Peptides having hair loss prevention or hair growth promotion activity and uses thereof
Patent Information
- Application Number
- CN202280066459.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2021-10-01
- Filing Date
- 2022-09-28
- Publication Date
- 2026-09-04
- Estimated Expiration
- 2042-09-28
AI Technical Summary
然而,由于使用可能含有各种成分的各种类型的天然产品,存在可能会出现不可预测的副作用的问题
[0070] The peptides provided by this invention have the activity of promoting the proliferation or activity of cells that form hair follicles or are involved in hair formation (e.g., dermal papilla cells, outer root sheath cells, and germinal matrix cells).
Smart Images

Figure CN118055942B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a novel peptide with activity that improves hair loss or promotes hair growth, and its uses. Background Technology
[0002] The average human body has approximately 100,000 to 150,000 hairs. As the cell division and activity of hair follicles cease during repeated cycles of growth, degeneration, and rest, existing hairs are pushed out by newly growing hairs and fall out naturally. When an average of about 100 hairs fall out each day, this is considered natural hair loss. Hair loss occurs when the number of hairs lost exceeds this natural rate, or when hair is absent or fails to grow in areas where it should be, as a medical condition. Hair loss can occur during the natural aging process, but it can also be caused by external environmental factors such as hormonal changes, stress, air pollution, and processed foods.
[0003] As hair loss progresses, the dermal papillae in the hair follicle shrink, and correspondingly, the hair growing from the dermal papilla becomes thinner. The hair growth cycle (growth, regression, and resting) also shortens, making newly grown hair even thinner. With repeated occurrences of this phenomenon, the increasingly thinner hairs become vellus hair, the hair growth cycle gradually shortens, leading to slower hair growth and eventual shedding, ultimately resulting in a reduction in the total number of hairs. In the past, hair loss was considered a phenomenon or disease primarily affecting older men, but statistics show that nearly half of hair loss patients are young people in their 20s and 30s, and the number of female patients is also gradually increasing. Because hair loss causes significant changes in appearance, the cost of hair loss treatments (such as hair transplants or other hair loss treatments) is gradually increasing among young people interested in beauty and appearance.
[0004] However, research and development on effective treatments for hair loss remain insufficient. Korean Patent Publication No. 2020-0058932 discloses a composition for preventing and improving hair loss containing extracts such as bellflower extract, and Korean Patent Publication No. 2017-0046528 discloses a compound composition for improving and preventing hair loss containing various herbal extracts. However, due to the use of various types of natural products that may contain diverse ingredients, there is a risk of unpredictable side effects. In particular, hormone-regulating treatments have the disadvantage of causing sexually related side effects or being unsuitable for women. On the other hand, if a peptide composed of amino acids with hair loss treatment effects is developed and used as a treatment for hair loss, it has the advantage of high biocompatibility and the potential to exhibit similar activity by mimicking the active sites of other proteins in the human body. Furthermore, because a single peptide is used, its mechanism of action is well-defined compared to extracts containing various ingredients, and after local inhibition of hair loss, it can be easily broken down and removed by the body's decomposing proteins. Therefore, unlike existing treatments, there are fewer concerns about side effects. Therefore, there is an urgent need to develop a peptide agent that can effectively prevent hair loss and promote hair growth with fewer side effects.
[0005] [Existing Technical Documents]
[0006] [Patent Documents]
[0007] (Patent Document 1) Korean Patent Publication No. 2020-0058932
[0008] (Patent Document 2) Korean Patent Publication No. 2017-0046528 Summary of the Invention
[0009] [Technical Issues]
[0010] The purpose of this invention is to provide peptides that have the activity of inducing increased proliferation or activity of cells associated with hair formation, thereby promoting hair growth.
[0011] Another object of the present invention is to provide a composition that utilizes peptides to effectively prevent, treat, improve hair loss, or promote hair growth.
[0012] [Technical Solution]
[0013] To achieve the above objectives, one aspect of the present invention provides a peptide having activity in preventing hair loss or promoting hair growth, comprising the amino acid sequence of SEQ ID NO:1.
[0014] Another aspect of the present invention provides a composition for preventing hair loss or promoting hair growth, comprising the peptide.
[0015] Another aspect of the present invention provides a pharmaceutical composition for preventing or treating hair loss, comprising the peptide.
[0016] Another aspect of the present invention provides a cosmetic composition for preventing or improving hair loss, comprising the peptide.
[0017] The present invention will now be described in detail.
[0018] 1. Peptides with activity in preventing hair loss or promoting hair growth and their uses.
[0019] One aspect of the present invention provides novel peptides having activity in preventing hair loss or promoting hair growth.
[0020] In this invention, the term "peptide" refers to a polymer composed of two or more amino acids linked by peptide bonds.
[0021] In this invention, the term "hair loss" refers to the absence of hair in areas where hair should normally be present, and includes the phenomenon of a reduction in the amount of hair compared to a normal state. Hair loss is a concept that, depending on whether hair follicles are destroyed, includes non-scarring and scarring hair loss, such as hereditary androgenetic alopecia, alopecia areata, tinea capitis caused by fungal infection, telogen effluvium, trichotillomania, hair loss caused by hair growth disorders or lupus, folliculitis alopecia, lichen planus of hair, and hair loss due to burns and / or trauma.
[0022] The peptide contains the amino acid sequence of SEQ ID NO:1. The peptide may include variant peptides that have a different sequence due to the deletion, insertion, substitution, or combination thereof of amino acid residues, to a degree that does not affect the peptide's activity, or may be in the form of protein fragments with the same function. Amino acid modifications at the protein and peptide level that do not generally alter activity by including the amino acid sequence of SEQ ID NO:1 are known in the art. In some cases, it can be modified by phosphorylation, sulfation, acrylate, glycosylation, methylation, farnesylation, etc. Therefore, the peptide includes not only the amino acid sequence of SEQ ID NO:1, but also peptides or variants thereof having substantially the same amino acid sequence. A peptide having substantially the same amino acid sequence may be, but is not limited to, a peptide containing an amino acid sequence having at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% homology to the amino acid sequence of SEQ ID NO:1. Any peptide containing a sequence having at least 90% amino acid sequence homology with and having the same activity as the amino acid sequence of SEQ ID NO:1 is included within the scope of this invention.
