A method for planting taro seedlings by transplanting using stubble fields

By using specific substrates and seedling raising methods on wheat stubble land, and utilizing seed bulbs or lateral buds for seedling raising, combined with management measures, the problem of reduced planting area and yield of Baimiao taro was solved, achieving efficient seedling raising and transplanting, and improving economic benefits and survival rate.

CN118140768BActive Publication Date: 2026-06-09QINGDAO AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
QINGDAO AGRI UNIV
Filing Date
2024-03-26
Publication Date
2026-06-09

Smart Images

  • Figure CN118140768B_ABST
    Figure CN118140768B_ABST
Patent Text Reader

Abstract

The application provides a kind of taro seedling transplanting planting method using wheat stubble, first, preparation substrate and seedling container, the substrate contains sandy soil, granular slow-release fertilizer, chelated slow-release fertilizer, bacteriostatic agent, rooting agent, the seedling container includes seedling bag and seedling box;Select the seed ball or lateral bud of taro for seedling, and transplant to wheat stubble and plant;After transplanting, regular fertilization and watering, until the taro grows to maturity.The application proposes two seedling transplanting methods suitable for baimiao taro, wherein the seed ball seedling method can shorten the field growth period of taro;Another lateral bud seedling transplanting method not only shortens the field growth period of taro, but also reduces the seedling cost and increases the propagation coefficient.The application shortens the growth cycle by using seedling transplanting, and makes up for the influence on the later yield.Summer high temperature and high humidity and diseases can also be inspected and treated by seedling transplanting in seedling stage, greatly reducing the proportion of seedlings with diseases, further reducing the incidence of field diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant transplanting and planting technology, specifically relating to a method for transplanting taro seedlings using wheat stubble land. Background Technology

[0002] In recent years, the planting area and yield of Baimiao taro have decreased sharply, from about 6,000 mu in 2017 to less than 2,000 mu. The reasons for this decline include technical difficulties caused by continuous cropping obstacles, as well as rising input costs and a shortage of agricultural labor. The yield of Baimiao taro cultivated in traditional spring open fields can no longer meet market demand.

[0003] After the summer wheat planting season, the traditional planting method is to intercrop corn. Intercropping can improve the utilization rate of light energy and land, and is conducive to the timely sowing and planting of subsequent crops. However, corn has low economic benefits. Summary of the Invention

[0004] The purpose of this invention is to provide a method for taro seedling cultivation and transplanting in wheat stubble fields. This invention utilizes wheat stubble fields to cultivate Baimiao taro, which can significantly improve economic benefits. This invention also establishes a two-crop-a-year cultivation model in open fields, shortening the growth period of taro in open fields through seedling cultivation, thereby improving the efficiency of taro cultivation.

[0005] To achieve the above-mentioned objectives, the present invention employs the following technical solution:

[0006] This invention provides a method for cultivating and transplanting taro seedlings in wheat stubble fields, the method comprising the following steps:

[0007] (1) Prepare substrate and seedling container, wherein the substrate contains sand, granular slow-release fertilizer, chelated slow-release fertilizer, antibacterial agent and rooting agent, and the moisture content of the substrate is 70%-80%; the seedling container includes seedling bag and seedling box;

[0008] (2) Select taro bulbs or lateral buds for seedling cultivation and transplant them to wheat stubble fields for planting;

[0009] (3) Post-transplanting management: Fertilize and water regularly until the taro grows to maturity.

[0010] Furthermore, the method of raising seedlings using bulbs includes the following steps:

[0011] (1) Seed selection: Select taro tubers with no mechanical wounds or bacterial soft rot lesions on the surface, white cross-section, no discoloration of vascular bundles, and plump apical buds as seed tubers; remove lateral buds, disinfect the seed tubers, and then dry them in the sun;

[0012] (2) Germination: After drying, pack the seeds into a germination room and gradually increase the temperature from 10-15℃ to 22-25℃, keeping it constant; keep the humidity at 80-90%, and germination time is 20-30 days; when the sprouts reach 2cm in length, pick out the sprouts in time, cool down to control growth, and keep the sprouts of uniform size.

