A Bacillus subtilis strain and its application in lignin degradation

Abstract

The present invention belongs to the field of microbial technology and relates to a strain of Bacillus subtilis subsp. and its application in degrading lignin. It is named Bacillus subtilis subsp. NBL-B12058, deposited in the China Center for Type Culture Collection on October 17, 2022, with the deposit number CCTCC NO: M20221574, and the deposit address is Wuhan University, Wuhan, China. The Bacillus subtilis subsp. provided by the present invention has a good degradation effect on lignin in crop straws and the black water of paper mills.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbiology and relates to a strain of Bacillus subtilis and its application in degrading lignin. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention and is not necessarily to be regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] In nature, only a few organisms can degrade lignin and produce corresponding enzymes. Among them, the most studied fungi are: Phanerochete chrysosporium, Coridus versicolor, Thametes versicolor, Phlebia radiata, Pleurotus pulmononanus, Pycnoporus cinnabarinus, etc. These fungi mostly belong to the Basidiomycetes subphylum, the Aphyllophorales order, and the Polyporaceae family of the Aphyllophorales subclass. The actinomycetes that degrade lignin mainly include Streptomyces, Arthrobaeter, Micromonospora, Nocardia, etc. Among bacteria, anaerobic Clostridum xylanoyticum, Pseudomonas, Acinetobacter, Bacillus, etc. also have the effect of degrading lignin.

[0004] Currently, in the research on microbial degradation of lignin, more research has been done on using fungi to degrade lignin than bacteria. However, the growth and metabolic cycles of fungi are long, and the diversity of C-source utilization is poor; moreover, the enzyme production conditions of most fungi are harsh, and they are strongly restricted by C and N sources; in addition, the stability of fungal enzymes is relatively poor compared to bacteria. Due to the above various reasons, fungi are still less used in industrial applications. Currently, the wastes with more lignin mainly include crop straws and black liquor from paper mills. The environments for degrading lignin in crop straws and black liquor from paper mills are different, resulting in the inability to use the same microorganism to degrade lignin in crop straws and black liquor from paper mills. Summary of the Invention

[0005] To solve the deficiencies of the prior art, the object of the present invention is to provide a strain of Bacillus subtilis subsp. and its application in degrading lignin. The Bacillus subtilis subsp. provided by the present invention has a good degradation effect on lignin in crop straws and the black liquor of paper mills.

[0006] To achieve the above object, the technical solution of the present invention is as follows:

[0007] On the one hand, a strain of Bacillus subtilis subsp., named Bacillus subtilis subsp. NBL-B12058, is deposited in the China Center for Type Culture Collection. The deposition time is October 17, 2022, and the deposition number is CCTCC NO: M 20221574. The address is Wuhan University, Wuhan, China.

[0008] On the other hand, a culture method of Bacillus subtilis subsp. is to add the above-mentioned Bacillus subtilis subsp. to a culture medium for culture.

[0009] The culture medium can be NA medium, aniline blue-BM medium, sodium lignosulfonate medium, sodium carboxymethylcellulose medium, inorganic salt medium (Hutchinson medium (g / L)).

[0010] Further, the culture medium is NA medium. More specifically, in the NA medium, peptone is 9.5 - 10.5 g / L, beef extract powder is 2.5 - 3.5 g / L, NaCl is 4.5 - 5.5 g / L, and agar is 19.5 - 20.5 g / L.

[0011] In the third aspect, a bacterial agent of Bacillus subtilis subsp. includes the above-mentioned Bacillus subtilis subsp., the fermented product of the above-mentioned Bacillus subtilis subsp. and / or the metabolite of the above-mentioned Bacillus subtilis subsp.

[0012] Preferably, it further includes cellulase, xylanase and / or protease.

[0013] In the fourth aspect, an application of the above-mentioned Bacillus subtilis subsp. and / or the bacterial agent of Bacillus subtilis subsp. in degrading lignin.

[0014] In the fifth aspect, an application of the above-mentioned Bacillus subtilis subsp. and / or the bacterial agent of Bacillus subtilis subsp. in straw fermentation for returning to the field or fermenting silage feed.

[0015] In the sixth aspect, an application of the above-mentioned Bacillus subtilis subsp. and / or the bacterial agent of Bacillus subtilis subsp. in degrading lignin in paper-making black liquor.

[0016] Specifically, the above-mentioned Bacillus subtilis subsp. is inoculated into paper-making black liquor for culture.

[0017] Specifically, the bacterial agent of the Bacillus subtilis subsp. is applied to the papermaking black liquor for degradation treatment.

[0018] The beneficial effects of the present invention are as follows:

[0019] The Bacillus subtilis subsp. NBL-B12058 provided by the present invention can simultaneously degrade hemicellulose, cellulose and lignin, and the degradation rates reach 18.88%, 23.22% and 44.28% respectively, having high application value.