[0023] The peptides of the present invention may consist of 20 or fewer amino acids and contain the amino acid sequence of SEQ ID NO:1, and exhibit activity in preventing hair loss or promoting hair growth. Specifically, the peptides may consist of 20 or fewer, 18 or fewer, 15 or fewer, or 12 amino acids.
[0024] Furthermore, the peptides of the present invention can be obtained by various methods well known in the art. For example, they can be manufactured using polynucleotide recombination and protein expression systems, through in vitro synthesis of chemical synthesis (e.g., peptide synthesis) and cell-free protein synthesis, but are not limited by the manufacturing method.
[0025] Furthermore, to obtain better chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., broad-spectrum biological activity), and reduced antigenicity, a protecting group can be attached to the N-terminus or C-terminus of the peptide. For example, the protecting group can be acetyl, fluorenyl methoxycarbonyl group, formyl, palmitoyl, myristyl, stearoyl, or polyethylene glycol (PEG), but is not limited to including any component that can modify the peptide (especially improve peptide stability). "Stability" refers not only to in vivo stability, which protects the peptide of the present invention from attack by protein-cleaving enzymes in vivo, but also to storage stability (e.g., storage stability at room temperature).
[0026] The peptides of the present invention can promote the proliferation or activity of cells associated with hair formation. Specifically, the peptides may have the activity of promoting the proliferation of cells associated with hair formation (e.g., dermal papilla cells, outer root sheath cells, germinal matrix cells), thereby increasing their number, or have the activity of inducing hair formation by promoting cell activity.
[0027] Furthermore, the peptides of the present invention can inhibit the expression of proteins associated with hair loss in cells involved in hair formation. Specifically, they can inhibit the expression of DKK-1 protein (dickkopf-related protein 1) in dermal papilla cells, and can also inhibit the expression of DKK-1 protein induced by hormones such as DHT (dihydrotestosterone) in dermal papilla cells.
[0028] Because the peptides of the present invention have the above-mentioned activities, they can be effectively used to prevent hair loss or promote hair growth.
[0029] Therefore, another aspect of the present invention provides a composition for preventing hair loss or promoting hair growth, comprising the peptide.
[0030] The peptide may be included in the composition at a concentration of 0.01 μM to 100 μM. Specifically, the peptide may be included at concentrations of 0.01 μM to 100 μM, 0.05 μM to 80 μM, 0.1 μM to 60 μM, or 0.5 μM to 50 μM, but is not limited thereto. When the concentration of the peptide included in the composition of the present invention is within the above ranges, it is advantageous that the activity of the peptide is sufficient to prevent hair loss and / or promote hair growth, while being non-toxic to the organism or its cells.
[0031] This composition can induce hair formation by promoting the activity of one or more cells selected from the group consisting of dermal papilla cells, outer root sheath cells, and germinal matrix cells.
[0032] This composition can induce one or more phosphorylations in dermal papillary cells, wherein the phosphorylation is selected from the group consisting of AKT and ERK. Specifically, this composition can increase the amount of p-AKT and / or p-ERK in dermal papillary cells, thereby activating signaling pathways associated with dermal papillary cell proliferation.
[0033] This composition can induce the activation of β-linkin in dermal papillary cells. Specifically, the composition can activate β-linkin in dermal papillary cells and induce its movement toward the cell nucleus, thereby promoting or inducing cell proliferation and / or differentiation of dermal papillary cells.
[0034] This composition can promote the expression of one or more of the group consisting of LEF-1, c-Myc, and cyclin D1 in dermal papilla cells. Specifically, this composition can promote or induce cell proliferation and / or differentiation in dermal papilla cells, thereby promoting the expression of LEF-1, c-Myc, and / or cyclin D1.
[0035] In a specific embodiment of the present invention, human follicular dermal papilla cells (HHFDPCs) were treated with compositions containing the peptides of the present invention at different concentrations, and absorbance was measured. The results showed that the measured absorbance was greater than that of the control group, confirming its effect in promoting and inducing HHFDPC proliferation. Furthermore, in HHFDPCs, p-AKT and p-ERK, associated with proliferation or activation, were increased, β-linkin was activated leading to increased migration to the nucleus, and the expression of LEF-1, c-Myc, and cyclin D1 was also correspondingly increased. Therefore, the peptides of the present invention and compositions containing said peptides are demonstrated to have excellent performance in promoting hair growth or preventing hair loss by promoting and inducing the proliferation and activation of dermal papilla cells (which are cells that form hair follicles).
[0036] This composition inhibits the expression of DKK-1 protein in dermal papillary cells. Specifically, the composition inhibits the expression of DKK-1 protein in dermal papillary cells, where the expression of DKK-1 protein is induced by hormones such as DHT (dihydrotestosterone).
[0037] In a specific embodiment of the invention, dermal papillary cells (HHFDPCs) containing the peptides of the invention were treated with different concentrations of the composition, the HHFDPCs having been treated with DHT to induce the expression of DKK-1 protein. Western blotting examination of the DKK-1 protein composition confirmed a reduction in the amount of DKK-1 protein compared to the negative control group. Therefore, it has been demonstrated that the peptides of the invention and the compositions containing said peptides are effective in inhibiting the expression of hair loss-related proteins in dermal papillary cells and can be effectively used for the prevention of hair loss.