[0013] (3) Sowing: Fill the seedling bags with the substrate in sequence, insert the apical bud of the seed taro upward into the substrate, cover the substrate up to the base of the apical bud, leaving 0.5-1cm exposed; put the seedling bags into the seedling box;

[0014] Remove any sprouting lateral buds and cover the seedlings with substrate up to 1 cm above the base of the terminal bud; control the temperature at 20-25℃ during the day and ≥13℃ at night, with an air humidity of 50-70% until seedlings emerge; in the mid-to-late stages, control the seedling height to 15-25 cm; transplant the seedlings to wheat stubble fields for post-transplant management and planting until the taro matures.

[0015] Furthermore: In step (1), 20g-40g of oval taro is selected as seed taro.

[0016] Further: In step (1), the molecular marker icdA is used to identify the bacterial soft rot pathogen in seed potatoes. The sequence of the molecular marker icdA is:

[0017] icdA400F:GGTGGTATCCGTTCTCTGAACG;

[0018] icdA977R: TAGTCGCCGTTCAGGTTCATACA.

[0019] Furthermore, the specific steps for propagating taro seedlings using lateral buds include:

[0020] (1) Take lateral buds: Take one or two lateral buds with roots or root buds at the base, with a thickness of 1-1.5cm, a height of 8-12cm, and a pseudostem length of 1-3cm;

[0021] (2) Transplanting: When the lateral buds have grown to a plant height of 15-25cm, a stem diameter of 1.5-2.0cm, and a leaf area of ​​130-140cm². 2 The number of taro seedlings is 15-20, the fresh weight is 25.0-35.0 g, the leaves are dark green, the color is uniform, and there are no diseases. Transplant the taro seedlings to the harvested spring wheat stubble field.

[0022] (3) Post-transplanting management: Apply organic fertilizer and slow-release granular fertilizer before transplanting. After transplanting, apply slow-release fertilizer and medium-element water-soluble fertilizer, high-nitrogen and high-potassium water-soluble fertilizer respectively during the vegetative growth period, the seedling development period and the taro formation period. Perform segmented water and fertilizer management. After transplanting, mound soil to control the production and growth of lateral buds until the taro matures.

[0023] Furthermore: in step (1), the lateral buds are divided into rooted lateral buds and rootless lateral buds, and are treated separately;

[0024] Treatment of rooted lateral buds: Remove leaves appropriately, cultivate in the shade, maintain water balance, gradually increase light, new roots will develop, the above-ground and underground water will be balanced, and the plant will not wilt. When the ratio of leaf number to root coefficient is 1:3, enter the later stage of growth management.

[0025] Treatment of rootless lateral buds: Take rooting powder and insert it into a seedling bag containing substrate. Water with mineral-derived potassium humate to promote root growth. In the early stage, provide shade by using a 50% shade net from 10:00 to 16:00 every day. Control the temperature to 20-25℃ during the day and 15-20℃ at night. Maintain soil moisture at 60%-70%. Once the leaves have unfolded and new adventitious roots have formed, remove the shade net and proceed with later growth management.

[0026] Furthermore, the physical and chemical properties of the sandy soil are as follows: pH 6.5-6.9, EC 200-250 mS / cm, organic matter content 3.2-3.6%, and bulk density 0.27-0.30 g / cm³. 3 The porosity is 50-55%.

[0027] Furthermore: the seedling bag is made of biodegradable white non-woven fabric, with holes punched in the lower half of the bag. The holes are 2.5-3mm in diameter and spaced 2.2-2.5cm apart, and the bag contains the substrate.

[0028] Furthermore: the seedling box is made of polypropylene foam material, the height of the box is 12cm-30cm, the top is covered, and the bottom of the box is provided with ventilation holes.

[0029] Furthermore: the taro mentioned is Baimiao taro.

[0030] Compared with the prior art, the advantages and technical effects of the present invention are:

[0031] 1. This invention proposes two seedling transplanting methods suitable for Baimiao taro. The bulb seedling method can shorten the field growth period of taro; the lateral bud seedling transplanting method not only shortens the field growth period of taro, but also reduces seedling costs and increases the propagation coefficient.

