A heat-resistant α-L-rhamnosidase and its sugar-resistant mutant and application

Abstract

The invention discloses a heat-resistant α-L-rhamnosidase and its sugar-tolerant mutant and application, belonging to the technical field of genetic engineering and enzyme engineering. The invention clones a heat-resistant α-L-rhamnosidase gene from the genome of Dictyoglomus thermophilum DSM 3960, and the nucleotide sequence is shown in SEQ ID NO.1. Compared with the prior art, the α-L-rhamnosidase DthRha provided by the invention has excellent heat resistance, and the heat-resistant α-L-rhamnosidase DthRha is subjected to sugar-tolerant key site mutation, and the obtained novel α-L-rhamnosidase DthRha sugar-tolerant mutant has a sugar tolerance coefficient increased by more than 2.3 times, and the mutant can specifically hydrolyze rhamnose connected by α-1 glycosidic bond at the R2 position of icariin, and can utilize the mutant to efficiently transform icariin to generate icariin I.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering and enzyme engineering, and specifically relates to a heat-resistant alpha-L-rhamnosidase and a sugar-resistant mutant thereof and application thereof. Background Art

[0002] α-L-rhamnosidase (EC 3.2.1.40) is an exoglycoside hydrolase that can specifically hydrolyze a variety of glycosidic bond types. It can hydrolyze many natural plant extracts, such as hesperidin, naringin, choline C, icariin and other glycosides. Its main functions and effects include debittering, flavoring, biotransformation, etc., thereby improving the bioavailability of natural active substances and can be used in food, medicine and other fields.

[0003] Epimedium is a perennial herb of the genus Epimedium of the Berberidaceae family. Its multi-component flavonoid compounds such as icariin, chamotidine C, chamotidine A, and chamotidine B have multiple active functions. Icariin I is a natural chemical component of epimedium. It has the function of promoting human cells to produce interferon-γ, which can significantly improve the body's immunity, and has important application prospects in the prevention and treatment of infectious diseases such as tuberculosis, influenza, hepatitis B, and tumor immunotherapy. In addition, icariin I is an effective ingredient of traditional Chinese medicine, has little toxicity and side effects, and is safe to use. Compared with the structure of icariin I, icariin has an additional rhamnose at the R2 position, and the rhamnose is connected by an α-1-glycosidic bond. If the rhamnose connected by an α-1-glycosidic bond at the R2 position of icariin can be specifically removed, icariin can be converted into icariin I. It can be seen that screening and obtaining the ability to specifically degrade the α-1-glycosidic bond linked to rhamnose is of great significance for the biocatalytic production of icariin and other natural products containing rhamnose linked by α-1-glycosidic bonds. Summary of the invention

[0004] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0005] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0006] One of the purposes of the present invention is to provide a thermostable α-L-rhamnosidase, which is a thermostable α-L-rhamnosidase of the GH72 family cloned from the genome of Dictyoglomusthermophilum DSM 3960. Compared with the prior art, the thermostable α-L-rhamnosidase DthRha has excellent heat resistance, the highest enzyme activity under the conditions of 95°C and pH 6.5, and the enzyme activity remains basically unchanged when kept warm at 80°C for 2h.

[0007] To solve the above technical problems, the present invention provides the following technical solutions: a thermostable α-L-rhamnosidase, the nucleotide sequence encoding the thermostable α-L-rhamnosidase is shown in SEQ ID NO.1; the thermostable α-L-rhamnosidase has the highest enzyme activity under the conditions of 95°C and pH 6.5.

[0008] Another object of the present invention is to provide a sugar-tolerant mutant of the heat-resistant α-L-rhamnosidase as described above, wherein the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the heat-resistant α-L-rhamnosidase with one of serine, histidine and arginine.

[0009] Another object of the present invention is to provide a gene encoding the thermostable α-L-rhamnosidase as described above or the sugar-tolerant mutant as described above.