[0038] This composition can promote the expression of one or more of the group consisting of Ha3-II, keratin 14, and keratin 19 in outer root sheath cells. Specifically, this composition can increase the cell viability of outer root sheath cells and promote the expression of Ha3-II, keratin 14, and / or keratin 19.
[0039] In a specific embodiment of the present invention, lateral root sheath cells (HHORSCs) were treated with compositions containing the peptides of the present invention at different concentrations. The expression of Ha3-II, keratin 14, and keratin 19 was confirmed by RT-PCR, and the results showed increased expression levels compared to the control group. Therefore, it is confirmed that the peptides of the present invention and compositions containing said peptides have the effect of increasing the activity of lateral root sheath cells (a type of cell that forms hair follicles), and thus have the effect of preventing hair loss or promoting hair growth.
[0040] This composition can promote the expression of MSX2 in germinal stromal cells. Specifically, the composition can induce the expression of genes related to germinal stromal cell activity by promoting the expression of MSX2 (a transcription factor associated with the cellular activity of germinal stromal cells).
[0041] In a specific embodiment of the invention, HHGMCs (Hair germinal stromal cells) were treated with a composition containing the peptides of the invention at different concentrations. MSX2 expression was confirmed by RT-PCR, and the results showed an increased expression level compared to the control group. Therefore, the peptides of the invention and compositions containing said peptides are confirmed to increase the activity of hair follicle stromal cells (a type of hair-forming cell), thus having the effect of preventing hair loss or promoting hair growth.
[0042] 2. Pharmaceutical compositions for the prevention or treatment of hair loss
[0043] Another aspect of the present invention provides a pharmaceutical composition comprising the peptide for the prevention or treatment of hair loss.
[0044] The peptide contains the amino acid sequence of SEQ ID NO:1. This interpretation is the same as that of the peptides described in the section "Peptides with activity for preventing hair loss or promoting hair growth and their uses," which is used for specific explanation. Hereinafter, only specific components of the pharmaceutical composition are described. As used herein, the term "prevention" means reducing the risk of developing a disease or condition, and refers to all activities that inhibit or delay the onset of a disease by preventing the development of one or more clinical symptoms of the disease in subjects who are susceptible to or prone to the disease but have not yet developed the disease or shown symptoms of the disease.
[0045] In this invention, the term "treatment" means to alleviate a disease or symptom, and includes all activities that improve or beneficially alter the symptoms of a disease by inhibiting or reducing the progression of the disease or one or more of its clinical symptoms.
[0046] In the pharmaceutical compositions of the present invention, the peptide may be contained in a therapeutically effective amount, and may further contain a pharmaceutically acceptable carrier. The term "therapeutically effective amount" refers to an amount sufficient to achieve the purpose of the composition, to prevent or treat hair loss.
[0047] In this invention, hair loss refers to the absence of hair in areas where hair should normally be present, and includes a reduction in the amount of hair compared to a normal state. Hair loss is a concept that, depending on whether hair follicles are destroyed, includes non-scarring or scarring hair loss, such as hereditary androgenetic alopecia, alopecia areata, tinea capitis caused by fungal infection, telogen effluvium, trichotillomania, hair loss caused by hair growth disorders or lupus, folliculitis alopecia, lichen planus of hair, and hair loss due to burns and / or trauma.
[0048] Preventing or treating hair loss can include eliminating the cause of hair loss or inhibiting its progression, as well as promoting hair growth by inhibiting hair loss or promoting hair formation.
[0049] Furthermore, according to methods readily available to those skilled in the art, the pharmaceutical compositions of this invention can be prepared in unit dosage forms by using pharmaceutically acceptable carriers and / or excipients, or by placing them in multi-dose containers. In this case, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granules, tablets, capsules, or gel (e.g., hydrogel), and may additionally contain dispersants or stabilizers.
[0050] Additionally, peptides contained in the pharmaceutical composition can be transported in pharmaceutically acceptable carriers, such as colloidal suspensions, powders, salt solutions, lipids, liposomes, microspheres, or nanospheres. The peptides can form complexes or associate with delivery carriers and can be transported in vivo using delivery systems known in the art, such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensing agents, polysaccharides, polyamino acids, dendritic polymers, saponins, adsorption promoters, or fatty acids.
[0051] In addition, pharmaceutically acceptable carriers may include, but are not limited to, commonly used carriers in the preparation process such as lactose, glucose, sucrose, sorbitol, mannitol, starch, gum arabic, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylparaben, propylparaben, talc, magnesium stearate, and mineral oil. Furthermore, in addition to the above-mentioned components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, and preservatives may also be included.
[0052] The pharmaceutical compositions according to the present invention can be administered orally or parenterally during clinical application and can be used in the form of general pharmaceutical preparations. That is, the pharmaceutical compositions of the present invention can be administered in various oral and parenteral dosage forms during actual clinical application. In formulation, diluents or excipients are used, such as commonly used fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Orally administered solid dosage forms include tablets, pills, powders, granules, capsules, etc., which are prepared by mixing herbal extracts or fermented herbs with at least one excipient (such as starch, calcium carbonate, sucrose, or lactose) and gelatin. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Orally administered liquid dosage forms include suspensions, oral solutions, emulsions, and syrups. In addition to commonly used simple diluents such as water and liquid paraffin, various excipients such as wetting agents, sweeteners, flavorings, and preservatives may be included. Parenteral dosage forms include sterile aqueous solutions, non-aqueous solutions, suspensions, emulsions, lyophilized formulations, and suppositories. Non-aqueous solvents and suspending agents may include propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and injectable esters (such as ethyl oleate). As a base for suppositories, wethepsol, polyethylene glycol, Tween 61, cocoa, lauryl, glycerin, gelatin, etc., can be used.
