting allelic mutations at the 231st base (Ala to Gly), we screened breeding pigs carrying the pathogenic gene, eliminated the CC and CG genotypes, and selected the GG genotype for breeding. We combined this with 10×Genomics sequencing technology to achieve high coverage and accuracy detection.

Benefits of technology

This technology enables early, low-cost, and highly accurate screening of breeding pigs carrying pathogenic genes, preventing the spread of abnormal sex development in pigs, optimizing breeding stock selection, and reducing economic losses.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116694755B_ABST
    Figure CN116694755B_ABST
Patent Text Reader

Abstract

This invention relates to the field of pig selective breeding technology, and particularly to a SNP molecular marker, primers, and applications related to the NOBOX gene and intersex pigs. The nucleotide sequence of this SNP molecular marker is SEQ ID NO:1, and the 231st base S in the nucleotide sequence of the SNP molecular marker is a polymorphic site; at this polymorphic site, individuals with genotypes CC and CG exhibit abnormal sex development, while individuals with genotype GG exhibit normal sex development. The primers of this invention include F1 and a downstream primer R1. The SNP molecular marker of this invention is closely related to intersex disease traits in pigs and can be effectively used in breeding pigs to prevent abnormal sex development, achieving eugenic goals in pigs, and also providing a reference for human sex development abnormalities.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pig selective breeding technology, and in particular to a SNP molecular marker, primer, and application associated with abnormal sex development in pigs with the NOBOX gene. Background Technology

[0002] Disorders of sex development (DSD) refers to abnormalities in the sex determination or differentiation process during an organism's sex development, resulting in inconsistencies in chromosome karyotype, gonadal phenotype, and external genitalia. Pigs are mammals, and their sex determination, like that of humans, involves heterogamous chromosome matching. Normal sows have a 38,XX karyotype, while boars have a 38,XY karyotype. It is generally believed that the sex-determining region gene (SRY) on the Y chromosome causes the gonads to develop and grow in a male-oriented direction. 38,XX-DSD (Y-) refers to pigs with a 38,XX karyotype that, in the absence of a Y chromosome, possess both male and female reproductive organs. Because of this hermaphroditic reproductive system, it is also called intersex disease in pigs. It leads to impaired reproductive capacity, urogenital infections, reduced growth performance, and consequently, a significant decline in the economic benefits of pig farming. According to literature reports, the incidence of 38,XX-DSD pigs ranges from 0.08% to 0.75% in different populations, and can reach 20% in some independent inbred populations. However, because 38,XX-DSD pigs may have double cryptorchidism, it is difficult to identify them at a glance, and their true incidence may be underestimated.

[0003] The detection of pathogenic genes causing genetic defects in pigs has significant biological and economic value. Pigs share many similarities with humans, and pig biomedical models simulating human reproduction have greatly advanced our understanding of the basic science of diseases. Research on pig DSD can provide a reference for human DSD. At the end of 2022, my country had 452.56 million pigs, of which 43.9 million were breeding sows. Assuming a sow productivity per sow per year (PSY) of 20 and a DSD incidence rate of 0.08%, approximately 702,400 piglets in my country suffer from DSD annually. If we calculate based on a selling price of 500 yuan per weaned piglet, pig farming enterprises nationwide would lose 351.2 million yuan annually due to this disease. Whether from the perspective of improving economic efficiency or formulating breeding strategies, the accurate elimination of pathogenic genes causing genetic defects is indispensable.

[0004] 38,XX-DSD in pigs is an autosomal polygenic inherited disease with a heritability of 0.72-0.81. Most scholars believe it is an autosomal recessive inheritance; when at least one parent is a carrier, the offspring are highly likely to also carry the pathogenic gene. Since heterozygotes do not show symptoms, the pathogenic gene can spread through generations. When both parents are carriers, their offspring may be homozygous for the pathogenic gene, leading to DSD in pigs. The harm is particularly severe when the boar is a carrier, as artificial insemination is the main breeding technique in large-scale commercial pig farms in my country, and the semen from one boar can be used to inseminate many sows at a ratio of 1:80-200. When large-scale imports of lean-type breeding pigs from abroad are used for selective breeding in my country, timely detection of individuals carrying the pathogenic gene is crucial. Therefore, the development and application of SNP molecular markers specific to 38,XX-DSD to assist in the detection of carriers of the pathogenic gene is urgently needed.

[0005] To optimize human reproductive health, prenatal diagnosis has been developed in recent years, and patented SNP loci capable of detecting sex developmental abnormalities have been gradually developed and applied in practice. However, currently, these SNP molecular markers for DSD are only used in humans and goats, and have not yet been applied in animals with DSD such as pigs, dogs, horses, and cattle. Therefore, the development and application of SNP molecular markers for 38,XX-DSD pigs can fill the gap in international and domestic auxiliary detection tools in this field. Summary of the Invention

[0006] The purpose of this invention is to propose a SNP molecular marker, primers, and applications related to abnormal pig sex development associated with the NOBOX gene. This SNP molecular marker is closely related to inter-swine sexually transmitted disease traits and can be used for genetic diagnosis of breeding pigs and marker-based breeding selection to prevent the spread of inter-swine sexually transmitted diseases.

