Application of CircCDPK6 gene in regulating plant drought tolerance

Abstract

The present invention discloses the application of CircCDPK6 gene in regulating plant drought tolerance, belonging to the field of biotechnology. The sequence of the CircCDPK6 gene is shown in SEQ ID NO.1. The present invention constructs CircCDPK6RNAi transgenic corn strains and CircCDPK6OE transgenic Arabidopsis plants, conducts functional studies on the CircCDPK6 gene, and reveals that when the expression of CircCDPK6 is inhibited, the drought tolerance of corn is weakened; increasing the expression of CircCDPK6 enhances the drought tolerance of Arabidopsis plants. The present invention provides gene resources for drought-resistant breeding and genetic improvement of corn and other plants.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of CircCDPK6 gene in regulating plant drought tolerance. Background Art

[0002] Corn (Zea mays spp. mays L.) is one of the most important multi-purpose crops for food, cash and feed in the world. Drought is one of the main abiotic factors that cause crop yield reduction. For corn, seasonal drought stress before and after sowing, tasseling and silking is particularly serious. Therefore, exploring drought-tolerant and high-yield corn gene resources and cultivating new green varieties with high yield and resistance are the top priorities for improving scientific and technological innovation in the corn seed industry, developing green modern agriculture, and ensuring national food security.

[0003] In recent years, researchers have discovered and cloned a number of key genes for plant response to drought stress. These studies can partially explain the physiological and regulatory mechanisms of maize under drought stress. However, due to the complexity of drought resistance traits and the significant interaction between genes and the environment, there are few genes that can be directly used to guide the stress resistance breeding and production practice of food crops, which limits the research on crop drought resistance breeding. In addition, most of the genes reported so far are protein-coding genes, and little is known about the function of a "newly discovered" circular RNA (Circular RNAs, CircRNAs) that is significantly associated with stress response in plant (especially maize) drought resistance. CircRNAs are a special type of circular RNA. Unlike traditional linear RNA, it is a single-stranded closed RNA formed by circularizing exons or introns by reverse splicing. Except for the circular junction sequence, other sequences are consistent with linear transcripts. CircRNAs do not have a 5' end cap and a 3' end polyA tail. The 5' and 3' ends are connected to form a complete circular structure, which avoids degradation by nuclease exonucleases. Therefore, it is more stable and conservative than linear RNA and more suitable as a molecular marker. Many protein-coding genes in higher eukaryotes can generate CircRNAs through reverse splicing of pre-mRNA. As important regulatory molecules, CircRNAs have multiple functions, mainly including: ① As miRNA molecular sponges, they play a regulatory role at the post-transcriptional level. CircRNAs contain a large number of miRNA binding sites, which bind to miRNA in cells, relieve the inhibition of miRNA on target genes, and thus achieve regulation of downstream genes; ② Coding function. Although CircRNAs are non-coding RNAs, some CircRNAs can also encode functional proteins to play a regulatory role; ③ Function by interacting with proteins. CircRNAs bind to RNA-binding proteins RBPs (RNA binding proteins), and then bind to RNA / DNA as a scaffold, providing a platform for RBPs and RNA / DNA interactions. For example, CircRNAs can interact with AGO protein and RNA polymerase II (RNAPolⅡ), and participate in the transcriptional regulation process as a molecular sponge for miRNA or functional protein; ④ Regulate the expression of parental genes (host gene). CircRNAs and their hosts are mostly reported to show a positive correlation. CircRNAs can promote host gene expression through the CircRNAs-miRNA-mRNA mode. On the other hand, CircRNAs can interact with RNAPolⅡ and regulate the transcriptional activity of the host through the cis action mode.