[0032] 2. The present invention utilizes the technique of centrally removing lateral buds from Baimiao taro bulbs, which can reduce the germination of lateral buds, promote the growth of the main bud seedlings, form larger taro bulbs, and reduce the need for lateral branch removal in the field.

[0033] 3. The planting method provided by this invention uses a foldable EPP plastic foam box with a lid. In early spring, when nighttime temperatures are low, this box provides insulation and is easy to move; moreover, it can be folded after seedling cultivation to reduce space requirements. Simultaneously, using biodegradable non-woven bags for seedling cultivation allows for direct placement into the rows, minimizing damage to the taro seedling roots, reducing the recovery time, and increasing the survival rate. This lays the foundation for mechanized planting. The Baimiao taro substrate seedling box provided by this invention enables large-scale, intensive taro seedling propagation.

[0034] 4. Traditionally, Baimiao taro is grown from bulbs, resulting in a long growth period of 7-8 months. Planting bulbs after wheat stubble shortens the growth cycle and affects yield. This invention, however, uses seedling transplanting to shorten the growth cycle and compensate for the impact on later yield. Furthermore, the high temperature and humidity of summer and the presence of diseases can be mitigated through seedling inspection and centralized disinfection during the transplanting process, significantly reducing the proportion of diseased seedlings and further lowering the incidence of diseases in the field. Attached Figure Description

[0035] Figure 1 This is a structural diagram of a seedling tray;

[0036] Figure 2 It is a Bai Miao taro seed tuber awaiting identification;

[0037] Figure 3 This is the result of identification of bacterial soft rot pathogens carried by seed taro. Detailed Implementation

[0038] The present invention will now be described in detail with reference to specific embodiments. However, the embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited thereto. Example 1

[0039] 1. Substrate preparation

[0040] (1) The base matrix is ​​peat moss and perlite (volume ratio of 3:1).

[0041] (2) Add 20% of the total seedling substrate volume of local mountain sandy soil from Baimiao (physicochemical properties: pH 6.5-6.9, EC 200 ms / cm, organic matter content 3.6%, bulk density 0.27 g / cm³). 3 (Porosity is 50%).

[0042] (3) After mixing, water the mixture to bring the total moisture content to 50%-55%, pile it up to 80cm high, cover the top with a film to keep it moist, and sterilize it at high temperature one week before use. After sterilization, spread out the substrate.

[0043] (4) Prepare granular slow-release fertilizer: Each m³ of substrate requires the following slow-release fertilizer raw materials: 0.8 kg urea + 0.5 kg potassium sulfate + 0.1 kg calcium nitrate + 0.1 kg magnesium sulfate, which are prepared into a saturated solution; the solution is mixed with 10 kg diatomaceous earth to form diatom mud, and granules with a diameter of 0.25-0.3 cm are prepared by pressing.

[0044] (5) Addition of slow-release fertilizer and other auxiliary ingredients: When the moisture content of the loose substrate is 30%-40%, add the required chelated slow-release fertilizer and 50kg of carbonized rice husk. After mixing evenly, add antibacterial agent (the ingredients are Bacillus subtilis and Bacillus amyloliquefaciens in a ratio of 2:1); rooting agent (the formula is to add 1.2g of indoleacetic acid and auxin mixed solution per m³ of substrate in a ratio of 2:1).

[0045] (6) Adjust and maintain the moisture content of the substrate at 70%-80%.

[0046] 2. Seedling containers: Reusable seedling containers for Baimiao taro include seedling bags and seedling boxes.

[0047] Seedling bags: Choose biodegradable white non-woven fabric (material: polypropylene + polyester, density: 25g / ㎡). The seedling bags are 10cm high, 8cm in diameter, and have a capacity of 500cm³. 3 The lower half of the bag is perforated (hole diameter 2.5-3mm, spacing 2.2-2.5cm) and the above-prepared substrate is filled in.

[0048] Seedling box: such as Figure 1 As shown, the material is EPP (polypropylene foam), with a thickness of 2.5cm. The dimensions are 75*50*30cm (length*width*height). The box is extendable vertically, reaching heights of 12cm, 20cm, and a maximum of 30cm to meet the light requirements of different taro seedling stages. The top is covered to provide insulation during low nighttime temperatures in the seedling stage. The box is foldable to save space. There are 54 holes on the bottom of the box for easy drainage and ventilation.