[0007] To achieve this objective, the present invention adopts the following technical solution:

[0008] A SNP molecular marker associated with abnormal sex development in pigs with the NOBOX gene is disclosed. The nucleotide sequence of this SNP molecular marker is SEQ ID NO:1. The nucleotide sequence of the SNP molecular marker contains an allelic mutation at the 231st base S, resulting in polymorphism. This mutation causes alanine (Ala) to be replaced by glycine (Gly). Individuals with genotypes CC and CG exhibit abnormal sex development, while individuals with genotype GG exhibit normal sex development. According to an embodiment of the present invention, the nucleotide sequence of SEQ ID NO:1 is as follows: CATCATGCCACCACCCGCCTGCTCTTACTCAGAAGACCTGGAACCCCAGGATTATCAACCCAGCAACCAGCCAGGGCCATTCCCCTTCCCCCATGCTCCACAGACCCAGCTTTTCCAACCTCCCCAGCCCCAGTTTCCATACCTGCAACCTTTCCCCTTCCACATGCCCAGCTCATTGATGCCTCTGCTACCGGAGGACCCTCTCTTTGCATTGTCCTTTGGCAGCAATG S(C>G) GAACACAGCCCGGAGCTATTTCCCAGGCCCTCCGCAGGGGCAGTCCTGCTGCAGCCACCTGCTGGCAACATGG.

[0009] According to an embodiment of the present invention, individuals with genotypes CC and CG at the SNP molecular marker exhibit abnormal sex development, that is, individuals with genotypes CC and CG exhibit abnormal sex development and the abnormality is consistent with the characteristics of inter-sex diseases in pigs; individuals with genotype GG at the SNP molecular marker exhibit normal sex development. Therefore, the SNP molecular marker is closely associated with the occurrence of 38,XX-DSD pigs.

[0010] Specifically, the SNP molecular marker is located on the 5th exon of the NOBOX gene on pig chromosome 9. By detecting the genotype of pig DNA at the aforementioned SNP molecular marker, it is possible to effectively detect whether the pig has inter-sex disease characteristics. Specifically, breeding pigs with genotypes CC and CG at the SNP molecular marker carry pathogenic genes for abnormal pig sex development. These pathogenic genes can be inherited by some or all of their offspring, increasing the risk of abnormal sex development in their offspring. When the SNP molecular markers related to abnormal pig sex development are applied to breeding pig selection, pigs with genotypes CC and CG at this invention are excluded, and breeding pigs with genotype GG are selected for breeding and preservation. Therefore, the SNP molecular markers related to abnormal pig sex development provided by this invention have the advantages of early screening, time saving, low cost, and high accuracy in breeding pig selection. Pigs with the preferred genotype GG can be used for breeding pig selection.

[0011] This invention also provides primers for SNP molecular markers associated with abnormal sex development in pigs related to the NOBOX gene. These primers are used to amplify the aforementioned SNP molecular markers associated with abnormal sex development in pigs related to the NOBOX gene. The primers include an upstream primer and a downstream primer.

[0012] Upstream primer F1: 5'-TGCTCCACAGACCCAGCTT-3',

[0013] Downstream primer R1: 5'-GACAATGGAACGCAAGGAACG-3'.

[0014] Primers for the SNP molecular marker associated with abnormal sex development in pigs with the NOBOX gene were used for breeding pigs.

[0015] According to an embodiment of the present invention, the DNA of the pig to be tested is amplified by PCR using the above-mentioned primers to amplify the target SNP molecular marker fragment. The amplification is then verified by gel electrophoresis. If successful, the sample is sent for Sanger sequencing. Based on the sequencing results, the genotype of the mutation site is determined, effectively identifying whether the pig carries the pathogenic gene. Therefore, the primer pair used to detect the above-mentioned SNP molecular marker can be effectively used for early screening of pigs, thereby assisting in the early, short-term, low-cost, and highly accurate screening of superior pig breeds.

[0016] The technical solution provided by this invention may include the following beneficial effects:

[0017] The SNP molecular marker with the nucleotide sequence of SEQ ID NO:1 has a genotype at the 231st base in its nucleotide sequence that is closely related to abnormal sex development in pigs. A mutation at this base causes alanine (Ala) to change to glycine (Gly), leading to abnormal sex development in pigs. The SNP molecular marker and its primer pair for amplification of this invention are applied to pig breeding. Pigs with the genotypes CC and CG of this SNP marker are eliminated, and pigs with the genotype GG are selected for breeding. This method offers advantages such as early screening, time saving, low cost, and high accuracy.