[0004] Research on circRNAs has mainly focused on the development of the mammalian nervous system, cardiovascular diseases, and malignant tumors. Recent studies have shown that circRNAs are also widely distributed in plants, such as Arabidopsis, rice, wheat, and corn. These studies only identified and found that the expression of circRNAs was related to tissue development specificity and stress response through high-throughput omics sequencing technology, and did not conduct in-depth research on the specific functions and regulatory mechanisms of circRNAs. There are only two reports on the functions of circRNAs in plants. One confirmed that the expression of Arabidopsis circRNA SEPALLATA3 would cause the expression of the transcript SEP3.3 formed by the corresponding exon skipping to decrease, thereby causing plant flower phenotypic variation. Another study found that the expression level of circRNAs from encoding calcium-dependent protein kinases and cytokinin oxidases / dehydrogenases was significantly correlated with the drought tolerance of corn seedlings. However, the specific functions and mechanisms of circRNAs in corn drought tolerance have not been reported. Corn leaves are the main organs for transpiration, and roots are the main organs for plants to absorb water and nutrients. The number of stomata on leaves, stomatal aperture, root length, root tip number, and root surface area are important evaluation indicators of plant drought resistance. Therefore, focusing on the mining of excellent gene resources such as CircRNAs related to maize leaf stomatal and root development and analyzing their biological functions and regulatory mechanisms is of great significance for enriching crop stress resistance gene resources. Summary of the invention

[0005] The purpose of the present invention is to provide an application of the CircCDPK6 gene in regulating plant drought tolerance to solve the problems existing in the above-mentioned prior art. The present invention reveals that when the expression of CircCDPK6 is inhibited, the drought tolerance of corn is weakened; increasing the expression of CircCDPK6 enhances the drought tolerance of Arabidopsis plants, providing gene resources for drought-resistant breeding and genetic improvement of corn and other plants.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a maize CircCDPK6 gene, and the sequence of the CircCDPK6 gene is shown in SEQ ID NO.1.

[0008] The present invention also provides biological materials related to the CircCDPK6 gene, which include vectors for overexpressing or knocking out the CircCDPK6 gene, and recombinant bacteria or transgenic plant strains containing the vectors.

[0009] The present invention also provides the use of the CircCDPK6 gene or the biological material in regulating plant drought tolerance.

[0010] Furthermore, by reducing the expression level of the CircCDPK6 gene, the drought resistance of the plant is reduced; by increasing the expression level of the CircCDPK6 gene, the drought resistance of the plant is improved.

[0011] Furthermore, the plants include corn and Arabidopsis thaliana.

[0012] The present invention also provides the use of the CircCDPK6 gene or related biological materials in regulating corn yield, leaf stomata number, taproot length or root number. The related biological materials include a vector that reduces the expression level of the CircCDPK6 gene, a recombinant bacterium containing the vector, or a transgenic plant strain.

[0013] Furthermore, the regulation includes reducing the expression level of the CircCDPK6 gene, thereby reducing the yield, number of leaf stomata, main root length or number of roots of corn; the yield includes ear weight, grain weight and fruit setting rate.

[0014] The present invention also provides a method for regulating corn yield, leaf stomata number, taproot length or root number, comprising reducing the expression level of the CircCDPK6 gene in corn, thereby obtaining transgenic corn with reduced yield, leaf stomata number, taproot length or root number; the sequence of the CircCDPK6 gene is shown in SEQ ID NO.1.

[0015] Furthermore, the yield includes ear weight, grain weight and fruit setting rate.

[0016] The present invention also provides the use of the CircCDPK6 gene or related biological materials in promoting the root growth of Arabidopsis thaliana or reducing the water loss rate of Arabidopsis thaliana leaves. The related biological materials include a vector overexpressing the CircCDPK6 gene, a recombinant bacterium containing the vector, or a transgenic plant strain.

[0017] The present invention also provides a method for promoting the root growth of Arabidopsis thaliana or reducing the water loss rate of Arabidopsis thaliana leaves, comprising transferring the CircCDPK6 gene into Arabidopsis thaliana and then overexpressing it, so that the transgenic Arabidopsis thaliana has increased root length or reduced leaf water loss rate; the sequence of the CircCDPK6 gene is shown in SEQ ID NO.1.

[0018] The present invention discloses the following technical effects:

[0019] The present invention constructs an RNAi vector of the maize circular RNA CircCDPK6 gene to obtain a CircCDPK6 RNAi transgenic maize strain; in addition, a CircCDPK6 overexpression vector is constructed to obtain a CircCDPK6 OE transgenic Arabidopsis plant, and the function of the CircCDPK6 gene is studied, revealing that when the expression of CircCDPK6 is inhibited, the drought resistance of maize is weakened; increasing the expression of CircCDPK6 enhances the drought resistance of Arabidopsis plants.