[0053] The dosage of peptides may vary depending on factors such as formulation method, administration method, patient age, weight, sex, pathological condition, diet, administration time, route of administration, excretion rate, and sensitivity to reaction. The typical dosage for adult patients is 1-20 mg / kg body weight / day, preferably 5-10 mg / day. It can be administered in multiple divided doses daily based on the judgment of a physician or pharmacist, preferably at regular intervals of 2-3 times per day.
[0054] The pharmaceutical compositions of the present invention can be topical skin preparations. Topical skin preparations are preparations that can be used by applying them to the external skin. When the pharmaceutical compositions of the present invention are used as topical skin preparations, they can be applied to the scalp, particularly to areas of hair loss or areas where hair growth needs to be promoted. Topical skin preparations can be creams, gels, ointments, skin lotions, skin suspensions, transdermal patches, medicated bandages, emulsions, or combinations thereof. Topical skin preparations can be appropriately mixed as needed with ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals, such as water-based ingredients, oil-based ingredients, powder ingredients, alcohol, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or combinations thereof. In addition, metal chelating agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, or gluconic acid, drugs such as caffeine, tannins, verapamil, licorice extract, glycyrrhizin, calin fruit hot water extract, various herbs, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts, vitamin C, magnesium ascorbate phosphate, ascorbate glucoside, arbutin, kojic acid, and sugars (such as glucose, fructose, or trehalose) may also be appropriately incorporated into topical skin preparations.
[0055] 3. Cosmetic compositions for preventing or improving hair loss
[0056] Another aspect of the present invention provides a cosmetic composition containing peptides for preventing or improving hair loss.
[0057] The peptide contains the amino acid sequence of SEQ ID NO:1. This interpretation is the same as that of the peptides described in the section "Peptides with activity for preventing hair loss or promoting hair growth and their uses," and is used for specific explanation. In the following description, only specific components of the cosmetic composition are described.
[0058] In this invention, the term "improvement" refers to any activity that improves or benefits a disease or condition.
[0059] Preventing or improving hair loss can involve eliminating the cause of hair loss or inhibiting its progression, or it can involve promoting hair growth by inhibiting hair loss or promoting hair formation.
[0060] Cosmetic compositions may include cosmetically effective amounts of peptides and cosmetically acceptable carriers, and cosmetically effective amounts refer to amounts sufficient to achieve the aforementioned hair loss prevention or hair growth promotion effects.
[0061] The cosmetic compositions of the present invention may additionally contain other ingredients that synergistically enhance the activity of the peptides, for example, within a range that does not affect the peptides' activity in preventing hair loss or promoting hair growth. For example, it may contain adjuvants commonly used in the cosmetic or dermatological fields, such as fatty substances, organic solvents, solubilizers, concentrates, gelling agents, emollients, antioxidants, suspending agents, stabilizers, foaming agents, fragrances, surfactants, water, ionic or nonionic emulsifiers, fillers, masking agents, chelating agents, preservatives, vitamins, occlusive agents, wetting agents, essential oils, dyes, pigments, hydrophilic or hydrophobic activators, lipoves, or other ingredients commonly used in cosmetics. Adjuvants are used in amounts generally acceptable in the cosmetic or dermatological fields.
[0062] The cosmetic compositions of the present invention can be prepared using any formulation commonly prepared in the art. For example, they can be formulated into cosmetics such as solutions, suspensions, lotions, gels, lotions, serums, creams, powders, soaps, shampoos, conditioners, packaged masks, cleansers containing surfactants, cleansing foams, cleansing waters, oils, liquid foundations, cream foundations, or sprays.
[0063] When the formulation is a solution or emulsion, solvents, solubilizers, or emulsifiers can be used as carrier components. For example, water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butanediol oil, glyceryl fatty acid esters, polyethylene glycol, or fatty acid esters of dehydrated sorbitol can be used as carrier components. When the formulation is a suspension, liquid diluents (e.g., water, ethanol, and propylene glycol), suspending agents (e.g., ethoxylated isostearyl alcohol, polyoxyethylene sorbitol esters, and polyoxyethylene dehydrated sorbitol esters), aluminum metahydroxide, microcrystalline cellulose, bentonite, agar, astragalus gum, etc., can be used as carrier components. When the formulation is a cream or gel, waxes, paraffin wax, astragalus gum, animal oils, starch, cellulose derivatives, siloxanes, bentonite, polyethylene glycol, silica, zinc oxide, or talc can be used as carrier components. When the formulation is in powder or spray form, the carrier component may additionally contain silica, talc, aluminum hydroxide, lactose, calcium silicate, propellants such as chlorofluorocarbons, propane / butane, and dimethyl ether. When the formulation is a detergent containing surfactants, the carrier component may include fatty alcohol sulfates, fatty alcohol ether sulfates, sulfosuccinate monoesters, imidazoline derivatives, hydroxyethyl sulfonates, methyl taurine salts, sarcosinates, fatty acid amide ether sulfates, fatty alcohols, alkylamide betaine, fatty acid glycerides, fatty acid diethanolamides, vegetable oils, lanolin derivatives, or ethoxylated glycerol fatty acid esters, etc.
[0064] Specifically, the cosmetic composition of the present invention can be a topical skin preparation. A topical skin preparation is a preparation that can be used by applying it to the outside of the skin. When the cosmetic composition of the present invention is used as a topical skin preparation, it can be applied to the scalp, particularly the scalp in areas of hair loss or areas where hair growth needs to be promoted. The topical skin preparation can be a cream, gel, ointment, skin lotion, skin suspension, transdermal patch, medicated bandage, lotion, or a combination thereof. The topical skin preparation can be appropriately mixed as needed with ingredients commonly used in topical skin preparations such as cosmetics or pharmaceuticals, such as water-based ingredients, oil-based ingredients, powder ingredients, alcohol, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or combinations thereof. In addition, metal chelating agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, or gluconic acid, drugs such as caffeine, tannins, verapamil, licorice extract, glycyrrhizin, calin fruit hot water extract, various herbs, tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts, vitamin C, magnesium ascorbate phosphate, ascorbate glucoside, arbutin, kojic acid, and sugars (such as glucose, fructose, or trehalose) may also be appropriately incorporated into topical skin preparations.