[0049] The seedling bags are placed in the seedling box in sequence, with 54 spaces for placing the seedling bags separated by PC boards. The PC boards are 10cm high and have 54 compartments for easy counting and unified management.

[0050] 3. The method for raising seedlings of Baimiao taro bulbs provided in this embodiment

[0051] The method for cultivating white taro bulbs provided by this invention specifically includes the following steps:

[0052] (1) Select taro tubers with no mechanical wounds or lesions on the surface, white cross-section, no discoloration of vascular bundles, and plump apical buds as seed tubers.

[0053] 1.1 Effects of different shapes and sizes of seed tubers on taro seedling cultivation

[0054] Bai Miao taro seedlings are produced using high-quality, high-yield, and disease-free local varieties from the Bai Miao area of ​​Jimo. Before entering the storage room, the seed tubers are graded according to their shape and size, with a total of 4 grades, represented by DY, DC, XY, and XC, as shown in Table 1. The effects of different shapes and sizes of seed tubers on the germination rate of taro seedlings are shown in Table 2.

[0055] Table 1. Experimental design for seedling raising of different seed taro shapes and sizes

[0056]

[0057] Table 2. Effects of different seed tuber shapes and sizes on emergence rate.

[0058]

[0059] There was no significant difference in the germination rate of taro seedlings among different shapes and sizes of seed taro, indicating that it had no significant impact on taro seedling germination. Considering the need to save seed usage and the economic benefits after harvest, it is advisable to select oval seed taro of 20.0-40.0g for seedling cultivation.

[0060] 1.2 The effects of different shapes and sizes of seed tubers on the growth of taro seedlings are shown in Table 3.

[0061] Table 3. Effects of different taro seed shapes and sizes on taro seedling growth.

[0062]

[0063] Taro seedlings grown using seed tubers of different shapes and sizes all showed good and robust growth, with no significant differences in key agronomic traits such as leaf area and root vigor among the seedlings. This further indicates that, considering the need to save seed usage and post-harvest economic benefits, it is advisable to use oval-shaped seed tubers weighing 20.0-40.0g for seedling cultivation.

[0064] 1.3 Identification of bacterial soft rot pathogens carried by Baimiao taro seed tubers

[0065] Bacterial soft rot is a key disease causing reduced yields or even total crop failure in Baimiao taro. High temperature and humidity in taro cultivation areas easily lead to disease outbreaks, and wounds on the underground corms also increase the chances of infection, resulting in seed tubers carrying the pathogen. The pathogen remains latent during storage and seedling cultivation, causing disease outbreaks after transplanting. Studies have shown that if just 10% of the plants in the field are infected, the amount of bacteria is enough to infect the entire field. Therefore, selecting disease-free, pest-free taro corms without excessively large wounds as seed tubers is crucial.

[0066] Because bacterial soft rot pathogens have a high incidence rate, and incomplete disinfection of seed tubers can lead to infection, infected seed tubers are often undetectable by the naked eye during the incubation period, resulting in a high risk of disease later on. Therefore, identifying bacterial soft rot pathogens in Baimiao taro seed tubers is crucial. This invention utilizes a molecular marker identification method, which offers high detection sensitivity.

[0067] Using 1.5% agarose gel electrophoresis, representative rotten and foul-smelling diseased Bai Miao taro roots were used as positive controls, and healthy taro roots as negative controls. The degree of infection by the bacterial soft rot pathogen of Bai Miao taro was identified using the molecular marker icdA. The icdA sequences are: icdA400F: GGTGGTATCCGTTCTCTGAACG; icdA977R: TAGTCGCCGTTCAGGTTCATACA. The infectivity of Bai Miao taro seed tubers to the bacterial soft rot pathogen was identified using the molecular marker icdA, and the results are as follows: Figure 2 As shown in the figure, the seed tubers to be identified exhibit obvious disease, which is easily identifiable by the naked eye. These samples can be directly removed during seed tuber selection before seedling cultivation. However, seed tubers 2 and 3 cannot be visually identified as carrying bacterial soft rot pathogens. If these are directly stored, sprouted, or used for seedling cultivation, there is a risk of disease development later, potentially infecting other seed tubers in the vicinity. Therefore, it is crucial to use the molecular marker icdA to identify bacterial carriers in sampled seed tubers before cultivating Baimiao taro seedlings.