[0020] The present invention shows through experiments that compared with wild-type corn, the number of leaf stomata of CircCDPK6 RNAi transgenic corn lines under normal or drought stress conditions is significantly increased, the main root is shortened, the root system in the adult stage is shorter and sparser, and the ear weight and grain weight are significantly reduced; compared with wild-type Arabidopsis, the water loss rate of detached leaves of CircCDPK6 OE transgenic Arabidopsis plants under normal or drought conditions is significantly reduced, and the main root length is significantly lengthened.

[0021] The invention provides gene resources for drought-resistant breeding and genetic improvement of corn and other plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0023] Figure 1 Screening and validation analysis of CircCDPK6; A: Modules closely related to seedling survival rate under drought stress with CircCDPK6 and ZmCDPK6 as the core; B: Divergent primer design diagram for CircCDPK6 expression validation; C: Electrophoresis diagram of CircCDPK6 amplified by PCR using random primers (Random) and cDNA reverse transcribed by Oligo dt primers as templates, M, DL5000 Marker; D: RT-qPCR detection of CircCDPK6 expression using cDNA reverse transcribed by random primers and Oligo dt primers as templates;

[0024] Figure 2Phenotypic analysis of leaves of CircCDPK6 RNAi transgenic maize plants; A: Detection of CircCDPK6 expression in CircCDPK6 RNAi transgenic maize plants; B: Growth conditions of wild-type and transgenic plants under normal hydroponic and PEG-simulated drought stress conditions, WW: water well, i.e. normal hydroponic, WS: water stress, i.e. drought stress, scale bar = 10 cm; C: Statistical analysis of water loss rate of detached leaves of wild-type and transgenic plants, with 6 biological replicates for each material; D: Microscopic observation of the number of stomata in leaves of wild-type and transgenic plants, scale bar = 10 μm; E: Statistical analysis of the number of stomata in leaves of wild-type and transgenic plants, with at least 3 biological replicates for each material; C-Ri1: CircCDPK6 RNAi transgenic maize line 1, C-Ri2: CircCDPK6 RNAi transgenic maize line 2, Col: wild-type maize plant KN5585, *** represents P < 0.001, ** represents P < 0.01;

[0025] Figure 3 This is the root phenotype analysis of CircCDPK6RNAi transgenic maize plants at the seedling stage; A: root growth status of wild-type and CircCDPK6RNAi transgenic plants under normal hydroponic and PEG-simulated drought stress conditions, WW: waterwell, i.e. normal hydroponic, WS: water stress, i.e., drought stress, scale bar = 10 cm; B: Statistical analysis of the taproot length of wild-type and CircCDPK6RNAi transgenic plants under normal hydroponic and PEG-simulated drought stress conditions, with at least 3 biological replicates for each material; C: Microscopic observation of the phenotype of cells in the taproot elongation zone of wild-type and CircCDPK6RNAi transgenic plants, scale bar = 10 μm; D: Statistical analysis of the length of cells in the taproot elongation zone of wild-type and CircCDPK6RNAi transgenic plants, with at least 3 biological replicates for each material, C-Ri1: CircCDPK6RNAi transgenic maize line 1, C-Ri2: CircCDPK6RNAi transgenic maize line 2, Col: wild-type maize plant KN5585, ** represents P < 0.01, * represents P < 0.05;

[0026] Figure 4Analysis of root phenotype and yield traits of CircCDPK6 RNAi transgenic maize plants at adult stage; A: root growth of wild-type and CircCDPK6 RNAi transgenic plants at adult stage under normal and drought stress conditions, WW: water well, i.e. normal hydroponics, WS: water stress, i.e. drought stress; B: analysis of seed setting rate of wild-type and CircCDPK6 RNAi transgenic plants under normal drought stress conditions; C: statistical analysis of single ear weight of wild-type and CircCDPK6 RNAi transgenic plants, with at least 3 biological replicates for each material; D: statistical analysis of ear grain weight of wild-type and CircCDPK6 RNAi transgenic plants, with at least 3 biological replicates for each material; C-Ri1: CircCDPK6 RNAi transgenic maize line 1, C-Ri2: CircCDPK6 RNAi transgenic maize line 2, Col: wild-type maize plant KN5585, ** represents P < 0.01;