[0020] Research shows that the Bacillus subtilis subsp. NBL-B12058 provided by the present invention has high activities of lignin peroxidase, manganese peroxidase, cellulase and laccase, and thus can be applied to straw fermentation for returning to the field, fermenting silage feed, etc.

[0021] When the Bacillus subtilis subsp. NBL-B12058 provided by the present invention is used in combination with cellulase, xylanase and protease, the degradation effect is better, and the degradation rate of lignin is as high as 40.08%.

[0022] When the Bacillus subtilis subsp. NBL-B12058 provided by the present invention is inoculated into the papermaking black liquor, it can still maintain its degradation effect on lignin. At 30 d, the degradation rate of lignin is 29.87%. Description of the Drawings

[0023] The specification drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention.

[0024] Figure 1 It is a diagram showing the composting and decomposition situation of straw in the embodiment of the present invention. A is CK, B is T1, and C is T2;

[0025] Figure 2 It is a picture of corn plants with wheat straw directly returned to the field. A is CK, B is T1, and C is T2;

[0026] Figure 3 It is a morphological characteristic diagram of the Bacillus subtilis subsp. NBL-B12058 in the embodiment of the present invention. Detailed Embodiments

[0027] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in combination with specific examples and comparative examples.

[0028] Examples

[0029] I. Screening of Strains

[0030] 1. Sample collection

[0031] A total of 21 samples were collected for the experiment, including papermill sewage, river water and sediment, soil samples, cow dung, etc.

[0032] After the soil samples and water samples were collected, they were immediately placed at -20 °C for storage in the laboratory to kill insects, plant tissues and some viruses in the soil. After 10 hours of treatment, they were thawed at 4 °C. For the soil samples, plant roots, gravel and excess residues needed to be removed, and after grinding, they were passed through a 1-mm soil sieve and stored in a 4 °C refrigerator.

[0033] 2. Preparation of culture media

[0034] (1) NA medium: peptone 10 g / L, beef extract powder 3 g / L, NaCl 5 g / L, agar 20 g / L, pH value 7.0.

[0035] (2) Aniline blue - BM medium: yeast extract 10 g / L, glucose 20 g / L, agar 15 g / L, natural pH value. After sterilization, aniline blue solution was added using a filter, and the final concentration of aniline blue in the medium was 0.1 g / L.

[0036] (3) Sodium lignosulfonate medium: sodium lignosulfonate 2 g / L, K2HPO4 1 g / L, KH2PO4 1 g / L, (NH4)2SO4 2 g / L, MgSO4·7H2O 0.2 g / L, CaCl2 0.1 g / L, FeSO4·7H2O 0.05 g / L, MnSO4 0.02 g / L, natural pH value.

[0037] (4) Carboxymethyl cellulose sodium medium: sodium citrate 1.5 g / L, (NH4)2PO4 5 g / L, KH2PO4 10 g / L, MgSO4·H2O 0.2 g / L, carboxymethyl cellulose sodium CMC - Na 1 g / L, pH value 7.0.

[0038] (5) Inorganic salt medium (Hutchinson medium (g / L)): KH2PO4 1.0 g / L, NaCl 0.1 g / L, CaCl2 0.1 g / L, MgSO4·7H2O 0.3 g / L, NaNO3 2.5 g / L, FeCl3 0.1 g / L, agar 18 g / L, pH value 7.2.

[0039] 3. Isolation and purification of strains

[0040] Take 5 g of the sample and soak it in a conical flask containing 100 mL of sterile water. After shaking at low speed for 0.5 h, take the sample water sample and dilute it serially to 10 -4 , take 10 -3 , 10-4 Coated on NA medium and cultured at 37°C for 1 - 2 days. Pick single colonies with different morphologies, streak for purification, and transfer to a slant.

[0041] 4. Screening of lignin - degrading bacteria

[0042] The aniline blue plate hydrolysis clear zone method was used to screen lignin - degrading bacteria. Bacteria were evenly spotted on the aniline blue - BM medium plate and cultured upside - down at 37°C for 1 - 2 days. During this period, observe whether a hydrolysis clear zone appears around the colony and the size of the hydrolysis clear zone. Observe and record the diameter of the clear zone (D, cm) and the diameter of the colony (d, cm), and calculate their ratio, i.e., H = D / d.

[0043] 5. Screening of cellulose - degrading bacteria

[0044] The Congo red staining method was used to screen cellulose - degrading bacteria. Bacteria were spot - inoculated on the medium, cultured at 37°C for 2 days, stained with 0.1% Congo red aqueous solution for 30 min, then the staining solution was discarded and decolorized with 1 mol / L NaCl aqueous solution for 1 h. Observe and record the diameter of the clear zone (D, cm) and the diameter of the colony (d, cm), and calculate their ratio, i.e., H = D / d.

