A method for detecting NF1 gene mutations by multi-gene combination
The detection of NF1 gene mutations, including LR-PCR and multiple PCR, solved the problem of difficulty in diagnosis of NF1 gene mutations in the prior art, achieved differential diagnosis of Legius syndrome, Noonan syndrome and structural mismatch repair defect syndrome, and improved the detection accuracy.
Patent Information
- Application Number
- CN202410402869.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-03
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2044-04-03
AI Technical Summary
现有技术中缺少对Legius综合征、Noonan综合征和结构性错配修复缺陷综合征的鉴别诊断方法,导致NF1基因突变诊断困难。
Multi-gene combination detection methods were used, including LR-PCR detection of NF1 gene and multiplex PCR detection of SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes. Combined with DNA extraction, long fragment amplification, library preparation, PE150 sequencing and data analysis, variant verification was performed through the Burrows-Wheeler Aligner MEM algorithm and GATK HaplotypeCaller and other software.
The full-length coverage of the NF1 gene was achieved and the breakpoints of microdeletion of various types of NF1 whole genes was covered, which improved the differential diagnosis ability of Legius syndrome, Noonan syndrome and structural mismatch repair defect syndrome, and the detection accuracy was more than 95%.
Smart Images

Figure BDA0004776169760000021 
Figure BDA0004776169760000031 
Figure BDA0004776169760000041
Abstract
Description
Technical Field
[0001] The embodiments of the present invention relate to the technical field of nucleic acid detection, and specifically to a method for detecting NF1 gene mutations by multi-gene combination. Background Art
[0002] The NF1 gene encodes neurofibromin, which is located at 17q11.2 and is a large gene of 287 Kb. At present, two main variants of NF1 transcripts have been identified, which contain 57 and 58 exons respectively (subtype 1: NM_000267.3 and subtype 2: NM_001042492.3). Due to the large size of the NF1 gene, there are multiple highly identical pseudogenes, lack of mutation hotspots, complex mutation spectra, and many patients show mosaic mutations, so molecular diagnosis is challenging. Whole gene deletions are detected in 5%-11% of patients, but there are two main types of whole gene deletions with relatively fixed breakpoint hotspots. NF1 microdeletion syndrome can be divided into 4 subtypes: type 1 deletion, type 2 deletion, type 3 deletion, and atypical deletion. The first three are recurrent deletions. The most common type is the 1.4 Mb type 1 deletion (accounting for 70%-80%), and its breakpoints are located in two low copy repeats (LCRs) flanking the NF1 gene, namely NF1-REPa and NF1-REPc. The 1.2 Mb type 2 deletion (10%-20%) has breakpoints located in the SUZ12P and SUZ12 gene regions respectively. The rarest is the 1.0 Mb type 3 deletion (1.4%-4%), and its breakpoints are located in NF1-REPb and NF1-REPc respectively.
[0003] Due to having the same symptoms such as CALMs (café-au-lait macules) as NF1 patients, such as Legius syndrome, McCune-Albright syndrome, neurofibromatosis type II, Noonan syndrome, and structural mismatch repair deficiency syndrome, etc., it is necessary to distinguish NF1 patients from other similar syndromes during diagnosis. In the prior art, there are already independent panels for detecting NF2 and GNAS in McCune-Albright syndrome and neurofibromatosis type II, but there is a lack of methods for differential diagnosis with Legius syndrome, Noonan syndrome, and structural mismatch repair deficiency syndrome, resulting in the inability to distinguish them. Summary of the Invention
[0004] Therefore, the embodiments of the present invention provide a method for detecting NF1 gene mutations by multi-gene combination to solve the problem of inability to distinguish from Legius syndrome, Noonan syndrome, and structural mismatch repair deficiency syndrome due to the lack of methods for differential diagnosis in the prior art.
[0005] To achieve the above object, the embodiments of the present invention provide the following technical solutions:
[0006] The present invention provides a method for detecting NF1 gene mutations by multi-gene combination, the method comprising: LR-PCR detection of the NF1 gene; multiplex PCR detection of the SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes;
[0007] The LR-PCR detection of the NF1 gene and the multiplex PCR detection of the SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes include the following steps: DNA extraction, long fragment amplification, library preparation, PE150 sequencing, data analysis, and variant verification.
[0008] Further, the sample used for DNA extraction is blood or tissue, and the reagents used include: cell lysate, saturated phenol, phenol-chloroform, sodium acetate, isopropanol, 70% ethanol, and 75% ethanol.
[0009] Further, the long fragment amplification is a two-step PCR cycle, including the first round of amplification, purification of the first-round amplification product, the second round of amplification, and purification of the second-round amplification product.
[0010] Further, the primers used in the two-step PCR cycle for the LR-PCR detection of the NF1 gene include 24 pairs of NF1 amplification primers, which are divided into 4 multi-groups A, B, C, and D, and their base sequences are shown in Table 1:
[0011] Table 1
[0012]
[0013]
[0014]
[0015] Among them, in the first step of the PCR reaction, the DNA double strand is gradually denatured and opened. In the second step of annealing, the two primers each bind to their complementary strand ends through base complementarity, and in the third step of the extension reaction, new bases are continuously added at the primer ends to continuously extend forward. The purpose of using the upstream and downstream primers is to specifically replicate the specific sequence of the target gene. If only one of the primers is used for PCR, the length of the obtained product is random. Dividing them into 4 multi-groups is for reaction amplification in groups, that is, the primers within the group are amplified in one tube.