[0027] Figure 5 Phenotypic analysis of drought tolerance of CircCDPK6OE transgenic Arabidopsis plants at the seedling stage; A: Analysis of water loss rate of detached leaves of wild-type and CircCDPK6 OE transgenic plants under ABA (20 μM) simulated drought stress conditions; B: Observation and statistical analysis of taproot length phenotype of wild-type and CircCDPK6 OE transgenic plants under normal hydroponic conditions; C: Observation and statistical analysis of taproot length phenotype of wild-type and CircCDPK6 OE transgenic plants under ABA (20 μM) treatment conditions; D: Observation and statistical analysis of taproot length phenotype of wild-type and CircCDPK6 OE transgenic plants under Mannitol (150 mM) treatment conditions; Each material had at least 3 biological replicates, C-OE1: CircCDPK6 OE transgenic Arabidopsis line 1, C-OE2: CircCDPK6 OE transgenic Arabidopsis line 2, Col: wild-type Arabidopsis plants, ** represents P < 0.01, * represents P < 0.05. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The maize drought-tolerant inbred line P1 (AC7643) and maize drought-sensitive inbred line P2 (AC7729 / TZSRW) used in the embodiments of the present invention were provided by the International Maize and Wheat Improvement Center (CIMMYT) and preserved by Sichuan Agricultural University; 220 RILs materials constructed from the maize drought-tolerant inbred line P1 (AC7643) and the maize drought-sensitive inbred line P2 (AC7729 / TZSRW) were completed and preserved by Sichuan Agricultural University; maize inbred line KN5585 and Arabidopsis seeds were provided and preserved by Sichuan Agricultural University;

[0034] Example 1 Screening and verification analysis of maize gene CircCDPK6

[0035] 1. Screening of CircCDPK6

[0036] The inventors previously identified the drought tolerance of 220 recombinant inbred lines (RILs) constructed from the strong drought-tolerant inbred line AC7643 and the drought-sensitive inbred line AC7729 / TZSRW, and screened out 7 recombinant inbred lines each with strong drought tolerance and drought-sensitive recombinant inbred lines. Together with the parents of the RILs population, they were used for seedling root full transcriptome and CircRNAs enrichment sequencing analysis after normal irrigation and drought stress. A corn root drought stress response gene co-expression network was constructed by WGCNA analysis, which contained 159 modules. The phenotypic variation under drought stress was brought into each module for significance analysis, and a module including 4,300 linear genes, 755 CircRNAs, and 24 miRNAs that was closely related to the survival rate of seedling plants under drought stress was screened out. It was found that CircCDPK6 and its parent gene ZmCDPK6 were located at the central node of the module, which may play an important role in corn drought tolerance ( Figure 1 A).

[0037] 2. Validation of CircCDPK6

[0038] Specific primers CircCDPK6-F: 5'-TGCTCTGCCCTTGTCCTT-3' (SEQ ID NO. 3) and CircCDPK6-R: 5'-GAAAACCTGACCTGCAGTT-3' (SEQ ID NO. 4) were designed at the CircCDPK6 junction site ( Figure 1 F and R in B), CircCDPK6 was amplified in the parents and progeny of the RILs population using cDNA reverse transcribed with random primers and Oligo dt primers as templates, and the amplified products were sequenced by Sanger sequencing to detect the circular structure.

[0039] The reaction system for PCR amplification was: 10 μL of 2×Rapidtaq Master PCRmix, 0.5 μL of upstream and downstream primers, 1 μL of DNA template, and 8 μL of double distilled water to make up to 20 μL.

[0040] The reaction procedure of PCR amplification was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s, for a total of 30 cycles; and incubation at 72°C for 5 min.