[0065] Another aspect of the present invention provides a method for treating hair loss, comprising administering a therapeutically effective amount of a peptide to a subject who requires hair loss treatment.
[0066] Another aspect of the present invention provides a method for improving hair loss, which includes administering a cosmetically effective amount of peptide to a subject who needs to improve hair loss.
[0067] In another aspect of the invention, the use of the peptide for treating alopecia is provided.
[0068] In another aspect of the invention, the use of the peptide in the preparation of a medicament for treating or preventing hair loss is provided.
[0069] Beneficial effects
[0070] The peptides provided by this invention have the activity of promoting the proliferation or activity of cells that form hair follicles or are involved in hair formation (e.g., dermal papilla cells, outer root sheath cells, and germinal matrix cells).
[0071] Specifically, the peptides of the present invention can increase the expression levels of genes or proteins related to cell proliferation, differentiation, and activation, and have the activity of inhibiting the expression of hair loss-related proteins induced by hormones such as DHT. Therefore, the peptides and compositions containing the peptides can be effectively used to prevent, treat, or improve hair loss or promote hair growth.
[0072] Furthermore, the peptides and compositions containing said peptides of the present invention use a single peptide as the active ingredient. Therefore, compared to hair loss treatments that use natural products that may contain multiple components and thus exhibit unpredictable effects, the peptides and compositions containing said peptides of the present invention have the advantage of exhibiting a localized hair loss inhibition effect, being easily broken down and removed by proteolytic enzymes in the body, and having little or no possibility of side effects due to a more clearly defined mechanism of action. Furthermore, the compositions of the present invention using peptides as active ingredients have higher biocompatibility than existing therapeutic agents because they use substances composed of amino acid bonds as active ingredients. Additionally, the composition has the advantage that said peptides can exhibit similar activity by mimicking the active sites of proteins in the human body and have the effect of reducing problems such as decreased sexual function due to hormonal regulation.
[0073] However, the effects of the present invention are not limited to those described above, and those skilled in the art will clearly understand other unmentioned effects through the following description. Attached Figure Description
[0074] Figure 1 The graph shows the results of comparing the cell proliferation values of HHFDPCs treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention with the cell proliferation values of the untreated control group (Con) and the positive control group (MNX) treated with minoxidil.
[0075] Figure 2 The results were obtained by Western blotting in HHFDPC of phosphorylated AKT and ERK (p-AKT and p-ERK, respectively) in groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention, a control group (Con) without any treatment, and a positive control group (MNX) treated with minoxidil.
[0076] Figure 3 The results of Western blotting confirmed the migration of β-linkin to the cell nucleus in HHFDPC groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention and in a control group (Con) that was not treated.
[0077] Figure 4 The results were obtained by RT-PCR confirmation of the expression of LEF-1, c-Myc, and cyclin D1 in HHFDPC groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention and in a control group (Con) without any treatment.
[0078] Figure 5The results of Western blotting confirmed the DKK-1 protein in DHT-treated HHFDPCs in groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention, a control group (Con) without any treatment, and a positive control group treated with finasteride.
[0079] Figure 6 The results were obtained by RT-PCR confirmation of the expression of Ha3-II, keratin 14, and keratin 19 in HHORSC groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention, a control group (Con) without any treatment, and a positive control group treated with EGF.
[0080] Figure 7 The results of MSX2 expression were confirmed by RT-PCR in HHGMC in groups treated with different concentrations of the peptide containing the amino acid sequence of SEQ ID NO:1 of the present invention, a control group (Con) without any treatment, and a positive control group treated with EGF.
[0081] Best way
[0082] Methods of implementing the present invention
[0083] The present invention will now be described in detail through examples.
[0084] However, the following embodiments specifically illustrate the present invention, and the content of the present invention is not limited to the following embodiments. Example
[0085] [Preparation Examples] Peptide preparation
[0086] Peptides having the amino acid sequence listed in Table 1 below were synthesized using an automated peptide synthesizer (Milligen 9050, Millipore, USA) and purified using C18 reversed-phase high-performance liquid chromatography (HPLC) (Waters Associates, USA). The chromatographic column used was an ACQUITY UPLC BEH300 C18 (2.1 mm × 100 mm, 1.7 μm, Waters Corporation, USA).
[0087] [Table 1]
[0088] 1 QHNQIRYFEE
[0089] [Experimental Example 1] Confirmed the effect of the peptide of the present invention on promoting the proliferation and activity of dermal papillary cells.
[0090] Using the peptide of the present invention, which consists of the amino acid sequence of SEQ ID NO:1 and prepared according to the above preparation examples, its proliferative and activity-promoting effects on dermal papillary cells (one of the cells that form hair follicles) were confirmed, and its inhibitory effect on hair loss-related proteins was also confirmed.
[0091] [1-1] Confirmed the effect of promoting dermal papillary cell proliferation
[0092] When culturing human follicular dermal papillary cells (HHFDPC), absorbance was measured after treatment with the peptides of the present invention to confirm whether it promotes the proliferation of HHFDPC dermal papillary cells.
[0093] Specifically, HHFDPC (Sciencell, USA) will be used at a rate of 4 × 10 3 Cells / well were seeded in 96-well plates and cultured for 24 hours in complete MSC medium (Mesenchymal Stem Cell Complete Medium, Sciencell, USA). The medium was then replaced with serum-free MSC complete medium and cultured for another 24 hours. HHFDPCs were then treated with the peptide of SEQ ID NO:1 prepared in the preparation examples at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 72 hours. As a positive control, 1 μM minoxidil was used for treatment, and as a negative control, untreated HHFDPCs were used. Then, 10 μl of 5 mg / mL MTT solution was added, and the cells were cultured in a 37°C CO2 incubator for 4 hours to stain the cells. After removing the medium, the cells were treated with 100 μl of DMSO and shaken for 10 minutes. The number of HHFDPC cells was confirmed by measuring the absorbance at 540 nm using a spectrophotometer.
