Application of rice OsERF103 protein and its encoding gene in improving plant drought tolerance

Abstract

The present invention provides the use of rice OsERF103 protein and its encoding gene in improving plant drought tolerance, relating to the technical field of plant genetic engineering. The amino acid sequence of rice OsERF103 protein is shown in SEQ ID No. 2. The present invention clarifies for the first time that rice OsERF103 gene is induced to express by drought, and its transcriptional expression level gradually increases with the process of drought treatment and gradually decreases with the process of rewatering; drought tolerance analysis shows that OsERF103 overexpressing rice plants have a drought-resistant phenotype and a high survival rate, while Oserf103 mutants all show a drought-sensitive phenotype and a survival rate significantly lower than that of the wild type, indicating that OsERF103 is a positive regulatory factor in rice's response to drought. Rice OsERF103 protein and its encoding gene can be used to improve plant drought tolerance, which is of great significance for the study of the molecular mechanism of drought stress and the breeding of new drought-resistant varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and in particular to an application of a rice OsERF103 protein and a gene encoding the same in improving plant drought tolerance. Background Art

[0002] Rice (Oryza sativa L.) is one of the three major crops in the world and feeds more than half of the world's population as a staple food. Rice is also one of my country's main food crops. Drought is the main factor that limits rice growth, affects rice development and rice yield. As an important food crop, rice consumes up to 8884.5m3 of water during its entire growth period. 3 / hm 2 (Zhang et al., 2012). With the intensification of the greenhouse effect, the area of ​​arid regions worldwide is increasing, and some areas are experiencing extreme drought and water shortages. Therefore, maintaining normal rice production under traditional flooded irrigation requires sufficient water. However, current water scarcity and uneven regional distribution of precipitation have led to an increasingly prominent conflict between agricultural production and water shortages. Furthermore, persistent severe droughts can lead to widespread crop yield reductions or even complete crop failure, seriously threatening food security (Lesk et al., 2016; Lobell et al., 2011). Therefore, in-depth research on the genetic basis and molecular mechanisms of rice responses to drought stress and the identification of drought-resistance-related genes can provide a theoretical basis for the breeding and improvement of new drought-resistant rice varieties. This research also has important theoretical and practical significance for ensuring food security and achieving sustainable agricultural development.

[0003] In response to various biotic and abiotic stresses, rice has evolved a series of adaptive mechanisms to survive and reproduce. One of the most important components is the regulation of stress-responsive gene expression by transcription factors to enhance rice's adaptability. Currently, known transcription factors involved in drought stress response include ZFPs, bZIPs, ERF / AP2s, MYB / MYCs, and NACs. AP2 / ERFs are one of the largest transcription factor families in rice and are widely involved in various biological processes, including rice growth and development and stress response. When faced with adversity, rice AP2 / ERF transcription factors regulate the expression of target genes by binding to cis-acting elements in the promoter regions of stress-related genes, such as GCAC(A / G)N(A / T)TCCC(A / G)ANG(C / T), GCC-box (AGCCGCC), and DRE / CRT (A / GCCGAC), thereby enhancing rice's adaptability to various stresses (Shoji and Yuan, 2021). Rashid et al. (2012) classified 170 rice AP2 / ERF transcription factor family genes into five subfamilies: AP2 (APETALA2), RAV (related to ABI3 / VP1), DREB (dehydration-responsive element binding protein), ERF (ethylene responsive factor), and soloist. The ERF and DREB subfamilies play crucial roles in rice's response to stress. To date, reports on the role of ERF and DREB subfamily members in rice stress resistance have primarily focused on disease resistance, drought resistance, and salt tolerance. For example, overexpression of OsEREBP1 (ethylene responsive element binding protein 1) can increase JA and ABA content and enhance rice resistance to bacterial blight (Jisha et al., 2015); OsERF83 binds to the GCC-box to regulate downstream gene expression, enhancing rice blast resistance (Tezuka et al., 2019); and OsERF3 is a phosphorylation substrate of the receptor-like kinase GUDK (growth under drought kinase). Overexpression of GUDK and OsERF3 can reduce drought tolerance in rice. OsDERF1 (drought-responsive ERF genes) and OsERF109 can directly bind to the GCC-box or DRE elements in the OsERF3 promoter, activating its expression and negatively regulating drought resistance (Wan et al., 2011; Zhang et al., 2013).In salt stress research, OsSERF1 (salt-responsive ERF1) is a core positive regulator of salt stress response. When rice is exposed to salt stress, the MAP3K6-MKK4-MAPK5 pathway is activated, and the Ser 105 residue of the OsSERF1 protein is phosphorylated by MAPK5, enhancing its transcriptional activation activity and improving salt tolerance. Furthermore, OsSERF1 expression is induced by salt stress. OsSERF1 recognizes and binds to the A / GCCGAC motifs of MAP3K6 and MAPK5, directly activating target genes and its own expression, forming a feedback regulation mechanism (Schmidt et al., 2013). Overexpression of OsERF922 increases the concentration of Na in rice. + / K + An increase in the ratio leads to a weakening of rice tolerance to salt stress (Liu et al., 2012). However, the function and application of OsERF103 in rice response to drought have not been reported.