[0041] The amplified PCR products were electrophoresed with 1% agarose gel and sent to Shanghai Bioengineering for sequencing. The results showed that CircCDPK6 expression could only be detected in the cDNA template reverse transcribed by random primers, which is consistent with the characteristic that CircRNA has no polyA tail, indicating that CircCDPK6 does exist ( Figure 1The sequencing results showed that CircCDPK6 was formed by the cyclization of exron2-intron2-extron3 of ZmCDPK6 (MaizeGDB gene number: GRMZM2G032852) pre-mRNA, and the specific sequence is shown in SEQ ID NO.1.

[0042] SEQ ID NO.1:

[0043] GTCAGTTTTCACTGAGCTGGTTGGAAGTCCATACTACGTTGCTCCTGAGGTACTACACAAACGGTATGGACCAGAAGCGGATGTGTGGTCAGCTGGAGTGATACTGTATGTTTTGCTTAGTGGGGTGCCACCTTTTTGGGCAGAGACG CAACAAGGTATATTTGATGCTGTCTTGAAGGGGGCACATTGATTTTGACTCGGACCCATGGCCTAAGATATCTGAAAGCGCAAAGAATCTCATAAGGAAGATGCTCTGCCCTTGTCCTTCAGAGCGTCTGAAAGCCCATGAAGTACTAC.

[0044] Example 2 Acquisition and identification of CircCDPK6 RNAi transgenic corn plants

[0045] The pRS300 vector was used to construct a CircCDPK6 RNAi vector targeting the CircCDPK6 reverse splicing junction site. The specific junction target sequence was: ACACTAGTCTCTAACACTAAGCATTGTACTG TCTCATTGATCTGAGATTCATACGATTCTTTACTTCGGTAGTGATTCTGCTTATTATACGGAATATGGTGACTAAATAAGTTACAGTGTGCTTATGCGCCTATGCCCCTGTTCGCAAAGCTTATTGTTGCTTATCAGACTCAGTACATATCGATCAATTTTGTGTTTTTTGAGATTTCTGATGGGTTTATGGATTAAACCTTAATTTATTTTTATATTCAAAACTGCAG (SEQ ID NO.2).

[0046] After the vector was successfully constructed, Weimi Biotechnology (Jiangsu) Co., Ltd. used wild-type corn KN5585 for genetic transformation to obtain the corresponding T0 generation transgenic seeds. The T0 generation transgenic seeds were planted in the field and self-pollinated to obtain T1 generation seeds.

[0047] The T1 generation seeds were planted in the field, and the leaves and roots of the transgenic plants were collected at the three-leaf and one-heart stage, and RNA was extracted and reverse transcribed using random primers in the HiScript III 1st strand cDNAsynthesis kit (+gDNAwiper) reverse transcription kit. Fluorescent quantitative qPCR primers located near the CircCDPK6 reverse splicing junction site and the gene target were designed (same as the CircCDPK6 fragment amplification primers, SEQ ID NO.3-4) to detect the expression of the CircCDPK6 gene in transgenic plants.

[0048] The reaction system for qPCR amplification was: 10 μL of ChamQ SYBR qPCR Master Mix (High ROX Premixed) (Novozymes), 0.5 μL of upstream and downstream primers, 1 μL of DNA template, and 8 μL of double distilled water to make up to 20 μL.

[0049] The reaction procedure of qPCR amplification was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 56°C for 15 s, and extension at 72°C for 15 s, for a total of 40 cycles; and incubation at 72°C for 5 min.

[0050] The expression results of CircCDPK6 in transgenic plants were compared with those of the wild type (KN5585), and two transgenic lines C-Ri1 and C-Ri2 with different degrees of decreased CircCDPK6 expression were successfully identified (the expression of ZmCDPK6 did not change significantly). Figure 2 As shown in A.

[0051] Example 3 Analysis of drought tolerance phenotype of CircCDPK6 RNAi transgenic corn plants at the seedling stage

[0052] The harvested T2 generation seeds of CircCDPK6RNAi transgenic corn plants were germinated at 28°C, and seeds with consistent germination rates were selected for hydroponic culture. When they grew to the three-leaf stage, some of the materials continued to grow in normal nutrient solution as a control, and some of the materials were cultured in a nutrient solution supplemented with 20% PEG to simulate drought stress. When the phenotype appeared (approximately when they grew to the five-leaf stage), photos were taken, roots were scanned, and phenotypic data were measured to observe the differences between CircCDPK6RNAi transgenic corn plants and wild-type materials.