[0094] The results are as follows Figure 1 As shown, compared with the untreated control group, the absorbance measured in the group treated with the peptide of the present invention was higher, confirming that HHFDPC proliferation was promoted and the cell number was further increased depending on the concentration of the treated peptide. These results confirm that the peptide of the present invention has the effect of increasing the number of dermal papilla cells, effectively promoting hair growth and improving hair loss, wherein dermal papilla cells correspond to the cells that form hair follicles.
[0095] [1-2] Confirmation of the enhancing effect of factors related to dermal papillary cell proliferation
[0096] In HHFDPCs treated with the peptides of the present invention, changes in factors affecting cell proliferation or differentiation were identified to determine whether increasing the peptides of the present invention could promote the proliferation and differentiation of HHFDPCs.
[0097] First, Western blotting confirmed the phosphorylated forms of AKT and ERK, which are signaling molecules associated with HHFDPC proliferation. Specifically, the HHFDPC from [Experimental Example 1-1] was subjected to a protein blotting process at 4 × 10⁻⁶. 5 Cells were seeded per well in 6-well plates and cultured for 24 hours in complete MSC medium (mesenchymal stem cell complete medium), then the medium was replaced with serum-free MSC complete medium and cultured for another 24 hours. HHFDPCs were then treated with the peptide of SEQ ID NO:1 prepared in the preparation examples at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 24 hours. As a positive control, 1 μM minoxidil was used for treatment, and as a negative control, untreated HHFDPCs were used. Western blotting was then performed to detect phosphorylated AKT and phosphorylated ERK. After washing with PBS, cells were treated with 100 μl of lysis buffer to disrupt the cells, resulting in cell lysates. After 10% SDS-PAGE gel electrophoresis, the lysates were transferred to PVDF membranes and blocked with 5% skim milk at room temperature for 30 minutes. To detect phosphorylated AKT (p-AKT) and phosphorylated ERK (p-ERK), anti-p-AKT and anti-p-ERK antibodies (Cell Signaling, USA) specifically binding to p-AKT and p-ERK were diluted 1:1000 in 3% BSA and reacted with a PVDF membrane at 4°C for 16 hours. Then, the membrane was washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. Secondary antibodies against these antibodies were diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three more times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. Finally, p-AKT and p-ERK were detected by treatment with ECL solution (GE Healthcare, USA).
[0098] The results are as follows Figure 2 As shown, the proliferation-related signaling molecules p-AKT and p-ERK were detected in HHFDPC treated with the peptides of the present invention, and increased phosphorylation was found compared with the control group not treated with the peptides. Based on the above results, it was confirmed that the peptides of the present invention have the effect of activating signals related to the proliferation of dermal papilla cells forming hair follicles, thereby promoting the proliferation of dermal papilla cells and promoting hair growth.
[0099] In addition to p-AKT and p-ERK, to confirm the activation of β-annexin, which is known to affect cell proliferation and differentiation, Western blotting was used to confirm whether β-annexin had entered the cell nucleus. Specifically, HHFDPC from [Experimental Example 1-1] was used at 4 × 10⁻⁶ ppm. 5Cells were seeded at a rate of 100 cells / well in 6-well culture plates and cultured in MSC complete medium (mesenchymal stem cell complete medium) for 24 hours. The medium was then replaced with serum-free MSC complete medium and cultured again for 24 hours. HHFDPCs were then treated with the peptide of SEQ ID NO:1 prepared in the preparation examples at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 24 hours. As a positive control, 1 μM minoxidil was used for treatment, and as a negative control, untreated HHFDPCs were used. After washing with PBS, proteins in the cell nuclei were isolated using a nuclear protein extraction kit (Thermoscientific, USA). After 10% SDS-PAGE gel electrophoresis, the proteins were transferred to PVDF membranes and blocked with 5% skim milk at room temperature for 30 minutes. To detect β-linkin, an anti-β-linkin antibody (Cell Signaling, USA) that specifically binds to β-linkin was diluted 1:1000 in 3% BSA and reacted with a PVDF membrane at 4°C for 16 hours. Then, the membrane was washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time. A secondary antibody against the above antibody was diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three more times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time, and β-linkin was detected by treatment with ECL solution (GE Healthcare, USA).
[0100] The results are as follows Figure 3 As shown, β-linkin was found to migrate to and be present in the nuclei of HHFDPC cells treated with the peptide of the present invention. Furthermore, compared to the control group not treated with the peptide, increased migration due to β-linkin activation was confirmed, and β-linkin activation was further promoted at the concentration of the peptide according to the present invention.
[0101] Furthermore, to determine whether β-linkin migrates to the nucleus and is activated to affect proliferation and differentiation, RT-PCR was used to confirm whether the expression of downstream factors LEF-1, c-Myc, and cyclin D1 (cyclin D1) increased with β-linkin activation. Specifically, HHFDPC cells were cultured using the same method as in previous Western blot experiments, treated with peptides from the preparation examples of this invention at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 24 hours. After washing the cells with PBS, they were treated with 300 μl of easy blue (Intron, Korea) to isolate RNA. Then, cDNA was synthesized using a cDNA synthesis kit (Enzynomics, Korea) with quantification via nanodroplets, and PCR was performed using primers for LEF-1, c-Myc, and cyclin D1 (primer base sequences are shown in Table 2 below) and PCR premix (Enzynomics, Korea). Electrophoresis was performed on a 1.5% agarose gel, and then the mRNA of LEF-1, c-Myc, and cyclin D1 was detected using a band analysis system (Bio-Rad gel imaging system).