[0004] In view of this, the present invention is proposed. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of rice OsERF103 protein and its encoding gene in improving plant drought tolerance and a method for cultivating transgenic plants tolerant to drought stress, thereby providing a theoretical basis for the study of the molecular mechanism of plant drought resistance and the cultivation of new drought-resistant varieties.

[0006] To achieve the above objectives, the present invention provides the following technical solutions:

[0007] In one aspect, the present invention provides a use of a rice OsERF103 protein and a gene encoding the same for improving plant drought tolerance. The amino acid sequence of the rice OsERF103 protein is shown in SEQ ID No. 2.

[0008] The present invention constructs an overexpression vector and mutants of the rice gene OsERF103. Overexpression-positive plants and mutant-positive plants are obtained by infecting rice callus with Agrobacterium. Four mutant transgenic lines and six overexpression transgenic lines with varying degrees of upregulated expression levels were obtained. Functional characterization revealed that the transcriptional expression of OsERF103 gradually increases with drought treatment and gradually decreases with rewatering, indicating that OsERF103 responds to drought stress at the transcriptional level. Drought tolerance analysis of the transgenic lines revealed that all Oserf103 mutants exhibited a drought-sensitive phenotype, with significantly lower survival rates than the wild type. In contrast, all overexpression plants exhibited a drought-resistant phenotype, with survival rates positively correlated with the upregulation of OsERF103 transcripts, indicating that OsERF103 is a positive regulator of rice drought response.

[0009] The "rice OsERF103 protein" in the present invention encompasses a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in SEQ ID No. 2, as well as a protein with the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID No. 2.

[0010] In one embodiment, the nucleotide sequence of the gene encoding the rice OsERF103 protein is shown as SEQ ID No. 1.

[0011] The present invention encompasses sequences having a similarity of 90% or more, preferably 95% or more, and more preferably 99% or more to the nucleotide sequence of SEQ ID No. 1 and having the same function. The present invention also encompasses sequences having one or more base substitutions, replacements, deletions, and / or additions to the nucleotide sequence of SEQ ID No. 1 and having the same function.

[0012] In another aspect, the present invention provides a use of a biological material comprising a gene encoding a rice OsERF103 protein for improving drought tolerance in plants, wherein the biological material comprises:

[0013] (A) an expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID No. 1;

[0014] (B) a recombinant vector containing the expression cassette described in (A);

[0015] (C) a recombinant microorganism containing the expression cassette described in (A) or the recombinant vector described in (B);

[0016] (D) A recombinant cell containing the expression cassette described in (A) or the recombinant vector described in (B).

[0017] In one embodiment, the present invention comprises transgenic plants containing a gene encoding a rice OsERF103 protein. Such transgenic plants include seeds, callus tissue, whole plants, and cells. Such transgenic plants include not only first-generation transgenic plants obtained by transforming the gene into a target plant, but also progeny thereof.