[0010] As a preferred embodiment of the gene encoding the above-mentioned thermostable α-L-rhamnosidase or the above-mentioned sugar-tolerant mutant of the present invention, wherein: the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with serine, and its nucleotide sequence is shown in SEQ ID NO.3;

[0011] Or, the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with histidine, and its nucleotide sequence is shown in SEQ ID NO.4;

[0012] Alternatively, the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with arginine, and its nucleotide sequence is shown in SEQ ID NO.5.

[0013] Another object of the present invention is to provide a recombinant plasmid comprising the gene sequence as described above.

[0014] Another object of the present invention is to provide a host cell, wherein the host cell contains the recombinant plasmid as described above.

[0015] As a preferred embodiment of the host cell of the present invention, the host cell comprises one of Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum, Pichia pastoris, Saccharomyces cerevisiae, and lactic acid bacteria.

[0016] Another object of the present invention is to provide a recombinant Escherichia coli expressing the above-mentioned thermostable α-L-rhamnosidase or the above-mentioned sugar-tolerant mutant.

[0017] Another object of the present invention is to provide the use of the sugar-tolerant mutant as described above in transforming icariin.

[0018] As a preferred embodiment of the application of the sugar-tolerant mutant of the present invention in the transformation of icariin, icariin is used as a substrate, and the target product is icariin I;

[0019] The addition ratio of substrate to sugar-tolerant mutant is 0.2-5 U of sugar-tolerant mutant per gram of substrate, the reaction temperature is 65-95° C., the pH is 4.5-7.5, and the reaction time is 0.5-4 hours.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention clones a heat-resistant α-L-rhamnosidase gene from the genome of Dictyoglomus thermophilum DSM 3960. Compared with the prior art, the α-L-rhamnosidase DthRha provided by the present invention has excellent heat resistance and has the highest enzyme activity under the conditions of 95° C. and pH 6.5. The enzyme has good heat resistance and its enzyme activity remains basically unchanged after being kept warm at 80° C. for 2 hours. The enzyme is suitable for hydrolysis under high temperature above 70° C. and partial neutral conditions, and has potential application value.

[0022] The heat-resistant α-L-rhamnosidase DthRha is mutated at the key sugar-tolerant site, and the mutant is used to efficiently transform icariin to produce icariin I. The novel α-L-rhamnosidase DthRha sugar-tolerant mutant obtained by the present invention has a sugar tolerance coefficient increased by more than 2.3 times; the mutant can specifically hydrolyze rhamnose connected by an α-1 glycosidic bond at the R2 position of icariin, and has a high optimum action temperature, which is beneficial to improving the solubility of the substrate; the enzymatic conversion is safe and efficient, the enzymatic hydrolysis time is short, and the yield is high. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0024] Figure 1 The electrophoresis diagram of α-L-rhamnosidase DthRha of the present invention;

[0025] Figure 2 The enzymatic properties of the α-L-rhamnosidase DthRha of the present invention; wherein, (a) is the determination of the optimal reaction temperature of the recombinant α-L-rhamnosidase; (b) is the determination of the optimal reaction pH of the recombinant α-L-rhamnosidase; (c) is the determination of the temperature stability of the recombinant α-L-rhamnosidase; (d) is the determination of the pH stability of the recombinant α-L-rhamnosidase;

[0026] Figure 3 The enzymatic properties of the sugar-tolerant mutant of α-L-rhamnosidase DthRha of the present invention; wherein, (a) is the determination of the optimal reaction temperature of the recombinant α-L-rhamnosidase DtRha and its mutants; (b) is the determination of the optimal reaction pH of the recombinant α-L-rhamnosidase DtRha and its mutants;

[0027] Figure 4 A comparison diagram of the sugar tolerance coefficients of the α-L-rhamnosidase DthRha and its sugar-tolerant mutant enzyme of the present invention;

[0028] Figure 5 The present invention compares the ability of the sugar-tolerant mutant enzymes of α-L-rhamnosidase DthRha to convert substrates; wherein (a) is the effect of the mutant enzymes on the conversion rate of substrates containing different bond types; (b) is the effect of different mutant enzymes on the conversion rate of icariin;