[0102] [Table 2]
[0103]
[0104]
[0105] The results are as follows Figure 4 As shown, the mRNA of LEF-1, c-Myc, and cyclin D1 was detected in HHFDPCs treated with the peptide of the present invention, and the amount of mRNA was further increased compared with the control group that had not undergone any treatment. Therefore, it was confirmed that the expression of LEF-1, c-Myc, and cyclin D1 (expression as β-linkin activation) was promoted in dermal papilla cells treated with the peptide of the present invention, and the proliferation and differentiation of dermal papilla cells were promoted, thereby promoting hair formation.
[0106] [Experimental Example 2] The inhibitory effect of the peptide of the present invention on the expression of hair loss-related proteins in dermal papillary cells was confirmed.
[0107] DKK-1 protein (dickkopf-associated protein 1) is a hair loss-related protein known to be highly expressed in individuals with hair loss (especially male pattern baldness), and its expression is promoted by hormones such as DHT (dihydrotestosterone). Therefore, DKK-1 protein expression was induced by treating HHFDPC cells with DHT and a peptide prepared according to an embodiment of the present invention, and the expression level of DKK-1 was then measured by Western blotting to determine whether there was an inhibitory effect on DKK-1 protein expression.
[0108] Specifically, the HHFDPC in [Experimental Example 1-1] was used at 4×10 5 Cells / well were seeded in 6-well plates and cultured in MSC complete medium (mesenchymal stem cell complete medium) for 24 hours. The medium was then replaced with serum-free MSC complete medium and cultured again for 24 hours. HHFDPCs were treated with the peptide SEQ ID NO:1 prepared in the preparation example at concentrations of 500 nM, 5 μM, and 50 μM, while simultaneously being treated with 100 nM DHT (DHT is an inducer of DKK-1 protein expression), and then cultured at 37°C for 24 hours. As a positive control, HHFDPCs treated with 5 μM finasteride were used, and as a negative control, HHFDPCs treated only with DHT to induce DKK-1 expression without peptide treatment were used. Western blotting was then performed to detect the hair loss-associated protein DKK-1. After washing with PBS, cells were treated with lysis buffer to disrupt the cells, thereby obtaining cell lysates. After 10% SDS-PAGE gel electrophoresis, the gel was transferred to a PVDF membrane and blocked with 5% skim milk for 30 minutes at room temperature. To detect DDK-1 protein, a DDK-1 antibody (Cell Signaling, USA) specifically binding to DDK-1 protein was diluted 1:1000 in 3% BSA and reacted with the PVDF membrane at 4°C for 16 hours. Then, the membrane was washed three times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time, and a secondary antibody against the anti-DKK-1 antibody was diluted 1:2000 in 5% skim milk and reacted at room temperature for 1 hour. The membrane was then washed three more times with 0.1% PBS-T (0.1% Tween-20 in PBS) for 15 minutes each time, after which DKK-1 protein was detected by treatment with ECL solution (GE Healthcare, USA).
[0109] The results are as follows Figure 5 As shown, compared with the negative control group, the amount of DKK-1 protein in HHFDPC treated with the peptide of the present invention was reduced. In other words, DHT treatment of dermal papilla cells increased the expression of hair loss-related proteins (negative control). However, when treated with the peptide of the present invention, the amount of DKK-1 protein increased by DHT treatment was again reduced in HHFDPC, and the increased expression of DKK-1 was again reduced at the concentration of the peptide according to the present invention. Therefore, the peptide of the present invention is confirmed to have an inhibitory effect on hair loss.
[0110] [Experimental Example 3] Confirmation of the effect of the peptide of the present invention on promoting the activity of outer root sheath cells
[0111] Using the peptide of the present invention, which consists of the amino acid sequence of SEQ ID NO:1 and was prepared according to the above preparation examples, it was confirmed whether it promotes the activity of outer root sheath cells (a type of cell that forms hair follicles).
[0112] Specifically, HHORSCs (human hair outer root sheath cells, Sciencell, USA) were used at a rate of 4 × 10⁻⁶. 5 Cells / well were seeded in 6-well plates and cultured in MSC complete medium (mesenchymal stem cell complete medium) for 24 hours. The medium was then replaced with serum-free MSC complete medium and cultured again for 24 hours. HHORSCs were then treated with the peptide of SEQ ID NO:1 prepared in the preparation examples at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 72 hours. As a positive control, HHORSCs were treated with 50 nM EGF, and as a negative control, untreated HHORSCs were used. After washing with PBS, RNA was isolated by treatment with 300 μl of easy blue (Intron, Korea). cDNA was then synthesized using a cDNA synthesis kit (Enzynomics, Korea) with quantification via nanodroplets, and PCR was performed using primers for Ha3-II, keratin 14, and keratin 19 (primer base sequences are shown in Table 3 below) and PCR premix (Enzynomics, Korea). Electrophoresis was performed on a 1.5% agarose gel, and then the mRNA of Ha3-II, keratin 14, and keratin 19 was detected using a band analysis system (Bio-Rad gel imaging system).
[0113] [Table 3]
[0114] 10 Ha3-II forward primer (5')GATCATCGAGCTGAGACGCA(3') 11 Ha3-II reverse primer (5')CTGGCCCCAGGGTATCTAGT(3') 12 Keratin 14 forward primer (5')CCAAATCCGCACCAAGGTCA(3') 13 Keratin 14 reverse primer (5')GTATTGATTGCCAGGAGGGGG(3') 14 Keratin 19 forward primer (5')CGCGGCGTATCCGTGTCCTC(3') 15 Keratin 19 reverse primer (5')AGCCTGTTCCGTCTCAAACTTGGT(3')
[0115] The results are as follows Figure 6 As shown, mRNAs of Ha3-II, keratin 14, and keratin 19 were detected in HHORSCs treated with the peptides of the present invention, and the levels of mRNA were further increased compared to the untreated control group. Therefore, it was confirmed that the expression of the above-mentioned cytokines in the outer root sheath cells treated with the peptides of the present invention increased with increased cell activity. Furthermore, it was confirmed that the peptides of the present invention have the effect of increasing the activity of outer root sheath cells, which form hair follicles and contribute to hair formation.
