Chinese medicine composition for preventing and treating chicken infectious bronchitis and preparation method and application thereof

By preparing a traditional Chinese medicine composition containing ephedra, almond, licorice and other medicinal materials, the treatment problem of infectious bronchitis in chickens has been solved, achieving efficient and safe prevention and treatment effects, reducing viral load and organ damage in chicks, and promoting the growth and health recovery of chickens.

CN118217361BActive Publication Date: 2025-11-25FOSHAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410245269.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-05
Publication Date
2025-11-25
Estimated Expiration
2044-03-05

AI Technical Summary

Technical Problem

Current technology lacks effective traditional Chinese medicine compositions for treating infectious bronchitis in chickens, and existing antiviral drugs have issues with drug resistance and residues, affecting chicken growth and production performance and posing a threat to food safety.

Method used

A traditional Chinese medicine composition consisting of ephedra, apricot kernel, licorice, coix seed, forsythia, honeysuckle vine, white peony root, smilax glabra, and violet is extracted and prepared into tablets, capsules, oral liquids, granules, or pills through a specific process for the prevention and treatment of infectious bronchitis in chickens.

Benefits of technology

It significantly improves the survival rate of chicks, alleviates the decline in weight gain, reduces the viral load in the trachea and kidney tissues, reduces organ pathological damage, promotes the body's recovery, and has no toxic side effects or drug residues, making it suitable for large-scale production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118217361B_ABST
    Figure CN118217361B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of veterinary medicine, and specifically discloses a traditional Chinese medicine composition for preventing and treating chicken infectious bronchitis, a preparation method and application thereof. The traditional Chinese medicine composition is composed of the following raw materials in parts by weight: Ephedra 12 parts, apricot kernel 12 parts, licorice 9 parts, coix seed 30 parts, forsythia 12 parts, honeysuckle 20 parts, white eupatorium 12 parts, smilax 20 parts, and purple violet 6 parts. The composition can be used for preventing and treating artificially infected IBV chicks, and can significantly improve the survival rate of chicks, alleviate the decrease in body weight growth caused by IBV, relieve clinical symptoms, reduce the viral load in trachea and kidney tissues, reduce organ pathological damage, and promote the recovery of the body. The traditional Chinese medicine composition for preventing and treating chicken infectious bronchitis is easy to obtain, rich in resources, low in cost, safe, non-toxic and non-residual, and the preparation method is simple and suitable for large-scale production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of veterinary drugs, and in particular to traditional Chinese medicine compositions for the prevention and treatment of infectious bronchitis in chickens, their preparation methods, and applications. Background Technology

[0002] Avian infectious bronchitis (IB) is an acute, highly contagious disease caused by the avian infectious bronchitis virus (IBV). It can cause damage to multiple organs, including the trachea, kidneys, reproductive tract, and digestive tract. The main symptoms include decreased weight gain in chicks, stunted growth, reduced feed conversion ratio, secondary bacterial infections, and decreased egg production and quality in laying hens. This disease is widespread globally, and chickens of all ages are susceptible. The mortality rate in chicks can reach 30%, severely impacting growth and production performance and causing significant economic losses to the poultry industry.

[0003] Currently, there are no specific therapeutic drugs for IB, and vaccination remains the main effective measure for prevention and control. However, the IBV genome is prone to mutation and recombination, and the cross-protective efficacy between diverse serotypes is weak. Furthermore, existing antiviral chemical drugs such as ribavirin and antiviral agents are prohibited in livestock and poultry farming. Current strategies for dealing with IBV in production mainly involve treating complications caused by viral infection with antibiotics; however, the widespread use of broad-spectrum antibiotics in the livestock industry has led to increasing antibiotic resistance and public health problems. Traditional Chinese medicine (TCM) has the advantages of fewer toxic side effects and no drug residues. The Ministry of Agriculture and Rural Affairs, in its guidelines for promoting the healthy development of the veterinary drug industry, clearly stated the need to accelerate the development of the TCM veterinary drug industry to ensure food and public health safety. Developing a compound TCM formula for treating infectious bronchitis in chickens through rational screening and formulation of traditional Chinese medicines has significant practical significance and application prospects.