[0018] In one embodiment, the recombinant vector is a recombinant expression vector, preferably an overexpression vector of the target gene (rice OsERF103 gene).

[0019] In one embodiment, the recombinant expression vector comprises a transcript that initiates transcription of the target gene. To achieve overexpression of the target gene, the promoters included in the recombinant expression vector include, but are not limited to, constitutive promoters; tissue-, organ-, and development-specific promoters; and inducible promoters.

[0020] In a preferred embodiment, the overexpression vector contains a Ubiquitin promoter or a CaMV 35S promoter; the nucleic acid molecule of the target gene is operably linked to the promoter.

[0021] In one embodiment, the recombinant expression vector comprises a suitable transcription terminator, including but not limited to: Agrobacterium nopaline synthase terminator (NOS terminator), cauliflower mosaic virus CaMV 35S terminator, tml terminator, etc.

[0022] In one embodiment, the recombinant vector includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as but not limited to pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb vectors.

[0023] In one embodiment, the recombinant vector also includes a gene encoding an enzyme or luminescent compound that can produce color changes (GUS gene, luciferase gene, etc.) and an antibiotic marker gene (such as a gene that confers resistance to kanamycin and related antibiotics) to facilitate the identification and screening of transgenic plant cells or plants.

[0024] In one embodiment, the microorganism is Agrobacterium, preferably, the microorganism is Agrobacterium EHA105.

[0025] In one embodiment, the recombinant vector is Ubi-XX-3FLAG.

[0026] In one embodiment, the recombinant cell comprises an overexpression vector of the rice OsERF103 gene or an overexpression mutant of the rice OsERF103 gene.

[0027] In one embodiment, the application is to overexpress the rice OsERF103 protein or its encoding gene to improve the drought tolerance of the plant.

[0028] In another aspect, the present invention provides a method for cultivating transgenic plants tolerant to drought stress, wherein the expression level of the OsERF103 gene or the activity of the OsERF103 protein in the plant is increased by genetic engineering methods to obtain transgenic plants with improved drought tolerance.

[0029] In one embodiment, the method for increasing the expression level of the OsERF103 gene in the plant comprises introducing a gene encoding the OsERF103 protein into plant tissues or plant cells.

[0030] The present invention also provides a method for improving plant drought stress tolerance, comprising: 1) constructing an expression vector containing the rice OsERF103 gene; 2) transforming the constructed expression vector into plants or plant cells; and 3) cultivating transgenic plants.

[0031] In the present invention, the expression vector can be introduced into plant cells by using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation and other conventional biotechnology methods; for example, it can be introduced into rice by infecting callus tissue.

[0032] In one embodiment, after the recombinant expression vector containing the target gene is infected with the target plant, positive plants are screened to obtain transgenic plants with enhanced drought resistance compared with normal plants.

[0033] In a specific embodiment, the improved drought resistance of the transgenic plants (introduced with the OsERF103 gene) is manifested as: the drought resistance of the transgenic plants is higher than that of non-transgenic plants (wild-type plants) or plants transfected with an empty vector without the target gene; in particular, the transgenic plants have a higher level of drought tolerance, and the expression level of the OsERF103 gene is also higher under drought stress, and the survival rate of the transgenic plants is also higher than that of the wild type.

[0034] In one embodiment, the hosts transformed by the recombinant expression vector include various plants.

[0035] In one embodiment, the plant is a monocot or a dicot, including but not limited to Arabidopsis thaliana, rice, rapeseed, etc.

[0036] In a preferred embodiment, the plant is rice, preferably wild rice (Nipponbare).

[0037] Beneficial effects of the present invention:

[0038] The present invention clarifies that the OsERF103 gene is an important gene for rice drought tolerance. This gene can respond to drought stress and play a positive regulatory role in rice drought resistance. The rice gene OsERF103 or its encoded protein can be used to improve plant stress resistance (drought resistance).