[0045] 6. Primary screening results

[0046] A total of 87 strains of bacteria were isolated and purified from 21 collected samples. Among them, 46 strains of Bacillus were screened for lignin - degrading bacteria and cellulose - degrading bacteria by the aniline blue plate hydrolysis clear zone method and the Congo red staining method respectively. After excluding pathogenic bacteria, 25 strains showed good aniline blue fading effect (Table 1), and it was speculated that they had lignin - degrading ability. Through the Congo red fading experiment, 26 strains with cellulose - degrading ability were initially screened (Table 2).

[0047] Table 1 Results of aniline blue fading experiment

[0048]

[0049]

[0050] Table 2 Results of Congo red fading experiment

[0051]

[0052]

[0053] II. Enzyme activity determination of strains

[0054] 1. Preparation of crude enzyme solution

[0055] Pick bacteria and inoculate them into the seed liquid, incubate overnight at 37°C, inoculate into NB liquid medium at an inoculation amount of 2%, culture on a shaker at 37°C and 180 r / min. When cultured for 1 d, 3 d, and 7 d, pipette 1 mL into 1.5 mL EP tubes, and pipette a total of 3 tubes. Centrifuge at 4°C and 10,000 rpm for 10 min, and take the supernatant.

[0056] 2. Determination of the activity of manganese peroxidase (MnP)

[0057] In a 4 mL reaction system, it contains 3.4 mL of 50 mmol / L (pH 4.5) sodium lactate buffer, 0.1 mL of 1.6 mmol / L manganese sulfate solution, and 0.4 mL of crude enzyme solution. When preheated to 37°C, add 0.1 mL of 1.6 mmol / L H2O2 solution to initiate the reaction. Transfer to a cuvette at about 3 min 20 s, and measure the absorbance value (OD) at 238 nm for 4 min of the reaction. In the control group, use the uninoculated NB medium to replace the original enzyme solution, use distilled water to replace the H2O2 solution, and keep other reactants unchanged. The activity of manganese peroxidase is defined as the amount of enzyme required to convert 1 μmo1 / L of Mn 2+ to Mn 3+ is 1 enzyme activity unit (U / L). The measurement results are shown in Table 3. The results show that 5 strains of bacteria, such as E17, 12058, E1, F12, and J1, have relatively high manganese peroxidase activity, and the manganese peroxidase activity of all 5 strains reaches the highest at the 7th day.

[0058] Table 3 Determination of manganese peroxidase activity

[0059]

[0060]

[0061] 3. Determination of the activity of lignin peroxidase (LiP)

[0062] The reaction system contains 0.5 mL of enzyme solution, 0.4 mL of 4 mmol / L veratryl alcohol, 2.0 mL of 125 mmol / L tartaric acid buffer solution (pH 2.5). At 30 °C, 0.1 mL of 15 mmol / L H2O2 is added to initiate the reaction. After 2 min and 20 s, it is transferred to a cuvette, and the absorbance change within the first 3 min of the reaction is measured at a wavelength of 310 nm. In the control group, uninoculated NB medium is used instead of the original enzyme solution, and distilled water is used instead of the H2O2 solution, with other reactants remaining unchanged. The enzyme activity is defined as: at 30 °C, the amount of enzyme required to convert 1 μmol of veratryl alcohol into veratraldehyde per minute is 1 enzyme activity unit (U). The results show that the lignin peroxidase Lip activities of 5 strains of bacteria, namely E17, 12058, E1, F12, and J1, are relatively high. Among them, the enzyme activity of 12058 is the highest on the 3rd day, reaching 5.45 nmol / min / L (Table 4).

[0063] Table 4 Determination of lignin peroxidase Lip activity

[0064]

[0065] 4. Determination of laccase (Laccase, Lac) activity

[0066] A 3 mL reaction system reacts at room temperature. Take 0.2 mL of 3 mM ABTS solution, then add 2.7 mL of 0.1 M sodium tartrate buffer solution with pH 4.5, mix well, preheat to 30 °C, and finally add 0.1 mL of crude enzyme solution. Immediately start timing and mix quickly. After 2 min and 20 s, transfer it to a cuvette and place it in a UV-visible or visible spectrophotometer to accurately measure the absorbance value of the reaction solution at a wavelength of 420 nm for 3 min. The blank uses uninoculated NB medium instead of the crude enzyme solution. The enzyme activity is defined as: the amount of enzyme required to catalyze the conversion of 1 μmol of substrate into product per minute (U). The results show that the laccase activities of 5 strains of bacteria, namely E17, 12058, E1, F12, and J1, are relatively high. Among them, the laccase activity of 12058 is the highest on the 7th day, reaching 12.64 U / kg (Table 5).