[0068] from Figure 2 and Figure 3 It can be seen that seed tuber sample No. 1 has no characteristic bands, indicating it is a healthy and sterile seed tuber suitable for seedling cultivation. Seed tubers No. 2, 3, and 4 have characteristic bands, meaning they have been infected by bacterial soft rot fungus. Using the molecular marker icdA, it can be identified that seed tubers No. 2 and No. 3, which do not show phenotypic symptoms, are infected by bacterial soft rot fungus and are in the incubation period. Their germination, seedling cultivation, or planting is at extremely high risk, and further disinfection treatment is required.

[0069] (2) Chemical removal of lateral buds: Select a regulator that enhances apical dominance, add 2.5 mg of auxin and 15 ml of 200 times diluted 33% pendimethalin emulsifiable concentrate per liter of water, soak the whole bulb for 12 hours.

[0070] (3) Disinfection of bulbs: After soaking, the bulbs are coated with a 1-2 mm thick layer of mortar made from 100-mesh wood ash, quicklime, and slurry to disinfect and prevent microbial infection. Then they are placed in a greenhouse to dry.

[0071] (4) Germination: After drying, pack the seeds into boxes. The plastic boxes should be 65*45*30cm (length*width*height), with 6 layers of seeds placed inside the germination chamber. Gradually increase the temperature in the germination chamber from 10-15℃ to 22-25℃ and maintain a constant temperature. Keep the humidity at 80-90% for 20-30 days. When the sprouts reach 2cm in length, pick out the sprouts promptly, cool them down to control growth, and keep the sprouts of uniform size. Once the number of disease-free and strong sprouts selected is sufficient for one batch, sowing and seedling cultivation can begin.

[0072] (5) Sowing

[0073] Bagging: Fill the non-woven fabric seedling bags with the above-mentioned seedling substrate in sequence, filling the substrate to a thickness of about 4cm. Place the seed taro with the top bud facing upwards into the non-woven fabric seedling bag, cover it with substrate, and cover the base of the top bud with substrate, leaving 0.5-1cm exposed. Place multiple seedling bags into the seedling box in sequence.

[0074] After packing, water the plant. When 3-4 lateral buds emerge, apply a mixture of auxin and potassium 3,5-chlorophenoxyate per liter of water. Observe the effect after 5 days. If the lateral buds are not completely removed, a handheld laser can be used to remove the sprouting lateral buds. After 2 days, cover with substrate, ensuring the substrate extends 1 cm above the base of the apical bud.

[0075] The seedling tray lids are placed on the same side, and movable hanging ropes are attached. During the day, they are all opened and folded to one side. At night, when the temperature drops, they can be simultaneously folded up and placed over the seedling trays to maintain the temperature. This achieves integrated management and improves work efficiency. Initially, the height of the trays is maintained at 12cm to ensure sufficient light.

[0076] After sowing, control the temperature inside the greenhouse: 20-25℃ during the day and ≥13℃ at night. Maintain air humidity of 50-70% and soil moisture of around 60% until seedling emergence. If the temperature inside the greenhouse becomes too high, open the ventilation openings promptly.

[0077] In the mid-to-late stages, control the seedling height to 15-25cm. To prevent excessive growth, apply a compound solution of 200mg / L chlormequat chloride and 1500mg / L CaCl2 with irrigation water. Adjust the height of the seedling trays as the seedlings grow. Once the seedlings reach 15-25cm in height, transplant them to wheat stubble fields for post-transplant management until the taro matures.

[0078] Example 2: The method for cultivating lateral buds of Taro from Baimiao provided by the present invention

[0079] The seedling substrate and seedling container used in this embodiment are the same as those shown in Embodiment 1.