[0029] Figure 6 The diagram is a condition optimization diagram for the conversion of icariin by the sugar-tolerant mutant α-L-rhamnosidase DthRha of the present invention; (a) is the effect of pH on the conversion rate in the process of converting icariin by mutant E479S; (b) is the effect of temperature on the conversion rate in the process of converting icariin by mutant E479S; (c) is the effect of the amount of enzyme added on the conversion rate in the process of converting icariin by mutant E479S;

[0030] Figure 7 The HPLC spectrum of the α-L-rhamnosidase DthRha sugar-tolerant mutant before and after converting icariin. DETAILED DESCRIPTION

[0031] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0032] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0033] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0034] Unless otherwise specified, the raw materials used in the examples were purchased commercially.

[0035] The DNA polymerase (Prime STAR HS DNA Polymerase), deoxyribonucleic acid (dNTP), ligase (T 4 DNA ligase), phosphorylase (T 4 Polynucleotide Kinase) and related buffers were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa).

[0036] Example 1: Cloning, expression and enzymatic property determination of α-L-rhamnosidase DthRha gene

[0037] (1) Cloning of α-L-rhamnosidase DthRha gene and construction of expression vector

[0038] The DSM 3960 genome of Dictyoglomus thermophilum purchased from DSMZ (https: / / www.dsmz.de / ) was used as a template, and degenerate primers P1 and P2 (the sequence of P1 is GAAAGCTTTGTGGACGAGAGAATTGTTAAG, and the sequence of P2 is AATCCTTACCAAGTACCATTAAAAACAGGG) were designed according to the amino acid sequence of bacterial α-L-rhamnosidase on NCBI (NCBI No. WP_012548615.1, such as SEQ ID NO. 1) to amplify the DthRha gene fragment as upstream and downstream primers. Ex Taq polymerase (purchased from Takara) was used to prepare 50 μL reaction solution at the recommended ratio for fragment amplification. The PCR reaction conditions were 95°C, 5 min; 35 cycles (95°C, 30 s; 52°C, 30 s; 72°C, 2 min) 20s); 72℃, 10min; the reaction was stopped and kept warm at 4℃. The PCR amplification product was purified by a gel recovery kit. The α-L-rhamnosidase DthRha gene of Dictyoglomus thermophilum DSM 3960 (as shown in SEQ ID NO: 2) was obtained, and the obtained PCR amplification product and pET28a were double-digested with Nco I and Xhol I, respectively. The recovered fragments were connected with the pET-28a vector, and the product was transformed into Escherichia coli E.coli Top10F'. The transformation product was spread on an LB plate and cultured at 37℃ overnight. A single colony was inoculated into LB (kanamycin was added to a final concentration of 50 mg / L) liquid culture medium and cultured for 8 to 10 hours. The plasmid was extracted for sequence determination to obtain the recombinant plasmid pET-28a-DthRha.

[0039] (2) Expression and purification of α-L-rhamnosidase DthRha

[0040] Take 1 μL of the recombinant plasmid pET-28a-DthRha, add it to the competent cells of Escherichia coli BL21 (DE3), mix well and place on ice for 10 minutes, incubate in a 42°C water bath for 2 minutes, then place on ice for 5 minutes, add 1 mL of SOC medium, culture at 37°C for 1 hour, and then spread on an LB plate containing kanamycin (the final concentration of kanamycin is 50 mg / L) to screen out transformants, pick several single colonies and culture them in LB (add kanamycin to a final concentration of 50 mg / L) liquid culture medium for 8 to 10 hours, then take 1 mL of the bacterial solution for sequencing to determine the Escherichia coli BL21 (DE3) strain containing the pET-28a-DthRha recombinant plasmid.