[0067] Table 5 Determination of laccase activity

[0068]

[0069] 5. Determination of cellulase (Cellulase, Cel) activity

[0070] Take a 25-mL stoppered graduated test tube, add 0.5 mL of 1% sodium carboxymethyl cellulose (pH 5.5, containing 0.1 M sodium acetate buffer) solution, then add 0.5 mL of crude enzyme solution, mix well, place in a water bath at 50 °C, and accurately time for 10 min. After taking it out, add 1.0 mL of DNS (adjustable), shake well, heat the reaction solution in a boiling water bath for 10 min, quickly cool to room temperature, check if dilution is needed, transfer an appropriate amount of the liquid to a cuvette, and place it in a visible spectrophotometer to measure the absorbance value of the reaction solution at a wavelength of 550 nm. Use distilled water as the blank. The international unit definition of enzyme activity is: the amount of enzyme required to produce 1 μmol of glucose per minute (U). The results are shown in Table 6. Five strains, namely E17, 12058, E1, F12, and J1, have relatively high cellulase activities. Among them, E17 has the highest cellulase activity, reaching 10.96 U / g at 3 d.

[0071] Table 6 Determination of cellulase activity

[0072]

[0073] III. Corn straw shake flask experiment

[0074] Select 4 strains with relatively high enzyme activities from the above-screened strains, namely 12058, E17, F12, and J1, for the corn straw shake flask experiment.

[0075] 1. Reagent preparation:

[0076] (1) Neutral detergent: Weigh 18.6 g of disodium ethylenediaminetetraacetate (EDTA) and 6.8 g of sodium tetraborate in a 1-L beaker. Dissolve them by heating with a small amount of distilled water, and then dissolve 30 g of sodium dodecyl sulfate (SDS) and 10 mL of ethylene glycol monoethyl ether (flammable), and 4.56 g of anhydrous Na2HPO4 in another beaker by heating with water. Mix the two solutions and dilute to 1 L, adjusting the pH to 6.9 - 7.1.

[0077] (2) 72% sulfuric acid solution: Pour 665 mL of concentrated sulfuric acid with a density of 1.84 g / mL into a 1-L volumetric flask containing 800 mL of water. Place the volumetric flask in a cold water bath, cool it, and then make up the volume to 1 L with distilled water.

[0078] (3) 2 mol / L hydrochloric acid solution: Take 167 mL of concentrated hydrochloric acid with a density of 1.19 g / mL in a 1-L volumetric flask containing 600 mL of water, and make up the volume to 1 L with distilled water.

[0079] Liquid fermentation medium: 5.00 g of untreated straw + 200 mL of Hutchinson's culture solution.

[0080] 2. Test procedure:

[0081] (1) Prepare fresh straw, dry it, crush it, and sieve it. Weigh 5.00 g of corn straw accurately and add it to 180 mL of Hutchinson medium. Sterilize it at 121 °C for 30 min.

[0082] (2) Activate the strain, and after shaking culture in the medium for 48 h, inoculate it into the medium in step 1 at an inoculation amount of 10% and shake culture at 37 °C and 180 r / min for 30 d. Set 3 replicates for each treatment.

[0083] (3) Take samples at 30 d of culture. Take out the fermentation broth in a sterile operating table, pour it into a known-weight mesh bag, dry it overnight at 85 °C in an oven, and then use the improved Van Soest washing method to determine the contents of cellulose, hemicellulose, and lignin in the straw, so as to calculate the degradation rate of each component of the straw.

[0084] 3. Determination of the contents of hemicellulose, cellulose, and lignin:

[0085] (1) Add 70 mL of neutral detergent to 100 mL iodine flasks containing samples respectively, place them in a boiling pressure cooker, set to keep warm at 100 °C for 50 min, then take out and filter. Wash the filter residue until the pH is about 6.5 - 7.0, and wash it repeatedly with 95% ethanol, absolute ethanol, and acetone. After washing 2 times, put it in an oven and dry it to a constant weight W0.

[0086] (2) Place the dry residue sample in a 150 mL beaker, add 70 mL of 2 mol / L hydrochloric acid solution, put it in a boiling pressure cooker, set to keep warm at 100 °C for 50 min, then filter until the solution is neutral, and then wash it repeatedly with 95% ethanol, absolute ethanol, and acetone in turn. After that, put it in an oven and dry it to a constant weight W1. Then the hemicellulose content is W0 - W1.