[0004] Chinese patent application CN201310465972.3 discloses a traditional Chinese medicine for treating infectious bronchitis in broilers. This medicine is composed of the following raw materials by weight percentage: honeysuckle 10-13%, forsythia 8-10%, isatis root 10-12%, houttuynia cordata 12-15%, scutellaria baicalensis 8-10%, wild chrysanthemum 10-13%, bupleurum seedlings 23-25%, kudzu root 8-10%, and licorice root 5-10%. The raw materials are mixed, pulverized, passed through an 80-100 mesh sieve, and packaged. However, the efficacy of the raw materials used in this traditional Chinese medicine for treating infectious bronchitis in broilers is lacking, and its effective preventive and therapeutic effects cannot be determined. Summary of the Invention

[0005] To address the aforementioned technical problems, this invention provides a traditional Chinese medicine composition for the prevention and treatment of infectious bronchitis in chickens, along with its preparation method and application. This composition effectively improves the survival rate of chickens, alleviates reduced weight gain caused by IBV, relieves clinical symptoms, reduces viral load in tracheal and kidney tissues, reduces organ pathological damage, and promotes bodily recovery. It exhibits significant efficacy against IB, is simple to prepare, has no toxic side effects, does not induce drug resistance, and leaves no residue. Furthermore, it ensures food safety while treating and preventing infectious bronchitis.

[0006] To achieve the above objectives, the present invention is implemented according to the following technical solution:

[0007] One of the objectives of this invention is to provide a traditional Chinese medicine composition for the prevention and treatment of infectious bronchitis in chickens, which is composed of the following raw materials in parts by weight: 12 parts ephedra, 12 parts apricot kernel, 9 parts licorice, 30 parts coix seed, 12 parts forsythia, 20 parts honeysuckle vine, 12 parts white peony root, 20 parts smilax glabra, and 6 parts violet.

[0008] The second objective of this invention is to provide a method for preparing a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens, comprising the following steps:

[0009] S1. Mix 12 parts by weight of ephedra, 12 parts by weight of apricot kernel, 9 parts by weight of licorice, 30 parts by weight of coix seed, 12 parts by weight of forsythia, 20 parts by weight of honeysuckle vine, 12 parts by weight of white peony root, 20 parts by weight of smilax glabra, and 6 parts by weight of violet to obtain a mixture. Soak the mixture in distilled water to obtain a soaking material.

[0010] S2. The obtained soaking material is kept at 95-105℃ for 1 hour, filtered, and the first filtrate and the first filter residue are obtained.

[0011] S3. Mix the obtained first filter residue with distilled water at 50°C, keep at 95-105°C for 45 minutes, filter, and obtain the second filtrate.

[0012] S4. The first and second filtrates are mixed to obtain a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens.

[0013] Preferably, in step S1, the mass ratio of the mixture to distilled water is 1:10 to 15.

[0014] Preferably, in step S1, the temperature of the distilled water is 25°C and the soaking time is 30 minutes.

[0015] Preferably, in step S3, the mass ratio of the first filter residue to distilled water at 50°C is 1:5 to 7.

[0016] The third objective of this invention is to provide a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens, used in the preparation of a drug for treating infectious bronchitis in chickens, wherein the dosage form of the drug for treating infectious bronchitis in chickens is one of tablets, capsules, oral liquids, granules, or pills.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] 1. The application of the traditional Chinese medicine composition described in this invention for the prevention and treatment of artificially infected IBV chicks can significantly improve chick survival rate, alleviate IBV-induced weight loss, relieve clinical symptoms, reduce viral load in tracheal and kidney tissues, reduce organ pathological damage, and promote recovery. The traditional Chinese medicine composition of this invention uses readily available, abundant, low-cost, safe, non-toxic, and residue-free medicinal materials. Its preparation method is simple and suitable for large-scale production; furthermore, administration via drinking water is convenient.

[0019] 2. The traditional Chinese medicine composition of the present invention is safe and residue-free. Under the conditions of the banning of existing antiviral drugs such as ribavirin, the increasing prominence of antibiotic resistance and production safety issues, its use in the treatment of infectious bronchitis in chickens can effectively reduce the economic losses of farmers, which is in line with the development direction of green and antibiotic-free farming, and provides a new approach for the prevention and treatment of infectious bronchitis in chickens. Attached Figure Description

[0020] Figure 1 A represents the anti-IBV effect of XDS in chicken embryos; B represents the clinical symptom score; C represents the survival rate of chicks; D represents the difference in body weight gain; E represents the trend of body weight gain; F represents the trend of viral load change in tracheal tissue; and F represents the trend of viral load change in kidney tissue.

[0021] Figure 2 These are pathological autopsy images and H&E stained sections.

[0022] Figure 3 This represents the expression levels of signal transduction genes and cytokines. Detailed Implementation

[0023] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0024] All Chinese herbal raw materials used in the following examples were commercially available.