[0041] The recombinant Escherichia coli BL21 (DE3) was streaked on LB plates (the final concentration of kanamycin was 50 mg / L) for activation, cultured at 37°C for 12 h, and inoculated into 50 mL LB liquid culture medium until a single colony grew out. The culture was then shaken at 37°C and 180 rpm for 3-4 h until the OD 600 =0.4-0.6, add IPTG with a final concentration of 0.1mM for induction, and express at 28℃ for 7-8h. At the same time, Escherichia coli BL21 (DE3) containing empty plasmid pET28a was used as a negative control. 1mL of bacterial solution was aspirated and centrifuged at 5000r / min for 3min to collect the bacteria, discard the supernatant, wash the bacteria twice with 1mL PBS buffer, resuspend the bacteria with 500μL PBS, and then perform ultrasonic lysis. The working conditions are: ultrasonic 3s, 5s interval, a total of 50 times. Centrifuge at 12000r / min for 10min, aspirate 15μL supernatant for later use, filter the remaining crude enzyme solution through a 0.22μm filter membrane, and purify it with a Ni affinity column to obtain the purified α-L-rhamnosidase DthRha. Take 15μL of the crude enzyme solution expressed by the empty transformant without the DthRha gene, the crude enzyme solution expressed by the transformant containing the DthRha gene, and the purified α-L-rhamnosidase DthRha, add 15μL of 5×SDS loading buffer, mix well, boil for 5min, and take 10μL of each for SDS-PAGE electrophoresis to identify the expressed protein, such as Figure 1 shown.

[0042] (3) Enzymatic properties of recombinant α-L-rhamnosidase

[0043] 3.1 Enzyme activity determination method

[0044] The reaction system was 100 μL, 20 μL 5 mmol / L p-nitrophenyl α-L-rhamnosidase (pNPR) was added with 75 μL 100 mmol / L citric acid-sodium dihydrogen phosphate buffer (pH 6.5), incubated at 65°C for 5 min, and then 5 μL enzyme solution was added to react for 10 min. After color development, 300 μL 1 mol / L sodium carbonate solution was added to terminate the reaction. The absorbance was measured at 405 nm. The enzyme activity unit (U) is defined as: under the assay conditions, the amount of enzyme used to produce 1 μmol p-nitrophenol per minute is 1 enzyme activity unit. The enzyme activity assay result was 0.92 U / mL.

[0045] 3.2 Determination of the optimal reaction temperature

[0046] The enzyme activity was measured at 5°C intervals within the range of 60-100°C. The buffer was 100 mmol / L citric acid-sodium hydrogen phosphate buffer (pH 6.5). It was found that the optimal reaction temperature of the recombinant α-L-rhamnosidase was 95°C. Figure 2 As shown in a.

[0047] 3.3 Optimal reaction pH

[0048] The enzyme activity was measured at 95°C under different pH conditions (4.0-8.0, 100 mmol / L citric acid-sodium hydrogen phosphate buffer) and it was found that the optimal reaction pH of the recombinant α-L-rhamnosidase was 6.5. Figure 2 As shown in b.

[0049] 3.4 Temperature stability

[0050] The samples were incubated at different temperatures (80°C to 95°C) for 2 h, and the enzyme activity was measured at different time periods. The temperature stability of rhamnosidase DthRha at 80°C was good, and the enzyme activity was still more than 90% after 2 h. Figure 2 As shown in c.

[0051] 3.5 pH stability

[0052] The enzyme activity was measured at different pH values ​​(4.0-8.0, 100 mmol / L citric acid-sodium hydrogen phosphate buffer), 45°C for 4 h, and 95°C, respectively. The α-L-rhamnosidase DthRha still had more than 70% enzyme activity in the citric acid-sodium hydrogen phosphate buffer at pH 5.5-8.0 for 4 h. Figure 2 As shown in d.

[0053] 3.6 Rhamnose tolerance

[0054] In the standard system for measuring enzyme activity of pNPR, L-rhamnose with a final volume concentration of 0mmol / L, 1mmol / L, 5mmol / L, 10mmol / L, 25mmol / L, 50mmol / L, 100mmol / L, 150mmol / L, 200mmol / L, and 250mmol / L was added, and the enzyme activity of the recombinant enzyme DthRha was measured under the optimal reaction conditions. The enzyme activity measured without adding L-rhamnose was set to 100%, and the residual enzyme activity of the recombinant enzyme DthRha in different concentrations of L-rhamnose was calculated to determine the effect of L-rhamnose on the enzyme activity of the recombinant enzyme DthRha, and the L-rhamnose concentration corresponding to the residual 50% enzyme activity was calculated, that is, the glucose tolerance coefficient Ki. The test result was 115.20mmol / L.