[0080] The method for cultivating lateral buds of taro provided by this invention specifically includes the following steps:

[0081] 1. Take lateral buds

[0082] Since taro is transplanted late after wheat harvest, robust lateral buds from spring taro can be used to cultivate lateral bud seedlings in order to save on bulb costs and shorten the seedling period.

[0083] Lateral bud standard: one or two leaves, with roots or root sheaths at the base. Thickness is 1-1.5cm, height is 8-12cm, and pseudostem length is 1-3cm.

[0084] In a field of thriving taro plants, select healthy, disease-free plants and use a small shovel to remove the top layer of soil from the lateral buds down to the point where the lateral buds connect with the bulb. Let them dry for 1 day.

[0085] Take the buds and cut them off at the junction of the lateral bud and the bulb with a knife, trying to keep the root system on the lateral bud intact. After taking the buds, cover the cut of the bulb with wood ash and let it dry for 1-2 days until the wound heals. Then, take the lateral buds and mound soil around the plant in the field and drip irrigate to replenish the water.

[0086] The lateral buds were divided into rooted lateral buds and rootless lateral buds, and were treated separately.

[0087] Treatment of rooted lateral buds: Remove leaves appropriately, cultivate in the shade, maintain water balance, gradually increase light, new roots will develop, the above-ground and underground water will be balanced, and there will be no wilting, indicating survival. When the ratio of leaf number to root coefficient is 1:3, enter the later growth management.

[0088] Treatment of rootless lateral buds: After removal, dip them in a 1000-fold dilution of ABT biological rooting powder, insert them into seedling bags containing substrate, and water with mineral-derived potassium humate to promote root growth. Initially, provide shade by using a 50% shade net from 10:00 AM to 4:00 PM daily, maintaining a daytime temperature of 20-25℃ and a nighttime temperature of 15-20℃. Keep soil moisture at 60%-70%. Once the leaves have unfolded and new adventitious roots have formed, remove the shade net and manage as usual.

[0089] 2. Transplanting

[0090] Transplant seedlings when they have two or three leaves (15-25cm tall). The standard for transplanting lateral buds is a plant height of 15-25cm, stem diameter of 1.5-2.0cm, and leaf area of ​​130-140cm². 2 It has 15-20 roots, a fresh weight of 25.0-35.0 g, dark green leaves with uniform color, and is free from disease.

[0091] Transplant seedlings to harvested spring wheat fields. Use a detachable taro furrowing tool to create furrows 12cm deep. Place the entire seedling bag inside, spacing the rows 75cm apart and the plants 35cm apart. Mechanically mound soil around the seedlings, ensuring the soil reaches just to the center or slightly above it. Plant 2540 seedlings per acre and install drip irrigation pipes for irrigation and fertilization.

[0092] 3. Post-transplanting management

[0093] (1) Fertilization

[0094] Before transplanting, apply base fertilizer 10-12cm deep in the trench, per 667m². 2 Apply 2000 kg of organic fertilizer and 100 kg of granular slow-release fertilizer.

[0095] One month after transplanting (vegetative growth period), apply 5g of slow-release granular fertilizer to each plant at a depth of 15-20cm, and spray with an 800-fold dilution of chlorophyll water-soluble fertilizer containing medium-quantity elements.

[0096] Fertilize during the vegetative growth stage, per 667m² 2 Apply 10-15 kg of high-nitrogen 30-5-5 (NPK) water-soluble fertilizer with irrigation water.

[0097] Fertilize during the tuber formation period, per 667m² 2 Apply 10-20 kg of balanced 20-20-20 (NPK) water-soluble fertilizer and 10-20 kg of high-potassium 15-5-25 (NPK) water-soluble fertilizer in two separate applications with irrigation water.

[0098] (2) Transplanting should be done in summer when temperatures are high, ensuring sufficient water but avoiding excessive irrigation. When temperatures reach 35℃ or higher, turn on the sprinkler system to cool down and suppress high-temperature stress. During the tuber formation period, water every 5-7 days depending on the weather. Stop watering two weeks before harvest.

[0099] (3) Soil-building technique

[0100] About 20 days after transplanting, mound soil around the plant for the first time, to a depth of 5-7cm, to prevent the growth of lateral buds.