[0025] Example 1: Preparation of a traditional Chinese medicine composition for the prevention and treatment of infectious bronchitis in chickens

[0026] Weigh out 12g of ephedra, 12g of apricot kernel, 9g of licorice, 30g of coix seed, 12g of forsythia, 20g of honeysuckle vine, 12g of white peony root, 20g of smilax glabra, and 6g of violet. Mix them evenly in a container, add 500ml of 25℃ distilled water, soak for 30 minutes, heat to boiling and maintain for 1 hour, collect the extract and residue, add 250ml of 50℃ distilled water to the residue again, heat to boiling and maintain for 45 minutes, collect the extract; mix the two extracts and filter to obtain the extract of the traditional Chinese medicine composition, hereinafter referred to as XDS.

[0027] Example 2: Application of traditional Chinese medicine composition for the prevention and treatment of infectious bronchitis in chickens in the preparation of drugs for treating infectious bronchitis in chickens. This example uses an oral liquid preparation as an example.

[0028] To verify whether the traditional Chinese medicine composition described in the above embodiments can be used to prepare a drug for treating infectious bronchitis in chickens, the following experiment was conducted.

[0029] Experimental Example 1: Evaluation of the antiviral effect of XDS embryos

[0030] Experimental materials: 25 9-day-old SPF chicken embryos, provided by Xinxing Dahua Agricultural Poultry and Egg Co., Ltd.

[0031] IBV strain: gx2021 / 12-z (EID) 50 =10 -6.8 / 0.1mL, NCBI Registry Number: OP846990).

[0032] Experimental drug: XDS prepared in Example 1 was selected.

[0033] Experimental Methods: Twenty-five 9-day-old SPF chicken embryos were randomly divided into six groups: a 2-fold dose group, a 1-fold dose group (containing 0.665 g / 0.1 ml of raw drug), a 1 / 2-fold dose group, a 1 / 4-fold dose group, and a PBS group, with five embryos in each group. Each treatment group received 0.1 mL of IBV virus solution per embryo. -1 Mix with the corresponding dose of drug solution and incubate at room temperature for 30 min. For the PBS group, mix with an equal volume of PBS and inoculate via the allantoic cavity. Incubate at 37°C for 36 h. Collect the allantoic fluid and extract total RNA from the samples using the TRIzol method. Using the extracted total RNA as a template, specific primers are used:

[0034] F: GGCGAGCGGTAAAGCAACTG;

[0035] R:GCATTTCCAGATGACCCTACCTTAG;

[0036] Viral load was detected by RT-qPCR. The reaction system consisted of 0.4 μL each of upstream and downstream primers, 2 μL of template RNA, 10 μL of 2×One Step RT-qPCR SYBR Green Master Mix, and 7.2 μL of ddH2O. The amplification program was: 60℃ for 5 min; 95℃ for 30 s, 95℃ for 5 s, 60℃ for 30 s, for 40 cycles. Standards were prepared by amplifying the target fragment using the specific primers described above via RT-PCR, recovering the PCR product after agarose gel electrophoresis, and then comparing it with pMD... TM The 18-T vector was ligated and amplified to obtain recombinant plasmids. Standard curves were constructed using standards serially diluted 10-fold. Each sample was tested three times, and the average value was taken. Standard copy number (copies·μL) -1 )=(6.023×10 23 copies·mol -1 × Plasmid concentration (g·μL) -1 ) / (number of bases × 660 g·mol -1 ).

[0037] Experimental results: such as Figure 1 As shown in A: Allantoic fluid from chicken embryos in each group was extracted after 36 hours and the viral load was detected by RT-qPCR. The results showed that the viral load in the allantoic fluid of each treatment group was significantly lower than that in the PBS group. The viral load decreased with increasing dosage, indicating that XDS has an inhibitory effect on IBV in a dose-dependent manner.

[0038] Example 2: Evaluation of in vivo anti-IBV efficacy

[0039] Experimental animals: 45 healthy 1-day-old Nanhai Ma Huang chickens, purchased from Nanhai Poultry Breeding Farm in Nanhai District, Foshan City, Guangdong Province, and acclimatized for 15 days.

[0040] Virus: IBV strain: gx2021 / 12-z (EID) 50 =10 -6.8 / 0.1mL, NCBI Registry Number: OP846990).

[0041] Experimental drug: XDS prepared in Example 1 was selected.