[0039] The present invention provides applications for enhancing or improving plant drought tolerance by increasing the expression of the OsERF103 gene, thereby producing plants with enhanced drought resistance. This approach has high application value and lays a foundation for research into breeding drought-tolerant transgenic plants. Cultivating drought-tolerant transgenic plants by overexpressing the rice OsERF103 protein or its encoding gene can improve plant survival rates under drought stress conditions, contributing to food security and sustainable agricultural development. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 The amino acid sequence comparison results of the protein encoded by the OsERF103 gene and the protein encoded by the OsERF48 gene;

[0041] Figure 2 The amino acid sequence comparison results of the protein encoded by the OsERF103 gene and the protein encoded by the OsERF71 gene;

[0042] Figure 3 The amino acid sequence comparison results of the protein encoded by the OsERF103 gene and the protein encoded by the OsERF101 gene;

[0043] Figure 4 Schematic diagram of the mutation sites of four mutants of rice OsERF103 gene;

[0044] Figure 5 is the transcription level of rice OsERF103 in wild type and different overexpression transgenic lines;

[0045] Figure 6 is the transcription level of OsERF103 during drought treatment and rewatering in rice;

[0046] Figure 7 The results of the analysis of the rice Oserf103 mutant that reduces the drought resistance and survival rate of rice;

[0047] Figure 8 Analysis results of rice OsERF103 gene overexpression improving rice plant drought resistance and survival rate. DETAILED DESCRIPTION

[0048] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. The following embodiments and features of the embodiments may be combined with each other unless there is a conflict.

[0049] The detailed description of the embodiments of the present invention provided below is not intended to limit the scope of the claimed invention, but rather merely represents selected embodiments of the present invention. All other embodiments derived by persons of ordinary skill in the art based on the embodiments of the present invention without creative effort are intended to fall within the scope of protection of the present invention.

[0050] In one embodiment, the present invention provides a use of a rice OsERF103 protein or a gene encoding it in improving plant drought tolerance. The amino acid sequence of the rice OsERF103 protein is shown in SEQ ID No. 2 (SEQ ID No. 2: MVPRVERGGGGFHLPNSEREDSLFIRALISVVSGDTTVPTLLPEPTMATVVAGAATCARCGVDGCIGVDCEVVVLAAAAGSSCSDEEDEGECTTGAVASGGVTGGVGKRRPRRRSGGEGSRYRGVRRRPWGKWAAEIRDPRRAVCKWLGTFDTAEDAARAYDVAALEFRGQRAKLNFPASTAAQQPRPLLHHNLRENCGSNASSPVHAPEHARTAAAAKDQEIWDGLREIMMLDDGSFWSMP); the nucleotide sequence of the gene encoding the rice OsERF103 protein is shown in SEQ ID No. 1 (SEQ ID No.1:ATGGTGCCGAGGGTGGAGCGCGGCGGCGGCGGGTTCCATCTCCCCAACAGCGAGCGGGAGGACTCGCTGTTCATCCGCGCGCTCATCTCCGTCGTGTCCGGTGACACCACGGTGCCGACGCTGCTGCCGGAGCCGACGATGGCGACCGTGGTTGCCGGTGCGGCTACGTGCGCCAGGTGCGGGGTGGACGGGTGCATCGGCGTGGACTGCGAGGTGGTGGTGTTGGCGGCGGCGGCTGGCTCGAGCTGCAGCGACGAGGAGGATGAGGGGGAGTGCACCACGGGCGCGGTGGCCAGCGGCGGCGTGACGGGCGGCGTGGGCAAGAGGAGGCCGCGGAGGCGGAGCGGCGGCGAGGGGAGCAGGTACAGGGGCGTGCGGCGTCGGCCGTGGGGGAAGTGGGCGGCGGAGATCCGCGACCCGCGCCGCGCCGTCTGCAAGTGGCTCGGCACGTTCGACACCGCCGAGGACGCCGCGCGCGCCTACGACGTCGCCGCGCTCGAGTTCCGCGGCCAGCGCGCCAAGCTCAACTTCCCGGCGTCCACGGCCGCGCAGCAGCCACGTCCACTCCTCCATCACAACCTCCGTGAGAACTGCGGCTCGAACGCGTCGTCGCCGGTGCACGCGCCAGAGCACGCGAGGACGGCGGCGGCGGCGAAGGACCAGGAGATCTGGGACGGCCTACGGGAGATCATGATGCTCGACGACGGCAGCTTCTGGTCCATGCCATGA)。.