[0055] Example 2: Construction of a series of recombinant plasmids carrying mutant genes

[0056] Design of mutation primers: Using bioinformatics analysis and homology modeling, we changed some amino acids in the α-L-rhamnosidase DthtRha molecule and designed mutation points. We used inverse PCR to obtain the mutation sequence, and designed two forward and reverse oligonucleotide sequences for each mutation site. The mutation site selected yeast-preferred codons, and the mutation primers are shown in Table 1.

[0057] Table 1 Primers for site-directed mutagenesis

[0058]

[0059] Using the recombinant plasmid pET-28a-DthRha carrying the DthRha gene constructed in Example 1 as a template, E479R, E479S, E479H, E479M and E479D were further mutated by inverse PCR to obtain recombinant plasmids carrying mutant genes pET-28a-DthRha-479S (carrying E479S mutant gene, SEQ ID NO.3), pET-28a-DthRha-479H (carrying E479H mutant gene, SEQ ID NO.4), pET-28a-DthRha-479R (carrying E479R mutant gene, SEQ ID NO.5), pET-28a-DthRha-479M (carrying E479M mutant gene, SEQ ID NO.6) and pET-28a-DthRha-479D (carrying E479D mutant gene, SEQ ID NO.7).

[0060] The inverse PCR reaction solution (50 μL) is shown in Table 2; the inverse PCR reaction conditions are shown in Table 3.

[0061] Table 2 Reverse PCR reaction solution (50 μL in total)

[0062]

[0063] Table 3 Reverse PCR reaction conditions

[0064]

[0065] The PCR fragment 5' end phosphorylation reaction solution was prepared as shown in Table 4 and reacted at 37°C for 1 hour.

[0066] Table 4 Preparation of phosphorylation reaction solution

[0067]

[0068] After phosphorylation at 37°C, 1 μL T4 ligase was added and ligation was carried out at 16°C for 3 h. Plasmid DNA was transformed, and mutants were selected and identified by sequencing.

[0069] Example 3: Analysis of enzymatic properties of recombinant enzyme mutants

[0070] Enzyme activity determination method: 100μL reaction system, add 75μL 100mmol / L citric acid-sodium hydrogen phosphate buffer (pH 6.5) to 20μL 5mmol / L p-nitrophenyl α-L-rhamnosidase (pNPR), incubate at 55℃ for 5min, then add 5μL enzyme solution for 10min, and add 300μL 1mol / L sodium carbonate solution to terminate the reaction after color development. Measure the absorbance at 405nm. The enzyme activity unit (U) is defined as: under the assay conditions, the amount of enzyme used to produce 1μmol p-nitrophenol per minute is 1 enzyme activity unit.

[0071] (1) Determination of the optimal reaction temperature: The enzyme activity was measured at 5°C intervals within the range of 65-99°C. The buffer was 100 mmol / L citric acid-sodium hydrogen phosphate buffer (pH 6.5). It was found that the optimal reaction temperature of the recombinant α-L-rhamnosidase DtRha and its mutants was 90°C. Figure 3 As shown in a.

[0072] (2) Optimal reaction pH: The enzyme activity was measured at 90°C under different pH conditions (4.5-8.0, 100 mmol / L citric acid-sodium hydrogen phosphate buffer). It was found that the optimal reaction pH of the recombinant α-L-rhamnosidase DtRha and its mutants was 7.0. Figure 3 As shown in b.

[0073] (3) Temperature stability: The enzyme activity was measured at different time periods after incubation at different temperatures (80°C to 95°C) for 2 h. The temperature stability of the mutant enzyme DR-E479S was maintained at the same level as that of the wild-type enzyme DthRha, while the temperature stability of other mutants was reduced to varying degrees.