[0087] (3) Add 10 mL of chilled 72% sulfuric acid to the dry residue sample, place it indoors for degradation for 4 h, then add 90 mL of water, leave it overnight at room temperature. The next day, wash the residue with distilled water until the pH is about 6.5, and dry it to a constant weight W2. Then W1 - W2 is the cellulose content.

[0088] (4) Ash the residue in a muffle furnace at 550 °C for 4 h, take it out and weigh W3. W2 - W3 is the lignin content.

[0089] The contents and degradation rates of hemicellulose, cellulose, and lignin are shown in Table 7.

[0090] Table 7 Degradation of hemicellulose, cellulose, and lignin by different strains

[0091]

[0092] The straw flask experiment showed that the above 4 strains of bacteria had degradation effects on hemicellulose, cellulose, and lignin in corn straw. Among them, 12058 had the best degradation effects on hemicellulose and lignin, with degradation rates of 18.88% and 44.28% respectively, and E17 had the best degradation effect on cellulose, with a degradation rate of 30.41%.

[0093] IV. Corn straw composting experiment

[0094] Weigh dry corn straw with a length of about 1 - 2 cm, inoculate bacteria according to Table 8, add tap water to adjust the moisture content of the straw to 65%, fully mix it, and then put the straw into a foam box with an inner diameter of about 45 cm in length, width, and height. Conduct fermentation culture in a stacked state at room temperature (10 - 25°C), pay attention to the moisture content. If the moisture content is too low, add water in time to about 60%. Set the same water application amount, and set the non-inoculated test group as the control. The degradation rates of hemicellulose, cellulose, and lignin during the straw composting process are shown in Table 9.

[0095] Table 8 Settings of straw composting experiment

[0096]

[0097] Table 9 Degradation of hemicellulose, cellulose, and lignin by different treatments

[0098]

[0099] The corn straw composting experiment showed that 12058 had good degradation effects on hemicellulose, cellulose, and lignin during the corn straw composting process. When used in combination with cellulase, xylanase, and protease, the degradation effect was better, and the degradation rate of lignin was as high as 40.08%.

[0100] V. Papermaking black liquor lignin degradation experiment

[0101] Inoculate the cultured 12058 into the sterilized papermaking black liquor at an inoculation amount of 10%, shake and culture at 37°C and 180 r / min for 30 d, and use the inoculation of an equal amount of NB medium as the control. Measure the lignin degradation rate after 30 d. The results are shown in Table 10. The results showed that 12058 could still maintain its lignin degradation effect in the papermaking black liquor. At 30 d, the lignin degradation rate was 29.87%.

[0102] Table 10 Lignin degradation rate of papermaking black liquor

[0103] 15d 30d CK 3.21％ 5.07％ 12058 21.05％ 29.87％

[0104] VI. Experiment on the composting effect of corn straw under low-temperature conditions

[0105] 1. Purpose of the experiment: Using the method of composting and decomposing corn straw, under low-temperature conditions, verify the degradation rates of cellulose, hemicellulose, and lignin in the straw treated with lignin-degrading bacterium NBL-B12058, the decomposition effect of the straw, and the effect of the decomposed straw on seed germination.

[0106] 2. Experimental treatments:

[0107] The experiment started on December 5, 2021. The length * width * height of the prepared corn straw compost was 1m * 1.5m * 1m. It was stacked layer by layer in the way of 1 layer of straw, 1 layer of urea, and 1 layer of clear water. Adjust the C / N of the initial compost pile to 20 - 30:1 and the moisture content to 50% - 60%. During the decomposition process, appropriately supplement water and cover it with a plastic sheet. Except for using the degradation bacterial solution to replace the clear water, other measures for the treatment group were the same. It was divided into 3 treatments, as shown in Table 11.

[0108] Table 11 Experimental settings for corn straw compost

[0109]

[0110] 3. Observation and detection indicators:

[0111] 1) During the straw composting process, samples were collected every 25 days to measure the hemicellulose, cellulose, and lignin contents and calculate the degradation rates. About 200g of samples were taken at different positions of the compost pile using the 5-point method, mixed evenly and then detected. Sampling and detection were repeated three times.

[0112] 2) Observe the indicators of straw decomposition degree during the fermentation process:

[0113] Color of the straw (divided into medium yellow, slightly yellow, brownish yellow, blackish yellow);

[0114] Odor of the straw (divided into musty smell, ammonia smell, wine smell, rotten smell);

[0115] Softening degree by hand feeling (divided into hard, slightly soft, soft, rotten);

[0116] 3) Refer to the organic fertilizer standard NY / T 525 - 2021 to conduct cucumber seed germination tests to evaluate the degree of straw decomposition.