[0053] Phenotypic results showed that under normal conditions, there was no significant difference in growth between transgenic plants and wild-type plants. However, under drought stress, the survival rate of CircCDPK6RNAi transgenic maize plants was significantly reduced compared with the wild-type ( Figure 2 B). The water loss rate of the detached leaves was measured and it was found that the water loss rate of the detached leaves of the transgenic corn plants increased significantly under drought stress compared with the wild type ( Figure 2 C).

[0054] Usually, the water loss rate of detached plant leaves is related to stomatal development, so the inventors also detected the number of stomata in the leaves of CircCDPK6RNAi transgenic corn plants. The results showed that compared with the wild type, the number of stomata in CircCDPK6RNAi transgenic corn plants increased significantly under drought stress ( Figure 2 Based on the above experimental results, it is concluded that when encountering drought stress, CircCDPK6 can control the water loss rate of leaves by regulating the development of stomata, thereby improving the drought tolerance of corn plants.

[0055] In order to further analyze the root phenotype of transgenic plants, the harvested T2 seeds of CircCDPK6RNAi transgenic corn plants were germinated at 28°C, and seeds with consistent germination rates were selected for hydroponic culture. They were cultured in nutrient solution until they had three leaves and one heart. Some materials were still grown in normal nutrient solution as a control, and some materials were cultured in nutrient solution with 20% PEG added to simulate drought stress. When the phenotype appeared (about five leaves), photos were taken, roots were scanned, and phenotypic data were measured. The results showed that under normal conditions and drought stress, the taproot length of the CircCDPK6 transgenic lines was significantly shortened compared with the wild type ( Figure 3 AB). Observation of the main root tissue sections of the transgenic lines revealed that under drought stress, the length of the root cells in the elongation zone of the CircCDPK6RNAi transgenic lines was significantly shortened compared with the wild type ( Figure 3 CD), which may be the reason for the shortening of the taproot length.

[0056] Example 4 Analysis of drought tolerance phenotype of CircCDPK6 RNAi transgenic corn plants at adult stage

[0057] CircCDPK6RNAi transgenic plants and wild-type plants were planted in Hainan and Sichuan, respectively, to investigate drought tolerance of mature plants in the dry season. The roots of CircCDPK6RNAi transgenic plants and wild-type plants were dug out from the field, cleaned with running water, and the root system of maize was observed. It was found that compared with wild-type materials, the root system of transgenic maize materials was shorter and sparser, mainly manifested in fewer lateral roots ( Figure 4After harvest, the yield traits of transgenic corn materials and wild-type were counted. The results showed that the yield traits such as ear weight and grain weight of CircCDPK6RNAi transgenic corn plants were significantly reduced compared with wild-type plants, whether in the normal watering area or after drought stress ( Figure 4 Based on the above results, it can be concluded that reducing the expression of CircCDPK6 can reduce the number of stomata in the leaves of transgenic corn plants, shorten the main root length, make the root system sparse, and reduce the drought tolerance of the plants, which ultimately leads to a decrease in the fruit setting rate and yield of corn plants.

[0058] Example 5 Analysis of drought tolerance phenotype of CircCDPK6OE transgenic Arabidopsis plants at the seedling stage

[0059] Using the pCAMBIA2300-GFP vector, the CircCDPK6OE (overexpression) vector driven by the 35S promoter was constructed for the full-length and flanking intron sequences of CircCDPK6. The specific primer sequences are:

[0060] CircCDPK6-intron1-F: 5'-GATGACGATAAGATGGCCGGATCCGGTAGGACATCAA ATTTG-3' (SEQ ID NO. 5);

[0061] CircCDPK6-intron1-R: 5'-GCTCAGTGAAAACCTGACCTGCAGTTTTGAATAT-3' (SEQ IDNO.6);

[0062] CircCDPK6-F: 5'-ATATTCAAAACTGCAGGTCAGGTTTTCACTGAGC-3' (SEQ ID NO.7);

[0063] CircCDPK6-R: 5'-GCAAGATTTAAGATATATACTCACGTAGTACTTCATGGGC-3' (SEQ IDNO.8);

[0064] CircCDPK6-inton2-F: 5'-GCCCATGAAGTACTACGTGAGTATATATCTTAAATCTTGC-3' (SEQID NO.9);

[0065] CircCDPK6-intron2-R: 5'-CGATCGGGGAAATTCGAGCTCGCTGTAGCTCATATGG AAG-3' (SEQ ID NO. 10).