[0116] [Experimental Example 4] Confirmation of the effect of the peptide of the present invention on promoting the activity of germinal stromal cells
[0117] Using the peptide of the present invention, which consists of the amino acid sequence of SEQ ID NO:1 and was prepared according to the above preparation examples, it was confirmed whether it promotes the expression of transcription factors related to the activity of germinal stromal cells (a type of hair-forming cell).
[0118] Specifically, HHGMCs (human hair growth stromal cells, Sciencell, USA) were used at a concentration of 4 × 10⁻⁶. 5 Cells / well were seeded in 6-well plates and cultured in MSC complete medium (mesenchymal stem cell complete medium) for 24 hours. The medium was then replaced with serum-free MSC complete medium and cultured again for 24 hours. HHGMCs were then treated with the peptide of SEQ ID NO:1 prepared in the preparation examples at concentrations of 500 nM, 5 μM, and 50 μM, and cultured at 37°C for 72 hours. As a positive control, HHGMCs were treated with 50 nM EGF, and as a negative control, untreated HHGMCs were used. After washing with PBS, RNA was isolated by treatment with 300 μl of easy blue (Intron, Korea). cDNA was then synthesized using a cDNA synthesis kit (Enzynomics, Korea) with quantification via nanodroplets, and PCR was performed using primers of MSX2 (primer base sequences are listed in Table 4 below) and PCR premix (Enzynomics, Korea). Electrophoresis was performed on a 1.5% agarose gel, and MSX2 mRNA was detected using a band analysis system (Bio-Rad gel imaging system).
[0119] [Table 4]
[0120] 16 MSX2 forward primer (5')CGGTCAAGTCGGAAAATTCA(3') 17 MSX2 reverse primer (5')GAGGAGCTGGGATGTGGTAA(3')
[0121] The results are as follows Figure 7 As shown, MSX2 mRNA was detected in HHGMCs treated with the peptides of the present invention, and the amount of mRNA was further increased compared with the untreated control group. Therefore, it was confirmed that in germinal stromal cells treated with the peptides of the present invention, the transcription and corresponding activities of genes related to cell activity increased with the increase in the expression of the transcription factor MSX2. The peptides of the present invention, by increasing the activity of germinal stromal cells, have the effect of promoting hair formation and preventing and improving hair loss.
[0122] The present invention has been described in detail above only with respect to the described embodiments. However, it will be apparent to those skilled in the art that various changes and modifications can be made within the technical scope of the present invention, and such changes and modifications naturally fall within the scope of the appended claims.
Claims
1. A peptide with activity of preventing hair loss or promoting hair growth, which consists of the amino acid sequence of SEQ ID NO:
1.
2. A composition for preventing hair loss or promoting hair growth, comprising the peptide of claim 1.
3. The composition for preventing hair loss or promoting hair growth according to claim 2, wherein the peptide is contained in the composition at a concentration of 0.01 μM to 100 μM.
4. Use of the peptide of claim 1 in the preparation of compositions for preventing hair loss or promoting hair growth.
5. The use according to claim 4, wherein the composition induces hair formation by promoting the activity of one or more cells selected from the group consisting of dermal papilla cells, outer root sheath cells and germinal matrix cells.
6. The use according to claim 4, wherein the composition induces one or more phosphorylations in dermal papillary cells selected from the group consisting of AKT and ERK.
7. The use according to claim 4, wherein the composition induces the activation of β-linkin in dermal papillary cells.
8. The use according to claim 4, wherein the composition promotes the expression of one or more of the group consisting of LEF-1, c-Myc and cyclin D1 in dermal papillary cells.
9. The use according to claim 4, wherein the composition inhibits the expression of DKK-1 protein in dermal papillary cells.
10. The use according to claim 4, wherein the composition promotes the expression of one or more of the group consisting of Ha3-II, keratin 14 and keratin 19 in outer root sheath cells.
11. The use according to claim 4, wherein the composition promotes the expression of MSX2 protein in germinal stromal cells.
12. A pharmaceutical composition for the prevention or treatment of hair loss, comprising the peptide of claim 1.
13. The pharmaceutical composition for the prevention or treatment of hair loss according to claim 12, wherein the pharmaceutical composition is a topical skin preparation.
14. A cosmetic composition for preventing or improving hair loss, comprising the peptide of claim 1.
15. The cosmetic composition for preventing or improving hair loss according to claim 14, wherein the cosmetic composition is a topical skin preparation.
16. The cosmetic composition for preventing or improving hair loss according to claim 14, wherein the cosmetic composition is any one of the formulations selected from the group consisting of solutions, suspensions, emulsions, gels, creams, powders, packaged masks, cleansers containing surfactants, oils, liquid foundations, and sprays.
17. The cosmetic composition for preventing or improving hair loss according to claim 14, wherein the cosmetic composition is any one of the formulations selected from the group consisting of serums, soaps, shampoos, conditioners, cleansing foams, and cleansing waters.
18. The cosmetic composition for preventing or improving hair loss according to claim 14, wherein the cosmetic composition is any formulation selected from lotions or foundation creams.
Citation Information
Patent Citations
Peptide having hair growth-promoting activity and use thereof
CN108699109A
Peptide having anti-inflammatory, osteogenic and hair growth promoting activities, and use of same
CN109970842A