[0117] Weigh 10.00g of the decomposed straw (fresh sample), place it in a 250mL conical flask. After converting the moisture content of the sample, add 100mL of water according to the solid-liquid ratio (mass / volume) of 1:10. Tighten the bottle cap and fix it vertically on a reciprocating horizontal shaker. Adjust the frequency to 100 times per minute and the amplitude to not less than 40mm. Shake and extract at 25℃ for 1h. After taking it down and standing for 0.5h, take the supernatant and filter it through a filtration device pre-installed with filter paper. Collect the filtered extract, shake it well and use it for analysis.

[0118] Place 1 or 2 qualitative filter papers in a 9 cm petri dish, evenly place 10 cucumber seeds of basically the same size and plumpness on it, add 10 mL of the test sample extract, cover the petri dish, and culture it in the dark in an incubator at 25°C ± 2°C for 48 h, and count the germination rate and measure the main root length.

[0119] Use water as a control and conduct a blank test.

[0120] The seed germination index (GI) is calculated according to the formula:

[0121]

[0122] In the formula:

[0123] A1—the seed germination rate of the straw organic fertilizer extract, %;

[0124] A2—the average root length of the seeds cultured with the straw organic fertilizer extract, mm;

[0125] B1—the seed germination rate of water, %;

[0126] B2—the average root length of the seeds cultured with water, mm;

[0127] 4. Test results

[0128] 4.1 Degradation rate of hemicellulose, cellulose and lignin in straw

[0129] Table 12 Degradation rate of hemicellulose, cellulose and lignin in straw at different times (unit: %)

[0130]

[0131] As can be seen from Table 12, the degradation rates of cellulose, hemicellulose and lignin in the straw of each treatment increased with the prolongation of the composting time. The degradation rates of the three indexes of T1 and T2 treated with the straw degradation bacterial liquid were significantly greater than those of the control group CK without using the degradation agent. From the 25th day, the degradation rates of the three substances in the straw of T1 and T2 treatments were also significantly faster than those of the control group CK, indicating that the straw composting rate using the degradation bacterial liquid could quickly start colonization and growth under low-temperature conditions and degrade corn straw. Moreover, the degradation rate of the T2 group treated with the composite degradation bacterial liquid was also significantly greater than that of the single-strain degradation bacterial liquid T1, indicating that the degradation rate of the composite bacterial liquid after the previous optimization of the formula was also better than that of the single strain.

[0132] 4.2 Apparent situation of straw compost maturity

[0133] Table 13 Apparent situation of straw compost maturity

[0134]

[0135] From Table 13 andFigure 1 It can be seen that under the low temperature in winter, during the composting and decomposition of corn straw, on the 25th day, the straw colors, odors, softening degrees, etc. of T1 and T2 treated with the degradation bacterial liquid were significantly better than those of the control group CK without the bacterial liquid treatment. Moreover, on the 50th day, the color of the straw of T2 treated with the composite degradation bacterial liquid was also better than that of T1 treated with the single-strain bacterial liquid, indicating that the degree of decomposition of the straw treated with the bacterial liquid was faster than that without treatment, and the decomposition effect of the composite bacterial liquid was also better than that of the single-strain bacterial liquid.

[0136] 4.3 Seed germination rate and germination index

[0137] Referring to the organic fertilizer standard NY 525-2012, a cucumber seed germination test was carried out, and the results were counted after 48h. The seed germination index represents the degree of decomposition of the organic material. As can be seen from Table 14, the cucumber seed germination indices of the straw extracts in the three treatment groups were all greater than 70%, meeting the organic fertilizer standard. The seed germination index of the composite bacterial liquid treatment group T2 was the highest, followed by T1 treated with the single-strain bacterial liquid, and the lowest was T3 of the straw water control group, indicating that the degree of decomposition of the straw treated with the lignin degradation bacterial liquid was higher than that without treatment.

[0138] Table 14 Effects of straw extracts on cucumber seed germination

[0139]

[0140] Conclusion: In the corn straw composting and decomposition experiment carried out in winter after the autumn harvest, the degradation rates of cellulose, hemicellulose, and lignin in the straw inoculated with the lignin degradation bacterial liquid, as well as the apparent indexes such as straw color, odor, and hand feel softening degree, and the germination index of the seeds by the extract were all better than those of the control treatment without inoculating the bacterial liquid. Moreover, under low temperature conditions, it can quickly play a degradation role, and the degradation rate and degree of decomposition are also faster than the control.

[0141] VII. Experiment on the effect of directly returning wheat straw to the field

[0142] 1. Experimental purpose: By directly returning wheat straw to the field, study the effect of using lignin degradation bacteria to treat the straw in the cultivated soil on the soil nutrient situation and the growth of the next crop sown after a period of decomposition.