[0066] After the vector was successfully constructed, Arabidopsis was transformed to obtain the corresponding T0 transgenic seeds. The T0 transgenic seeds were planted in nutrient soil, and then the positive seedlings and expression levels were identified, and the positive lines with increased expression levels were selected for subsequent experiments. Subsequently, the T1 generation seeds were planted in 1 / 2MS medium for positive identification and expression level detection. The positive lines with increased expression levels (C-OE1 and C-OE2) were transplanted into 1 / 2MS, ABA (20μM), and Mannitol (150mM) medium, respectively, and the differences between CircCDPK6 OE transgenic Arabidopsis plants and wild-type materials were observed at the four- to five-leaf stage. The phenotypic results showed that under ABA (20μM) simulated drought stress conditions, the water loss rate of detached leaves of CircCDPK6 OE transgenic Arabidopsis plants was significantly reduced compared with the wild type ( Figure 5 In addition, the main root length of CircCDPK6OE transgenic plants was longer than that of wild type plants under normal conditions (1 / 2MS medium) or drought conditions (20μM ABA medium and 150mM Mannitol medium). Figure 5 BD in ).

[0067] Based on the above experimental results, it is concluded that when encountering drought stress, CircCDPK6 can improve the drought tolerance of plants by regulating the water loss rate of leaves and root length.

[0068] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A maize CircCDPK6 gene, characterized in that: The sequence of the CircCDPK6 gene is shown in SEQ ID NO.

1.

2. The biological material related to the CircCDPK6 gene according to claim 1, characterized in that: The biological material includes a vector for overexpressing or knocking down the CircCDPK6 gene or a recombinant bacterium containing the vector.

3. Use of the CircCDPK6 gene according to claim 1 or the biological material according to claim 2 in regulating plant drought tolerance, characterized in that: The drought tolerance of the plant is reduced by reducing the expression level of the CircCDPK6 gene, or the drought tolerance of the plant is improved by increasing the expression level of the CircCDPK6 gene.

4. The use according to claim 3, characterized in that: The plants include maize and Arabidopsis thaliana.

5. The use of the CircCDPK6 gene or related biological materials in regulating corn yield, leaf stomatal number, taproot length or root number as claimed in claim 1, characterized in that: The related biological materials include a vector for reducing the expression level of the CircCDPK6 gene, a recombinant bacterium containing the vector, or a transgenic plant strain.

6. The use according to claim 5, characterized in that: The regulation includes reducing the expression level of the CircCDPK6 gene, thereby reducing the yield, number of leaf stomata, main root length or number of roots of corn; the yield includes ear weight, grain weight and fruit setting rate.

7. A method for regulating corn yield, leaf stomata number, taproot length or root number, characterized in that: The method comprises reducing the expression level of the CircCDPK6 gene in corn, thereby reducing the yield, number of leaf stomata, main root length or number of roots of the transgenic corn obtained; the sequence of the CircCDPK6 gene is shown in SEQ ID NO.

1.

8. The method according to claim 7, characterized in that The yield includes ear weight, grain weight and fruit setting rate.

9. The use of the CircCDPK6 gene or related biological materials according to claim 1 in promoting root growth of Arabidopsis thaliana or reducing water loss rate of Arabidopsis thaliana leaves, characterized in that: The related biological materials include a vector that overexpresses the CircCDPK6 gene, a recombinant bacterium or a transgenic cell line containing the vector.

10. A method for promoting root growth of Arabidopsis thaliana or reducing water loss rate of Arabidopsis thaliana leaves, characterized in that: The method comprises transferring the CircCDPK6 gene into Arabidopsis and then overexpressing the gene, so that the root length of the obtained transgenic Arabidopsis is increased or the water loss rate of the leaves is reduced; the sequence of the CircCDPK6 gene is shown in SEQ ID NO.1.

Images