[0042] Experimental Methods: Sixty Nanhai Ephedra chicks were randomly divided into four groups: prevention group, treatment group, challenge group, and negative control group, with 15 chicks in each group. The prevention group, treatment group, and challenge group were inoculated with 0.1 mL of IBV strain per chick via nasal or ocular drops at 15 days of age (0 dpi). 1The negative control group was inoculated with the same dose of PBS. The prevention group was administered the drug at a dose of 3.24 g / day per bird starting at 12 days of age, for 3 consecutive days. The treatment group was administered the same dose 1 day after challenge, for 5 consecutive days. Chicks were isolated and allowed free access to feed and water. At 3, 7, and 14 days after challenge, 5 chicks from each group were randomly selected for cardiac blood collection and necropsy. Kidneys and tracheas were collected and cryopreserved for RNA extraction. Starting from 1 day post-infection (dpi), chick weight was continuously monitored, and clinical symptoms were observed and scored. The scoring criteria were: 1. Mild chills, mild runny nose, mild tearing; 2. Depression, watery stools, sneezing or coughing, severely reduced appetite; 3. Severe depression, severe nasal discharge, tracheal rales, or open-mouth breathing; 4. Death. Total RNA was extracted from tissue samples using the TRIzol method. Using total RNA extracted from organ tissues as a template and β-actin as an internal reference gene, RT-qPCR was performed using specific primers. The preparation method for the standard reference was the same as above. The formula for calculating the relative expression level of a gene is: Relative expression level of the target gene = 2^[-(Target gene Ct value - Internal reference gene Ct value)]. All data are expressed as mean ± standard error. The obtained data were analyzed using SPSS (22.0) one-way ANOVA, with t-tests for significance, and GraghPad Prism (5.0) for plotting. "a, b, c, d" indicate significant differences.

[0043] Experimental results:

[0044] Clinical symptoms, survival rate and weight gain

[0045] During the observation period, no clinical symptoms were observed in the negative control group. Chicks in each challenge group began to exhibit clinical symptoms such as depression, head shaking, coughing, decreased appetite, and open-mouth breathing 1 day after IBV infection (1 dpi). These symptoms peaked at 3-4 dpi. In the prevention group, there was no significant difference in clinical symptoms between the prevention and treatment groups from 0-3 dpi. From 4 dpi onwards, the prevention group's clinical symptoms were more severe than the treatment group, but milder than the simple challenge group. In the treatment group, symptoms largely disappeared by 8 dpi. The consistently high clinical symptom scores in the challenge group during the observation period indicated a lower risk than the treatment group. In the simple challenge group, one chick died at each of 11, 12, and 14 dpi, with a mortality rate of 20%. During the observation period, there was no significant difference in chick weight gain at 3 and 7 dpi. At 14 dpi, there was a significant difference in weight between the challenge group and the negative control group (P<0.05). There were no significant differences in weight gain among the other groups. The differences in clinical symptoms among the chicks in each group are as follows: Figure 1 As shown in B, the survival rate is as follows: Figure 1 As shown in C, weight gain is as follows Figure 1 As shown in D in the diagram.

[0046] Viral load detection

[0047] Tracheal and kidney tissues were selected at 3 dpi, 7 dpi, and 14 dpi, and viral load in each organ tissue was detected by RT-qPCR at different time points. The results are as follows: Figure 1 As shown in Figures E and F. The results showed that no virus was detected in the trachea and kidney tissues collected from the negative control group. Compared with the treatment group, the viral copy number in the trachea and kidney tissues of the challenge group was higher at all time points. These experimental results indicate that the application of XDS to treat IBV-infected chicks can effectively reduce the viral load in tissues.

[0048] Symptoms of autopsy

[0049] Pathological necropsy was performed on chicks in each group to observe the differences in pathological changes among different treatment groups. The necropsy results are as follows: Figure 2 As shown: No pathological changes were observed in the negative control group. No obvious abnormalities were found in the trachea of ​​the chicks in the treatment group at 7 dpi. The trachea of ​​the chicks in the challenge group showed obvious congestion and yellow mucus in the trachea. The kidney necropsy results at 14 dpi showed that no obvious abnormalities were found in the kidneys of the chicks in the treatment group. The kidneys of the challenge group were pale and swollen with urate deposition, showing typical "mottled kidney" changes.