[0074] (4) pH stability: The enzyme activity was measured at different pH values ​​(4.0-8.0, 100 mmol / L citric acid-disodium hydrogen phosphate buffer), incubated at 45°C for 4 h, and at 95°C. The activity of the mutant enzyme DR-E479S increased with increasing pH. After mutation, the enzyme changed from a weakly acidic enzyme to an alkaline enzyme. The pH stability of other mutants did not change significantly compared with that of the wild-type enzyme DthRha.

[0075] (5) L-rhamnose was added to the standard system for measuring enzyme activity of pNPR at final volume concentrations of 0mmol / L, 1mmol / L, 5mmol / L, 10mmol / L, 25mmol / L, 50mmol / L, 100mmol / L, 150mmol / L, 200mmol / L, and 250mmol / L, and the enzyme activities of the recombinant enzyme DthRha and its mutants were measured under the optimal reaction conditions. The enzyme activity measured without the addition of L-rhamnose was set as 100%, and the residual enzyme activities of the recombinant enzyme DthRha and its mutants in the presence of different concentrations of L-rhamnose were calculated to determine the effect of L-rhamnose on the enzyme activities of the recombinant enzyme DthRha and the mutants. The L-rhamnose concentration corresponding to the residual 50% enzyme activity was calculated, and its sugar tolerance coefficient was increased by more than 2.3 times.

[0076] The rhamnose tolerance of each mutant enzyme was measured and compared. Figure 4 As shown in the figure, the tolerance of mutant enzymes E479S / E479H / E479R at the amino acid position 479 to rhamnose is improved compared with the wild enzyme. Among them, the rhamnose tolerance of mutant enzyme E479S is the most obvious. When the rhamnose content is added to 200mmol / L, the residual enzyme activity of mutant enzyme DR-E479S is maintained at more than about 80%, while the residual enzyme activity of wild enzyme is less than 40% at this time.

[0077] Example 4: Process for converting icariin using recombinant α-L-rhamnosidase DthRha mutant E479S

[0078] (1) Under the same conditions, the conversion rates of the mutant enzymes on substrates containing different bond types were determined. The side chain of epimedin C contains an α-1,2-rhamnosidic bond connecting two rhamnose sugars and an α-1-rhamnosidic bond directly connected to the aglycone; icariin only contains an α-1-rhamnosidic bond directly connected to the aglycone; hesperidin contains an α-1,6-rhamnosidic bond connecting rhamnose and glucose; and naringin contains an α-1,2-rhamnosidic bond connecting rhamnose and glucose.

[0079] The transformation system was as follows: reaction temperature was 80°C, pH was 5.5, the concentration of substrate (epimedin C, icariin, hesperidin, naringin) was 5 g / L, 5 U / mL of recombinant α-L-rhamnosidase DthRha mutant E479S was added, the reaction was carried out at 45°C for 2 hours, and then 300 μL of methanol was added to terminate the reaction. The sample was passed through a membrane and then detected by HPLC.

[0080] Summarize the results of the measurement, such as Figure 5As shown in Figure a, the mutant enzyme E479S can only convert icariin. Under the same conditions, the conversion rate of icariin by the enzyme is 39.33%. That is, after the Glu at position 479 is mutated to Ser, DthRha, which can originally remove the α-1,2-rhamnosidic bond connecting two rhamnoses and the α-1-rhamnosidic bond directly connected to the aglycone, only has the catalytic ability to remove the α-1-rhamnosidic bond directly connected to the aglycone, and loses the ability to remove the α-1,2-rhamnosidic bond connecting two rhamnoses. The mutant enzyme also has no catalytic ability for naringin containing the α-1,2-rhamnosidic bond connecting rhamnose and glucose. Therefore, it can be concluded that the E479 site is the key site related to the bond-type substrate specificity of α-L-rhamnosidase. In addition to exercising the catalytic function, the E479 site is also related to the recognition of the bond type.