[0051] ERFs can specifically bind to GCC-box and / or DRE / CRT elements. It is by regulating the expression of related genes that ERFs participate in plant resistance to biotic and abiotic stresses, such as salt, drought, and cold. Plant responses to stress are regulated by multiple signaling pathways, which can either promote or antagonize each other, thereby achieving a defense response. Currently, the functions of many ERF genes in rice remain unknown, and few studies have examined the role of ERF transcription in rice drought resistance. Furthermore, plant drought resistance involves the involvement of numerous genes, and the discovery and validation of more genes involved in plant drought resistance is crucial for the research and development of drought-tolerant crop varieties. There are no reports on the function of the OsERF103 protein or its encoding gene in regulating rice drought resistance. OsERF genes related to plant drought resistance include, for example, OsERF48, OsERF71, and OsERF101. The protein encoded by the OsERF103 gene provided by the present invention has homologies of 21.48%, 15.45%, and 14.18% with the proteins encoded by the above genes, respectively. Figures 1 to 3 As shown, it can be seen that the protein encoded by the OsERF103 gene provided by the present invention has very low homology with the proteins encoded by genes reported so far. The present invention proposes that the OsERF103 gene can improve the growth state of rice under drought conditions and, therefore, can be used to cultivate transgenic plants that tolerate drought stress.

[0052] For genes whose expression is induced by drought stress, whether they have transcriptional activation activity and what role they play in drought stress response is unknown, and specific experiments are needed to clarify the function of the gene. This study used genetic engineering methods to study the expression characteristics of this gene and the phenotypic changes of mutant strains. The relationship between gene expression changes and crop phenotype and survival rate was analyzed, and it was found that rice plants overexpressing the OsERF103 gene had significantly greater drought tolerance than wild-type controls.

[0053] In another embodiment, the present invention provides a method for cultivating transgenic plants tolerant to drought stress, wherein the expression level of the OsERF103 gene or the activity of the OsERF103 protein in the plant is increased by genetic engineering methods to obtain transgenic plants with improved drought tolerance.

[0054] Under adverse stress, a series of responses will occur in plants, accompanied by many physiological, biochemical and developmental changes. Since plant stress tolerance is a complex trait regulated by multiple genes, clarifying the important genes in the stress resistance process is of great significance for drought tolerance mechanisms and the cultivation of drought-tolerant crops. The present invention illustrates that up-regulation of the OsERF103 gene improves the tolerance of transgenic rice to drought, and the loss of OsERF103 expression reduces the drought tolerance of rice. The OsERF103 protein and its encoding gene can enhance the tolerance of plants to adversity, indicating that the gene has application value in crop drought resistance modification and stable yield. The present invention has important theoretical and practical significance for improving and enhancing rice stress resistance and accelerating the process of stress resistance molecular breeding.

[0055] Definitions of terms used in this invention

[0056] The term "polynucleotide" or "nucleotide" means deoxyribonucleotides, deoxyribonucleosides, ribonucleosides or ribonucleotides, and polymers thereof, in single- or double-stranded form.

[0057] The term "transcription factor" refers to a class of DNA-binding proteins that can specifically bind to cis-acting elements in the promoter region of eukaryotic genes, thereby activating or inhibiting the transcription and expression of downstream genes at a specific time and space.

[0058] In the present invention, the term "identity" or "similarity" refers to sequence similarity to a natural nucleic acid sequence. Identity or similarity can be evaluated with the aid of computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0059] As used herein, the term "expression" or "gene expression" refers to the transcription of a specific gene, genes, or gene construct into structural RNA (rRNA, tRNA) or mRNA, with or without subsequent translation of the RNA into protein. This process includes transcription of DNA and processing of the resulting mRNA product.

[0060] In the present invention, the term "increased expression / overexpression" refers to any form of expression that is increased relative to the original wild-type expression level. Methods for increasing the expression of genes or gene products have been described in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers.