[0050] Histopathological changes

[0051] After appropriate treatment, parts of the trachea and kidneys of the chicks in each group were fixed with 4% formalin solution. Tracheal and kidney tissue samples were selected at 7 dpi for histopathological examination. The histopathological results are as follows: Figure 2 As shown in the results: No pathological damage was observed in the trachea and kidney tissues of the negative control group. Compared with the challenge group, the tracheal mucosa layer of the IBV-infected treatment group was relatively intact. In the challenge group, local epithelial cell shedding and necrosis were observed in the tracheal tissue, and a large number of inflammatory cells infiltrated the lamina propria. No obvious abnormalities were observed in the kidney tissue of the 14-day treatment group, while a large number of inflammatory cells infiltrated the renal interstitium, some glomerular structures were destroyed, and some tubular epithelial cells showed degeneration and necrosis. These experimental results indicate that the application of XDS to treat artificially infected IBV chicks can effectively reduce tracheal and kidney tissue damage.

[0052] Expression levels of signal transduction genes and cytokines

[0053] The results of the relative differences in the expression of immune-related genes in chick tissues at different time points during the observation period are as follows: Figure 3As shown in the figure, in the TLR7 pathway, compared with the challenge group, the relative expression levels of MAVs, TLR7, MyD88, IRF7, IFN-α, IFN-β, JAK, and STAT1 genes in the tracheal tissue of the treatment group were significantly higher than those in the challenge group at all time points, except for the IFN-α expression level at 14 dpi, which showed no significant difference from the challenge group. Specifically, the expression levels of related genes in the prevention group were higher than those in the challenge group at 3 dpi and 7 dpi, but lower than those in the treatment group. Furthermore, compared with the challenge group, the relative expression levels of inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-12 in the kidney tissue of chicks in the treatment group were significantly lower. These results suggest that XDS may exert its antiviral, immune-regulating, and tissue-damage-reducing effects by increasing the expression levels of TLR7 pathway-related genes and decreasing the expression levels of cytokines TNF-α, IL-1β, IL-6, and IL-12-related genes.

[0054] The above experimental results demonstrate that the traditional Chinese medicine composition of the present invention has a good anti-IBV effect, which can significantly improve the survival rate of chicks, alleviate the reduction in weight gain caused by IBV, alleviate clinical symptoms, reduce the viral load in tracheal and kidney tissues, reduce organ pathological damage, and promote the body's recovery.

[0055] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

1. A traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens, characterized in that, It is composed of the following ingredients in parts by weight: 12 parts ephedra, 12 parts apricot kernel, 9 parts licorice, 30 parts coix seed, 12 parts forsythia, 20 parts honeysuckle vine, 12 parts white peony root, 20 parts smilax glabra, and 6 parts violet.

2. A method for preparing a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens as described in claim 1, characterized in that, Includes the following steps: S1. Mix 12 parts by weight of ephedra, 12 parts by weight of apricot kernel, 9 parts by weight of licorice, 30 parts by weight of coix seed, 12 parts by weight of forsythia, 20 parts by weight of honeysuckle vine, 12 parts by weight of white peony root, 20 parts by weight of smilax glabra, and 6 parts by weight of violet to obtain a mixture. Soak the mixture in distilled water to obtain a soaking material. S2. The obtained soaking material is kept at 95-105℃ for 1 hour, filtered, and the first filtrate and the first filter residue are obtained. S3. Mix the obtained first filter residue with distilled water at 50°C, keep at 95-105°C for 45 minutes, filter, and obtain the second filtrate. S4. The first and second filtrates are mixed to obtain a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens.

3. The method for preparing the traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens according to claim 2, characterized in that: In step S1, the mass ratio of the mixture to distilled water is 1:10 to 15.

4. The method for preparing the traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens according to claim 2, characterized in that: In step S1, the temperature of the distilled water is 25°C, and the soaking time is 30 minutes.

5. The method for preparing the traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens according to claim 2, characterized in that: In step S3, the mass ratio of the first filter residue to distilled water at 50°C is 1:5 to 7.

6. The use of a traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens as described in claim 1 in the preparation of a drug for treating infectious bronchitis in chickens.

7. The application of the traditional Chinese medicine composition for preventing and treating infectious bronchitis in chickens according to claim 6 in the preparation of drugs for treating infectious bronchitis in chickens, characterized in that: The dosage form of the drug for treating infectious bronchitis in chickens is one of the following: tablets, capsules, oral liquids, granules, or pills.

Citation Information

Patent Citations

  • Traditional Chinese medicine for treating infectious tracheobroncheitis of broilers

    CN103463282A

  • Traditional Chinese medicine composition for preventing and treating infectious bronchitis as well as preparation method and application of traditional Chinese medicine composition

    CN116459302A