[0081] (2) The conversion rate of icariin by different mutant enzymes was determined under the same conditions. The conversion system was as follows: 5 g / L icariin was used as the substrate, 5 U / mL of wild α-L-rhamnosidase DthRha and its sugar-tolerant mutants (E479R, E479S, E479H, E479M, E479D) were added and placed in a 80°C water bath, reacted for 2 hours in a citric acid-sodium dihydrogen phosphate buffer (50 mmol / L) at pH 5.5, and then terminated by ice-water cold bath treatment. Then, ethanol was added to a final concentration of 60%, shaken at room temperature, the supernatant was taken, samples were prepared, and detected by HPLC. The test results are as follows: Figure 5 As shown in b, the conversion rates of icariin by α-L-rhamnosidase DthRha and its sugar-tolerant mutant were 56.3% (DthRha), 77.3% (E479R), 80.0% (E479S), 65.8% (E479H), 73.6% (E479M) and 76.9% (E479D), respectively.

[0082] (3) Optimization of transformation system conditions

[0083] Effect of pH on conversion rate: 5 g / L icariin was used as substrate, 5 U / mL α-L-rhamnosidase DthRha sugar-tolerant mutant E479S was added and placed in a 80°C water bath, and reacted for 2 h under citric acid-sodium dihydrogen phosphate buffer (50 mmol / L) with pH values ​​of 4.0, 4.5, 5.0, 5.5, 6.0, 6.7, 7.0 and 7.5, respectively. The reaction was then terminated by ice-water cooling, and then 60% ethanol was added to the mixture, shaken at room temperature, the supernatant was taken, and the sample was prepared. The optimal conversion pH was determined to be 5.5 ( Figure 6 a).

[0084] Effect of temperature on conversion rate: 5 g / L icariin was used as substrate, 5 U / mL α-L-rhamnosidase DthRha sugar-tolerant mutant E479S was added and placed in citric acid-sodium dihydrogen phosphate buffer (50 mmol / L) with a pH of 5.5, and different temperatures were set at 75°C, 80°C, 85°C, 90°C and 95°C for 2 h, followed by ice-water cold bath treatment to terminate the reaction, followed by addition of 60% ethanol at a final concentration, shaking at room temperature, taking the supernatant, preparing samples, and determining the optimal conversion temperature to be 80°C ( Figure 6 b).

[0085] Effect of enzyme dosage on conversion rate: 5 g / L icariin was used as substrate, and different α-L-rhamnosidase DthRha sugar-tolerant mutant E479S (enzyme dosage was 1.0, 2.5, 5.0, 10.0 and 25.0 U / mL) were added to a citric acid-sodium dihydrogen phosphate buffer (50 mmol / L) at pH 5.5, and reacted at 80°C for 2 h. The reaction was then terminated by ice-water cold bath treatment, and then 60% ethanol was added to the final concentration, shaken at room temperature, the supernatant was taken, and the sample was prepared. The optimal enzyme dosage was determined to be 5.0 U / mL ( Figure 6 c).

[0086] The test results show that the recombinant α-L-rhamnosidase DthRha mutant E479S was used to transform icariin. The transformation system was: reaction temperature 80°C, pH 5.5, icariin substrate concentration 5g / L, 5U / mL α-L-rhamnosidase DthRha sugar-tolerant mutant E479S was added for 2h, and the transformation efficiency was 80%; the HPLC spectra of α-L-rhamnosidase DthRha sugar-tolerant mutant E479S before and after transformation of icariin are shown in Figure 2. Figure 7 shown.