[0061] In the present invention, the terms "increase", "improve" or "enhance" are interchangeable and shall in the applied sense mean at least 3%, 4%, 5%, 6%, 7%, 8%, 9% or 10%, preferably at least 15% or 20%, more preferably 25%, 30%, 35% or 40% more yield and / or growth and / or changes compared to control plants as defined herein.

[0062] In the present invention, the term "transformation" refers to a process by which a heterologous DNA sequence or a vector containing a DNA sequence is introduced into a host cell or organism.

[0063] In the present invention, the term "recombinant expression vector" refers to one or more DNA vectors used to achieve plant transformation; these vectors are often referred to as binary vectors in the art.

[0064] In the present invention, the term "operably linked" refers to a functional connection between two or more elements, and the operably linked elements may be contiguous or non-contiguous.

[0065] In the present invention, the term "host cell" or "recombinant host cell strain" refers to a cell comprising a polynucleotide of the present invention, regardless of the method used to insert the polynucleotide to produce the recombinant host cell. The host cell can be a prokaryotic cell or a eukaryotic cell, and the host cell can also be a monocotyledonous or dicotyledonous plant cell.

[0066] Example 1. Cloning of the OsERF103 gene nucleotide sequence

[0067] RNA was extracted from rice using an Omega plant extraction kit. First-strand cDNA was synthesized using 1 μg of RNA as a template according to the cDNA synthesis kit (Yeasen).

[0068] The complete ORF of OsERF103 was obtained from the website (http: / / rice.plantbiology.msu.edu / expression.shtml), and specific primers were designed: the 5' forward primer was ATGGTGCCGAGGGTGG (5'-3' direction, SEQ ID No. 3); the 3' reverse primer was TCATGGCATGGACCAGAA (5'-3' direction, SEQ ID No. 4) for PCR amplification reaction.

[0069] The PCR reaction system was as follows: 25 μL of 2×Phanta Max Master Mix, 1 μL of each 10 μM forward / reverse primer, 5 μL of template (cDNA), and sterile water was added to make up to 50 μL.

[0070] The PCR reaction procedure was as follows: 36 cycles of pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 20 s, followed by a final extension at 72°C for 5 min. The resulting amplified full-length cDNA sequence of 729 bp for OsERF103 (shown in SEQ ID No. 1) encoding 243 amino acids (shown in SEQ ID No. 2) was obtained.

[0071] Example 2. Construction of OsERF103 gene mutant and overexpression vector

[0072] The CRISPR / Cas9 genome editing system was used to edit the OsERF103 gene in wild-type rice (Nipponbare) to obtain mutant plants.

[0073] (1) The exon sequence of the target gene OsERF103 was analyzed using the CRISPR-GE website (http: / / skl.scau.edu.cn / ), and two specific target sequences were selected: target site 1 (Cas9-1) CGATGGCGACCGTGGTTGC CGG (SEQ ID No. 5) and target site 2 (Cas9-2) GGCGAGGGGAGCAGGTACA GGG (SEQ ID No. 6).

[0074] (2) Specific sgRNA-1 (CGATGGCGACCGTGGTTGC) and sgRNA-2 (GGCGAGGGGAGCAGGTACA) were synthesized, and the gene editing vector psgR-CAS9-Os was digested with BsaI.

[0075] (3) First anneal the primers. The annealing reaction system is:

[0076] Target site 1, 10 μL F(5'-TGTGTG CGATGGCGACCGTGGTTGC -3') + 10 μL R (5'-AAACGCAACCACGGTCGCCATCGCA-3') + 80 μL ddH2O and mix well;

[0077] Target site 2, 10 μL F(5'-TGTGTG GGCGAGGGGAGCAGGTACA -3')+10μL R(5'-AAACTGTACCTGCTCCCCTCGCCCA-3')+80μL ddH2O and mix well.