[0101] After 25 days, a second round of soil covering was carried out, with a soil depth of 5cm, to further control the growth of lateral buds.

[0102] Using the lateral bud seedling transplanting method provided by this invention, taro plants transplanted after wheat harvest are healthy, with complete seedlings and a survival rate of 99%, yielding a yield of 3073 kg / 666.7 m². 2 The taro balls are perfectly shaped, and the marketability rate reaches 60%.

[0103] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit them. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions of the above embodiments or make equivalent substitutions for some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions claimed by the present invention.

Claims

1. A method for cultivating and transplanting taro seedlings in wheat stubble fields, characterized in that: The seedling transplanting method includes the following steps: (1) Prepare a substrate and a seedling container. The substrate contains sand, granular slow-release fertilizer, chelated slow-release fertilizer, antibacterial agent, and rooting agent. The moisture content of the substrate is 70%-80%. The seedling container includes a seedling bag and a seedling box. The seedling bag is made of biodegradable white non-woven fabric. The lower half of the bag is perforated with a hole diameter of 2.5-3 mm and a spacing of 2.2-2.5 cm. The bag is filled with the substrate. (2) Select lateral buds of taro for seedling cultivation and transplant them to wheat stubble fields for planting; (3) Post-transplanting management: Fertilize and water regularly until the taro grows to maturity; The method for raising taro seedlings from lateral buds specifically includes the following steps: S1: Take lateral buds: Take one or two lateral buds with roots or root bud protrusions at the base, with a diameter of 1-1.5cm, a height of 8-12cm, and a pseudostem length of 1-3cm, and cultivate them; S2: Transplanting: When the lateral buds have grown to a plant height of 15-25cm, stem diameter of 1.5-2.0cm, and leaf area of ​​130-140cm². 2 The number of taro seedlings is 15-20, the fresh weight is 25.0-35.0 g, the leaves are dark green, the color is uniform, and there are no diseases. Transplant the taro seedlings to the harvested spring wheat stubble field. S3: Post-transplanting management: Before transplanting, apply organic fertilizer and slow-release granular fertilizer. After transplanting, apply slow-release granular fertilizer and medium-element water-soluble fertilizer, high-nitrogen and high-potassium water-soluble fertilizer respectively during the vegetative growth period, the seedling development period and the tuber formation period of taro seedlings, and carry out segmented water and fertilizer management. After transplanting, mound soil to control the production and growth of lateral buds until the taro matures. In step S1, the lateral buds are divided into rooted lateral buds and rootless lateral buds, and are treated separately. Treatment of rooted lateral buds: Remove leaves appropriately, cultivate in the shade, maintain water balance, gradually increase light, new roots will develop, the above-ground and underground water will be balanced, and the plant will not wilt. When the ratio of leaf number to root coefficient is 1:3, enter the later stage of growth management. Treatment of rootless lateral buds: After removing rootless lateral buds, dip them in rooting powder and insert them into seedling bags containing substrate. Water with mineral-derived potassium humate to promote root growth. In the early stage, provide shade by using a 50% shade net from 10:00 to 16:00 every day. Control the temperature to 20-25℃ during the day and 15-20℃ at night. Maintain soil moisture at 60%-70%. Once the leaves have unfolded and new adventitious roots have formed, remove the shade net and proceed with later growth management. The taro mentioned is Baimiao taro.

2. The method for raising and transplanting taro seedlings in wheat stubble land according to claim 1, characterized in that: The physical and chemical properties of the sandy soil are as follows: pH 6.5-6.9, EC 200-250 mS / cm, organic matter content 3.2-3.6%, and bulk density 0.27-0.30 g / cm³. 3 The porosity is 50-55%.

3. The method for raising and transplanting taro seedlings in wheat stubble land according to claim 1, characterized in that: The seedling box is made of polypropylene foam material, with a height of 12cm-30cm, a lid on top, and ventilation holes at the bottom.

Citation Information

Patent Citations

  • Full-element, drought-resistant, water-retaining and slow-release composite substrate capable of regulating growth

    CN106699314A