[0143] 2. Experimental plan

[0144] 2.1 Experimental treatment

[0145] For the conventional planting experimental field, select a plot with uniform conditions and divide it into 3 groups, with each group being 12m 2(Length * Width = 2m * 6m), Spread 6.5 kg of straw crushed into 2 - 3 cm evenly on the ground, apply the degradation bacterial liquid by spreading, plow it into the field, water to make the soil moisture content reach 50 - 60%, and let it decompose for 30 days. Appropriate equal amounts of clear water can be supplemented for each group in the middle. After decomposition is completed, sow corn, variety "Zhengdan 958", 100 seeds per group. Another CK group is set with equal amounts of clear water replacing the degradation bacterial liquid, and other fertilizer and pesticide management measures are the same.

[0146] There are 3 experimental groups:

[0147] CK: Straw + Clear water;

[0148] T1: Straw + Degradation bacterial liquid;

[0149] T2: Straw + Competing product composting agent;

[0150] 2.2 Sampling and Index Determination

[0151] (1) Soil Sample Collection and Index

[0152] Take soil samples after spreading the straw and applying the degradation bacterial liquid and plowing it into the field as the initial value, and take soil samples when sowing after 30 days of decomposition as the end value of decomposition. Use the multi-point sampling method to collect soil samples at a depth of 0 - 25 cm in the rhizosphere of plants in each treatment, and put them into sterile sealed bags. Detect the nutrient contents such as soil alkaline hydrolyzable nitrogen, available phosphorus, and available potassium.

[0153] (2) Determination of Plant Growth Indexes

[0154] Measure no less than 30 plants in each group, and count the emergence rate, plant height, and stem diameter.

[0155] 3 Data Analysis

[0156] 3.1 Effects of Direct Return of Straw Treated with Degradation Bacterial Liquid on Soil Nutrient Conditions

[0157] Table 15 Soil Nutrient Conditions

[0158]

[0159]

[0160] * Increase ratio compared with the initial content after 30 days of decomposition

[0161] After the straw was returned to the field and decomposed for 30 days, the nutrient situation in the soil is shown in Table 15. It can be found that the contents of the three available nutrients in the degradation bacterial liquid group T1 increased the most compared with the initial stage, followed by the competing product composting agent T2 group, and the natural composting CK group was the least. This shows that after treating straw with the degradation bacterial liquid, the nutrients fixed in the soil and the macromolecular organic matter in the straw can be degraded and mineralized into plant-available nutrients, greatly increasing the content of soil available nutrients, improving soil fertility, and the increasing effect on the contents of the three nutrients is also much greater than that of the competing product composting agent and the natural composting group.

[0162] 3.2 Effects of treating straw with degradation bacterial liquid and directly returning it to the field on the growth of maize

[0163] Table 16 Maize emergence and growth situation

[0164]

[0165] The emergence rate was counted 10 days after maize sowing, and the plant height and stem diameter of maize plants were investigated and counted 30 days later. The seed emergence situation can illustrate the degree of straw decomposition. As can be seen from Table 16, the emergence rate of maize seeds after directly returning the straw treated with the degradation bacterial liquid and decomposing for 30 days was the highest at 100%, followed by the competing product T2, and the natural composting CK was the lowest. This shows that the degree of natural straw decomposition was the lowest, the degradation rate was the slowest, and the incomplete decomposition led to partial inhibition of seed germination and emergence. On the contrary, all the straw treated with the degradation bacterial liquid emerged, and the degree of straw decomposition was much greater than that of the competing product T2 group and the natural composting CK group, with the best effect.

[0166] Thirty days after emergence, the stem height and stem diameter of maize plants in the T1 group using the degradation bacterial liquid were significantly higher than those in the natural composting group CK and the competing product composting agent T2, indicating that directly returning the straw treated with the degradation bacterial liquid to the field can effectively increase various available nutrients in the soil and promote the growth of maize plants, as Figure 2 shown.

[0167] To sum up, directly returning the straw treated with the degradation bacterial liquid to the field can effectively degrade the straw in the soil and promote the mineralization of organic matter, increase soil available nutrients such as alkaline hydrolyzable nitrogen, available phosphorus, and available potassium, promote the emergence and growth of sown maize, and the effects on straw degradation rate, soil available nutrient improvement, maize emergence and growth are significantly better than those of natural composting and competing product composting agent treatment.

[0168] VIII. Morphological identification of lignin-degrading bacteria

[0169] 1. Bacterial morphological characteristics: Stained with crystal violet staining solution, the morphological characteristics of the bacterial cells were observed under the oil immersion lens of an optical microscope. They had typical Bacillus characteristics, with straight rod-shaped cells and proximal spores, oval in shape, as Figure 3 shown.