[0018] Furthermore, this invention employs 10× Genomics de novo sequencing technology with a sequencing depth of 60×, achieving over 99% genome coverage. This depth serves as an ideal and practical method for accurately identifying genomic mutations, enabling the discovery of more candidate SNPs. This yields a molecular-level biomarker, SEQ ID NO: 1, which, when applied to pig breeding, particularly boar selection, helps prevent the occurrence of inter-herd diseases. Attached Figure Description

[0019] Figure 1 This is a flowchart of the present invention for obtaining SNP molecular markers related to abnormal pig sex development in the NOBOX gene and for population validation of the SNP molecular markers.

[0020] Figure 2 This is the sequencing peak diagram in Embodiment 2 of the present invention. Detailed Implementation

[0021] The embodiments of the present invention are described in detail below. These embodiments are exemplary and are only used to explain the present invention, and should not be construed as limiting the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments used, unless otherwise specified, are all commercially available conventional products.

[0022] Reference Figure 1In this invention, 10× Genomics sequencing was performed on normal sows and 38,XX-DSD pigs, with a sequencing depth of 60×, and de novo genome assembly variation analysis was conducted. Further, population-scale validation was performed to obtain effective molecular markers, providing a theoretical basis for elucidating the molecular genetic mechanism of 38,XX-DSD. With the rapid development of gene sequencing technology, obtaining a massive amount of SNP markers across the entire genome has become possible. Therefore, this invention utilizes genome-wide SNP information to accurately detect pathogenic genes in XX-DSD pigs. Using genome-wide SNP information, it is possible to detect, to the greatest extent possible, whether breeding pigs carry pathogenic genes for porcine XX-DSD from a genetic perspective, thereby effectively identifying individual breeding pigs and achieving the goals of precision breeding and optimization of germplasm resources. Specifically, this invention derives SNP molecular markers associated with abnormal sex development in pigs, and the process of population validation of these SNP molecular markers is as follows.

[0023] Example 1: Screening of SNP molecular markers

[0024] The steps for screening SNP molecular markers in this embodiment are as follows:

[0025] S101: Ear tissues from two 38,XX-DSD pigs and one normal sow were collected for DNA extraction and quality testing to obtain DNA samples.

[0026] S102: 10×Genomics Library Construction and Sequencing: The DNA samples obtained in S101 were randomly fragmented using a Covaris ultrasonic disruptor and then allocated to 100,000s-1,000,000s microreaction systems, each containing a specific DNA sequence marker. Next, the microreaction system was mixed with GEM and then bound to an oil surfactant solution located in a microfluidic "double cross" junction. This step generates droplets containing DNA markers. Subsequently, the oil droplets containing the mixture of sample, enzyme, and GEM were collected from the reservoir, and the sequences in the GEM-released magnetic beads were dissolved to label the samples. At this point, the products containing barcode information in each droplet were mixed together. Finally, the sequencing library was constructed through end repair, A-tailing, sequencing adapter addition, purification, and PCR amplification, and bidirectional sequencing was performed.

[0027] S103: Use Trimmomatic v0.38 software to filter the offline data obtained in S102 to obtain high-quality clean reads.

[0028] S104: The sequencing data obtained from S102 were assembled using SOAP-denovo.

[0029] S105: Using BUSCO software based on the OrthoDB database, the integrity of the genome assembly was assessed by comparing the single-copy orthologous gene set with the assembly results, thereby inferring the integrity of the genome.

[0030] S106: The SOAP-denovo sequence fragment was assembled and aligned with the reference genome using Lastz software to obtain the corresponding SNP loci. SNP loci were then screened based on the autosomal recessive inheritance pattern, using the following criteria:

[0031] (1) Screening for nonsynonymous mutations that are homozygous only in XX-DSD pigs;

[0032] (2) Screening is performed only on nonsynonymous mutations that are homozygous in normal sows;

[0033] (3) Screening is performed only on heterozygous nonsynonymous mutations in normal sows;

[0034] (4) Screening for nonsynonymous mutations that are homozygous in XX-DSD pigs and heterozygous in normal sows.

[0035] S107: The obtained SNP sites were analyzed by GO and KEGG, and combined with transcriptome sequencing data to obtain candidate SNP sites.

[0036] Although we screened candidate loci using a recessive inheritance pattern, heterozygous mutations were still found in 38,XX-DSD, with the CC and CG genotypes at the c.1043C>G site of NOBOX being unique to XX-DSD. Therefore, it is inferred that this genotype is associated with 38,XX-DSD.