[0087] So far, the crystal structures of α-L-rhamnosidase from six sources have been solved, namely, α-L-rhamnosidase from Dictyoglumus thermophilum, Aspergilus terreus, Klebsiela oxytoca, Streptomycesavermitilis, Bacteroides thetaiotaomicron, and Bacilus sp.GL1, and their IDs in the PDB database are 6I60 (DthRha), 6GSZ, 4XHC, 3W5M, 3CIH (BtRha), and 2OKX, respectively. Icariin, which only contains α-1-rhamnosidic bonds, was docked with DthRha to prepare for the subsequent work on the substrate specificity-related mechanism of α-L-rhamnosidase DthRha from D. thermophilum. After docking the icariin molecule with DthRha, the key amino acid residues for the interaction between the enzyme protein and the substrate were obtained, which are Asp473, Arg477, Glu479 and Glu782. Among them, E479 is a catalytic amino acid predicted to play a core role in acid-base catalysis. Theoretically, when the properties of this amino acid are changed, it should show a state of no enzyme activity, but after the acidic amino acid of E479 mutated to serine (polar uncharged amino acid), it showed catalytic activity for the artificial substrate pNPR. After E479 mutated to alkaline arginine, the specific enzyme activity was 14.00U / mg, while the core catalytic amino acid E782 mutated to arginine but had no activity. It can be seen that in addition to exercising catalytic function, E479 may also be related to substrate bond type recognition.

[0088] The present invention clones a heat-resistant α-L-rhamnosidase gene from the genome of Dictyoglomus thermophilum DSM 3960. Compared with the prior art, the α-L-rhamnosidase DthRha provided by the present invention has excellent heat resistance and has the highest enzyme activity under the conditions of 95° C. and pH 6.5. The enzyme has good heat resistance and its enzyme activity remains basically unchanged after being kept warm at 80° C. for 2 hours. The enzyme is suitable for hydrolysis under high temperature above 70° C. and partial neutral conditions, and has potential application value.

[0089] The present invention mutates E479 of DthRha to S, H and R, and its sugar tolerance efficiency is increased by more than 2.3 times. The mutation site of 479 is the key site of sugar tolerance and the recognition site of the bond type of α-L-rhamnosidase DthRha, which can provide a theoretical basis for the analysis of the key site of sugar tolerance of GH72 family α-L-rhamnosidase.

[0090] The invention establishes a method for converting icariin into icariin I by means of biological enzyme hydrolysis, and the conversion efficiency is high, reaching 80% under suitable conditions.

[0091] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the claims of the present invention.

Claims

1. A sugar-tolerant mutant of a thermostable α-L-rhamnosidase, characterized in that: The sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with one of serine, histidine and arginine; Wherein, the amino acid sequence of the heat-resistant α-L-rhamnosidase is shown as SEQ ID NO.

1.

2. A gene encoding the sugar-tolerant mutant according to claim 1.

3. The gene according to claim 2, characterized in that: The sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with serine, and the nucleotide sequence encoding the sugar-tolerant mutant is shown in SEQ ID NO.3; Or, the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with histidine, and the nucleotide sequence encoding the sugar-tolerant mutant is shown in SEQ ID NO.4; Alternatively, the sugar-tolerant mutant is obtained by replacing the glutamic acid at position 479 of the amino acid sequence of the thermostable α-L-rhamnosidase with arginine, and the nucleotide sequence encoding the sugar-tolerant mutant is shown in SEQ ID NO.

5.

4. A recombinant plasmid, characterized in that: The recombinant plasmid comprises the gene according to claim 2 or 3.

5. A host cell, characterized in that: The host cell contains the recombinant plasmid according to claim 4.

6. The host cell according to claim 5, characterized in that: The host cell includes one of Escherichia coli, Bacillus subtilis, Corynebacterium glutamicum, Pichia pastoris, Saccharomyces cerevisiae, and lactic acid bacteria.

7. A recombinant Escherichia coli expressing the sugar-tolerant mutant according to claim 1.

8. Use of the sugar-tolerant mutant according to claim 1 in transforming icariin.

9. The use according to claim 8, characterized in that: With icariin as substrate, the target product is icariin I; The addition ratio of substrate to sugar-tolerant mutant is 0.2-5 U of sugar-tolerant mutant per gram of substrate, the reaction temperature is 65-95°C, the pH is 4.5-7.5, and the reaction time is 0.5-4 h.

10. The use according to claim 9, characterized in that: The addition ratio of substrate to sugar-tolerant mutant was 5 U of sugar-tolerant mutant per gram of substrate, the reaction temperature was 80°C, the pH was 5.5, and the reaction time was 2 h.

Images