[0170] 2. Molecular identification: Referring to the operating steps of the bacterial genomic DNA extraction kit (Solarbio), the bacterial genome was extracted. Using the genome as a template, the bacterial gyrA RNA primers 42F and 1066R were used for amplification to obtain the gyrA RNA sequence of the bacteria, which was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The sequencing results are as follows. Through alignment using BLAST in NCBI, the similarity of the gyrA RNA sequence of strain NBL-B12058 to the gyrA RNA sequence of Bacillus subtilis subsp. is greater than 99%, and this strain is Bacillus subtilis subsp.

[0171] >

[0172] CGGGATTGCATGAGCGTTATCGTGTCCCGTGCTCTTCCGGATGTTCGTGA

[0173] CGGTTTAAAACCGGTTCATAGACGGATTTTGTATGCAATGAATGATTTAGG

[0174] CATGACAAGTGACAAGCCTTATAAAAAATCCGCGCGTATCGTTGGAGAA

[0175] GTTATCGGGAAATACCACCCGCACGGTGATTCAGCGGTATATGAATCCATG

[0176] GTCAGAATGGCTCAGGATTTCAACTACCGTTATATGCTCGTTGACGGTCA

[0177] CGGAAACTTCGGTTCTGTTGACGGAGACTCAGCGGCGGCCATGCGTTATA

[0178] CAGAAGCACGAATGTCTAAAATCTCAATGGAGATTCTTCGCGACATCACA

[0179] AAAGACACAATCGATTACCAGGATAACTATGACGGGTCAGAAAGAGAAC

[0180] CTGTCGTTATGCCTTCAAGGTTCCCGAATCTGCTCGTGAACGGTGCTGCC

[0181] GGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCACCAGCTGGGAG

[0182] AAATCATTGACGGTGTACTTGCTGTTAGTGAGAATCCGGACATTACAATT

[0183] CCAGAGCTTATGGAAGTCATTCCAGGGCCTGATTTCCCGACCGCGGGTCA

[0184] AATCTTGGGACGCAGCGGTATCCGGAAAGCATACGAATCAGGCCGAGGC

[0185] TCTATCACGATCCGGGCAAAAGCTGAGATCGAACAAACATCTTCGGGTAA

[0186] AGAAAGAATTATCGTTACAGAGTTACCTTACCAAGTAAATAAGGCGAAAT

[0187] TAATTGAGAAAATTGCTGATCTCGTAAGGGACAAAAAGATAGAGGGTATC

[0188] ACAGATCTGCGTGATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGA

[0189] AATCAGACGCGATGCCAATGCGAATGTTATCTTAAACAATCTGTACAAAC

[0190] AAACTGCTCTACAAACATCTTTTGGCATCAACCTGCTTGCGCTTGTTGATGCCCCA, see SEQ ID NO.1.

[0191] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. A Bacillus subtilis strain, characterized in that, Named Bacillus subtilis subsp. ( Bacillus subtilis subsp. ) NBL-B12058, deposited in the China Center for Type Culture Collection on October 24, 2022, with the deposit number CCTCC NO: M20221574 and the deposit address being Wuhan University, Wuhan, China.

2. A cultivation method of Bacillus subtilis subspecies, characterized in that, The Bacillus subtilis subsp. described in claim 1 is added to a culture medium for cultivation.

3. The culturing method of the Bacillus subtilis subspecies according to claim 2, characterized in that, The culture medium is NA medium.

4. The culturing method of the Bacillus subtilis subspecies according to claim 3, characterized in that, In the NA medium, peptone is 9.5 - 10.5 g / L, beef extract powder is 2.5 - 3.5 g / L, NaCl is 4.5 - 5.5 g / L, and agar is 19.5 - 20.5 g / L.

5. A bacterial agent of Bacillus subtilis subspecies, characterized in that, It includes the Bacillus subtilis subsp. described in claim 1.

6. The microbial inoculum of the Bacillus subtilis subspecies according to claim 5, characterized in that, It also includes cellulase, xylanase, and / or protease.

7. Use of an agent of the Bacillus subtilis subsp. described in claim 1 and / or the Bacillus subtilis subsp. described in claim 5 or 6 in degrading lignin.

8. Use of an agent of the Bacillus subtilis subsp. described in claim 1 and / or the Bacillus subtilis subsp. described in claim 5 or 6 in straw fermentation for returning to the field or fermenting silage feed.

9. Use of an agent of the Bacillus subtilis subsp. described in claim 1 and / or the Bacillus subtilis subsp. described in claim 5 or 6 in degrading lignin in paper-making black liquor.

10. The application according to claim 9, characterized in that, The Bacillus subtilis subsp. is inoculated into paper-making black liquor for cultivation; Or, an agent of the Bacillus subtilis subsp. is applied to paper-making black liquor for degradation treatment.

Images