[0078] After the reaction system was mixed, annealed at 95 °C for 10 min;

[0079] Then, it was connected with the enzyme-digested vector psgR-CAS9-Os. The connection system was as follows: 2 μL annealing product (containing sgRNA) + 2 μL recovered enzyme-digested vector + 0.5 μL 10x T4 buffer + 0.5 μL T4 ligase, and connected at room temperature for 15 minutes to obtain the psgR-CAS9-OsERF103 vector containing the OsERF103-specific target.

[0080] The psgR-CAS9-OsERF103 vector containing the OsERF103-specific target was transformed into the competent Escherichia coli DH5α. The transformation system was as follows: 5 μL of the ligation product was added to the competent Escherichia coli, incubated on ice for 30 minutes, heat-shocked at 42°C for 90 seconds, incubated on ice for 2 minutes, added with 400 μL of antibody-free LB, revived at 37°C for 1 hour, centrifuged at 5000 rpm for 1 minute, most of the supernatant was aspirated, and 100 μL of the liquid was retained for mixing. The mixture was spread on an LB plate (50 mg / L Kan) and cultured at 37°C overnight.

[0081] After the plasmids were extracted from the positive clones, they were sent to the company for sequencing. The psgR-CAS9-OsERF103 plasmid with the correct result was selected and the mutant plants were obtained by infecting rice callus with Agrobacterium.

[0082] To construct Ubi:OsERF103-3FLAG, a full-length PCR product (726 bp) of the target gene, excluding the stop codon, was amplified and purified using the Omega gel extraction kit. The recovered product was then ligated with the HindIII-digested vector Ubi-XX-3FLAG by homologous recombination. The reaction system consisted of 2 μL of linearized vector, 3 μL of insert, 4 μL of 5× Cell Buffer, 2 μL of Exnase II, and a final volume of 20 μL with sterile water. The reaction conditions were 37°C for 30 minutes. The ligation product was transformed into DH5α competent cells and cultured overnight at 37°C (for kanamycin resistance). Positive single clones were isolated the next day for sequencing.

[0083] Example 3. Construction of OsERF103 gene mutants and overexpressing plants

[0084] Wild-type Nipponbare callus was transformed with Agrobacterium.

[0085] The OsERF103 gene mutant vector and plant overexpression vector obtained in Example 2 were transformed into Agrobacterium tumefaciens EHA105. The Agrobacterium-mediated rice genetic transformation system was primarily based on the method reported by Hiei et al. (Agrobacterium-mediated transformation of rice using immature embryos or calliinduce from mature seeds, 2008, Nature protocol. Doi: 10.1038 / nprot.2008.46).

[0086] The expression of the target gene in wild-type and transgenic plants was detected by hygromycin screening and qRT-PCR, and overexpression-positive plants were preliminarily screened; for mutant-positive plants, gDNA of the T0 generation plants needed to be extracted, PCR identified and sequenced.

[0087] Identification of Oserf103 mutants: Genomic DNA from leaves of T0 transgenic plants was extracted and used as a template. Based on the OsERF103 target site information, specific primers F (GATAGCGCGCCAACTTTT; SEQ ID No. 7) and R (CGGAGGTTGTGATGGAGG; SEQ ID No. 8) were designed for PCR amplification. A single, clear amplification product of interest (645 bp in positive plants) was recovered and sent to the company for sequencing to screen for mutant lines. T0 generation plants were continuously self-pollinated to obtain the T2 generation. T2 generation plants were again screened with hygromycin and identified by PCR to identify independent lines that were vector-free and homozygous for the mutation.

[0088] like Figure 4 As shown, four mutant strains were ultimately obtained, named Oserf103-1, Oserf103-2, Oserf103-3, and Oserf103-4. Two mutations occurred at target sequence 1: Oserf103-1, which had an addition of one base (+T), and Oserf103-2, which had a deletion of one base (-T). Two mutations also occurred at target sequence 2: Oserf103-3, which had an addition of one base (+A), and Oserf103-4, which had a deletion of one base (-C). All four mutants resulted in frameshift mutations in the encoded proteins.