[0037] The nucleotide sequence of this SNP molecular marker, SEQ ID NO:1, is:

[0038] CATCATGCCACCACCCGCCTGCTCTTACTCAGAAGACCTGGAACCCCAGGATTATCAACCCAGCAACCAGCCAGGGCCATTCCCTCCCCCATGCTCCACAGACCCAGCTTTTCCAACCTCCCCAGCCCCAGTTTCCATACCTGCAACCTTTCCCCTTCCACATGCCCAGCTTCATTGATGCCTCTGCTACCGGAGGACCCTCTCTTTGCATTGTCCTTTGGCAGCAATG S(C>G) GAACACAGCCCGGAGCTATTTCCCAGGCCCTCCGCAGGGGCAGTCCTGCTGCAGCCACCTGCTGGCAACATGG.

[0039] Example 2: Population validation of SNP molecular markers

[0040] In this embodiment, the steps for population validation of SNP molecular markers are as follows:

[0041] S201: Primer Design: Based on the polymorphism information of candidate SNP molecular markers, specific primers were designed using Primer 5 software. The nucleotide sequences of upstream primer F1 and downstream primer R1 are as follows:

[0042] Upstream primer F1: 5'-TGCTCCACAGACCCAGCTT-3';

[0043] Downstream primer R1: 5'-GACAATGGAACGCAAGGAACG-3'.

[0044] S202: DNA samples were extracted from 32 38,XX-DSD pigs and 32 normal sows (38,XX) as templates, and PCR amplification was performed using the specific primers designed above.

[0045] The PCR reaction system consisted of a total volume of 20.0 μL: 2.0 μL DNA template, 0.5 μL upstream primer (10 μM), 0.5 μL downstream primer (10 μM), and 0.4 μL... PCR SuperMix, 6.0 μL sterile water;

[0046] The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min; followed by 35 cycles, each cycle consisting of denaturation at 94℃ for 30 s, annealing at 56.5℃ for 30 s, and extension at 72℃ for 35 s; and extension at 72℃ for 10 min.

[0047] S203: The amplified PCR products were detected by 1.0% agarose gel electrophoresis and then subjected to Sanger sequencing. The sequencing peak diagram is shown below. Figure 2 As shown. Sequencing results were analyzed to determine the C / G polymorphism at base 231 of SEQ ID NO: 1 and to analyze the distribution of its genotype.

[0048] Sequencing analysis revealed that the CC and CG genotypes at position 231 of SEQ ID NO: 1 are unique to XX-DSD, with the CC genotype frequency at 80% and the CG genotype frequency at 20%. Meanwhile, the GG genotype at position 231 of SEQ ID NO: 1 only appeared in normal sows. The sequencing peak diagram is shown below. Figure 2 As shown. Therefore, the SNP markers described can serve as molecular screening markers for abnormal sex development in pigs.

[0049] Therefore, breeding pigs with the CC and CG genotypes at base 231 of SEQ ID NO: 1 may have offspring with 38,XX-DSD. In breeding work, breeding pigs with the CC and CG genotypes can be excluded and cannot be used as parents. The SNP marker described in this invention can be used as a molecular screening marker related to abnormal sex development in pigs. Combined with the specific primers F1 and R1 designed in this invention, it can be used for genetic diagnosis and disease-resistant breeding of breeding pigs. Breeding pigs with the CC and CG genotypes of this SNP marker can be excluded, and breeding pigs with the GG genotype can be selected for breeding work to optimize the breeding stock and prevent the spread of 38,XX-DSD pigs.

[0050] The SNP molecular markers, primers, and other components and operations related to abnormal sex development in pigs according to embodiments of the present invention are known to those skilled in the art and will not be described in detail here.

[0051] In the description of this specification, references to terms such as "embodiment," "example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0052] Although embodiments of the invention have been shown and described, those skilled in the art will understand that various changes, modifications, substitutions and alterations can be made to these embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents.

Claims

1. The application of primers for a SNP molecular marker associated with abnormal sex development in pigs with the NOBOX gene in the selection of breeding pigs to screen for intersex pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is SEQ ID NO:

1. The 231st base S in the nucleotide sequence of the SNP molecular marker is a polymorphic site. At this polymorphic site, individuals with genotypes CC and CG have abnormal sex development, while individuals with genotype GG have normal sex development. The SNP molecular marker is located on the 5th exon of the NOBOX gene on chromosome 9 of pigs; The SNP molecular marker is used in the selection of breeding pigs to screen individuals with the genotype GG of the SNP molecular marker as breeding parents.

2. The application of primers for a SNP molecular marker associated with abnormal pig sex development due to the NOBOX gene, as described in claim 1, in the selection of breeding pigs to screen for intersex pigs, characterized in that: The primers are used to amplify the NOBOX gene and its associated SNP molecular markers in intersex pigs. The primers consist of an upstream primer and a downstream primer. Upstream primer F1: 5'-TGCTCCACAGACCCAGCTT-3', Downstream primer R1: 5'-GACAATGGAACGCAAGGAACG-3'.