[0089] Identification of OsERF103 overexpressing plants: RNA extraction was carried out according to the instructions of the RNA plant extraction kit of Yeasen. RNA was extracted from 14-day-old wild-type and transgenic rice seedlings. 1 μg of RNA was used as a template and the first-strand cDNA was synthesized according to the operating instructions of the cDNA synthesis kit (Yeasen). Specific quantitative PCR primers were designed based on the OsERF103 gene cDNA (F is 5'-ACGTCCACTCCTCCATCACAAC-3', SEQ ID No. 9; R is 5'-AGCATCATGATCTCCCGTAGGC-3', SEQ ID No. 10). The expression of the OsERF103 gene in the wild-type and overexpressing transgenic lines was detected by qRT-PCR. The expression folds of #1, #6, #13, #17, #23 and #29, which were all upregulated and had different folds of upregulation, were selected for the following experiments. Figure 5 As shown, the abscissa represents the selected transgenic lines #1, #6, #13, #17, #23 and #29, and the ordinate represents the expression level of OsERF103.

[0090] Example 4. Functional characterization of OsERF103 mutants and overexpressing plants

[0091] 1. qPCR analysis of OsERF103 mRNA expression during rice drought

[0092] The quantitative PCR primers for the OsERF103 gene in Example 3 were used to detect the transcriptional expression levels of 4-week-old plants at different days after drought treatment and recovery. Figure 6 The results showed that the transcriptional expression level of OsERF103 gradually increased with the process of drought treatment and gradually decreased with the process of rehydration, indicating that OsERF103 responded to drought stress at the transcriptional level.

[0093] 2. Analysis of drought tolerance of OsERF103 mutants and overexpressing plants

[0094] After germination of wild-type (Nipponbare), Oserf103 mutant, and Ubi:OsERF103 seeds at 37°C in the dark, each plant was planted in nutrient soil and then placed in the same plastic pot to ensure consistent water supply. After the plants grew for about 4 weeks, they were subjected to drought treatment for 10 to 14 days (depending on the degree of leaf curling and wilting) and then rewatered. The phenotypes were observed and the survival rate was calculated. The results showed that the Oserf103 mutants all showed drought-sensitive phenotypes, and the survival rate was significantly lower than that of the wild-type ( Figure 7 ); while the overexpressing plants all showed drought-resistant phenotypes, and the survival rate was positively correlated with the up-regulation level of OsERF103 transcripts ( Figure 8These results indicate that OsERF103 is a positive regulator of rice drought response.

[0095] Finally, it should be noted that the scope of protection of the present invention is not limited to the above embodiments. Ordinary technicians in this field should understand that they can still modify the technical solutions described in the above embodiments, or replace some or all of the technical features therein with equivalents; and these modifications or replacements will fall within the scope of protection of the present invention.

Claims

1. A method for cultivating transgenic rice tolerant to drought stress, characterized in that: Improve the rice OsERF103 The expression level of the gene was increased to obtain transgenic rice with improved drought tolerance; The improvement of the rice OsERF103 The method for increasing the expression level of a gene comprises introducing a gene encoding an OsERF103 protein into rice tissues or rice cells; The nucleotide sequence of the gene encoding the rice OsERF103 protein is shown in SEQ ID No.

1.

2. Use of a biomaterial comprising a gene encoding rice OsERF103 protein in improving drought tolerance of rice, wherein: The biological material includes: (A) an expression cassette containing a nucleic acid molecule having a nucleotide sequence as shown in SEQ ID No. 1; (B) Recombinant vector containing the expression cassette described in (A); (C) a recombinant microorganism containing the expression cassette described in (A) or the recombinant vector described in (B); (D) A recombinant cell containing the expression cassette described in (A) or the recombinant vector described in (B).

3. The use according to claim 2, wherein the recombinant vector is rice OsERF103 Gene overexpression vector.

4. The use according to claim 3, characterized in that The overexpression vector contains Ubiquitin promoter or CaMV 35S promoter.

5. The use according to claim 2, characterized in that The recombinant cell includes rice OsERF103 Gene overexpression vector.

6. The use according to any one of claims 2 to 5, characterized in that The application is to over-express the rice OsERF103 protein or its coding gene to improve the drought tolerance of rice.

Images