[0016] Furthermore, the amplification primers used in the two-step PCR cycle for multiplex PCR detection of the SPRED1, GNAS, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes, and each amplicon has two amplification primers, upstream and downstream, and their base sequences are shown in Table 2:
[0017] Table 2
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030] Among them, the primer sequences in Target.1-26 correspond to the PTPN11 gene, Target.27-41 correspond to the SPRED1 gene, Target.42-76 correspond to the MSH2 gene, Target.77-107 correspond to the MSH6 gene, Target.108-138 correspond to the GNAS gene, Target.139-171 correspond to the MLH1 gene, and Target.172-201 correspond to the PMS2 gene.
[0031] Furthermore, the library preparation step includes: using an enzyme digestion kit for enzyme digestion and library construction, and the target fragment length is 300 bp.
[0032] Furthermore, the PE150 sequencing step is: using a Genolab_M sequencer for PE150 sequencing.
[0033] Further, the data analysis steps are as follows: The FASTQ file is aligned with the reference genome hg38 using the Burrows—Wheeler Aligner MEM algorithm; Germline variations are analyzed for SNV and indel variations using GATK HaplotypeCaller; Somatic variations are analyzed for SNV and indel variations using Vardict software, and variant annotation is performed using SnpEff. Variant analysis is carried out with reference to the variant classification guidelines published by ACMG and AMP.
[0034] Further, the variant verification steps are as follows: Sanger sequencing is used to verify positive SNV / indel variations; FQ-PCR method is used to verify CNV.
[0035] The embodiments of the present invention have the following advantages:
[0036] 1. In the detection of the NF1 gene, genes such as SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 are added. The detection of these genes helps in making a clear diagnosis and differentiating diagnoses from diseases such as Legius syndrome, Noonan syndrome, and structural mismatch repair deficiency syndrome.
[0037] 2. The LR-PCR detection of the NF1 gene achieves full-length coverage of the NF1 gene and covers the breakpoints of two types of NF1 whole-gene microdeletions, namely, the most common type is the type I deletion of 1.4 Mb; The multiplex PCR detection of genes SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 covers the CDS regions of genes SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 and the pathogenic or likely pathogenic sites of these genes located in the non-coding regions included in the ClinVar and HGMD databases. Specific Embodiments
[0038] The following specific embodiments illustrate the implementation manners of the present invention. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts fall within the scope of protection of the present invention.
[0039] Example 1
[0040] I. LR-PCR Detection of NF1 Gene
[0041] 1. DNA Extraction
[0042] The DNA extraction from the blood sample is carried out by the following steps:
[0043] 1) Collect a whole blood sample containing 15% EDTA;
[0044] 2) Add 1 mL of blood to 5 times the volume of red blood cell lysate to remove red blood cells for 30 minutes;
[0045] 3) Add cell lysate and proteinase K, mix well, and place in a 50°C water bath for 3 hours;
[0046] 4) Transfer the digested liquid into a 1.5 mL EP tube, add an equal volume of saturated phenol, mix well, and centrifuge at 14000 rpm for 5 minutes;
[0047] 5) Aspirate the supernatant and transfer it to another EP tube, add an equal volume of phenol-chloroform (saturated phenol and chloroform-ethanol 1:1), mix well, and centrifuge at 14000 rpm for 5 minutes;
[0048] 6) Transfer the supernatant to another EP tube, add 1 / 10 volume of NaAC (sodium acetate) and an equal volume of isopropanol, mix well, and place in a -20°C refrigerator for 3 hours;
[0049] 7) Centrifuge at 14000 rpm for 10 minutes and discard the supernatant;
[0050] 8) Add 1 mL of 70% ethanol, gently shake several times, centrifuge at 14000 rpm for 10 minutes, discard the supernatant to obtain DNA;
[0051] 9) Wash the DNA with 70% ethanol once more;
[0052] 10) Place the washed DNA in a laminar flow hood to dry for 10 minutes;
[0053] 11) Add 50 μL of deionized water to dissolve the precipitated DNA and store it at -20°C.
[0054] The extracted DNA can be stored at -25 to -15°C for no more than 6 months and at -70°C or below for 12 months without repeated freezing and thawing.
[0055] 2. Long fragment amplification
[0056] Twenty-four pairs of primers were used to perform multiplex long-fragment PCR amplification on the full-length 290 kb gene of NF1 and the breakpoint of type I microdeletion in four groups. Each PCR reaction in the 4 multiplex groups (A, B, C, D) contained 20 μL of 10 ng / μL genomic DNA in a 1 μL reaction volume, and a high-fidelity enzyme PCR kit was used for two-step PCR cycling: after an initial denaturation at 94 °C for 2 minutes, there were 35 cycles, with 10 seconds at 98 °C and 10 minutes at 68 °C, and the total running time was 6 hours and 11 minutes. In order to obtain uniform amplification products in multiplex long PCR, the concentration of each primer needs to be adjusted through experimental testing.
[0057] 3. Library Preparation
[0058] A commercial enzyme digestion kit was used for enzyme digestion fragmentation and library construction, with the target fragment length of about 300 bp.
[0059] 4. PE150 Sequencing
[0060] PE150 sequencing was performed using a Genolab_M sequencer to achieve almost complete coverage of the detection region, with an average sequencing depth of more than 500X, a 200X coverage of ≥ 98%, and a 100X coverage of ≥ 99%.
[0061] 5. Data Analysis
[0062] The FASTQ files were aligned with the reference genome (hg38) using the Burrows—Wheeler Aligner MEM algorithm. Germline variations were analyzed for SNV and indel variations using the GATK HaplotypeCaller, and somatic variations were analyzed for SNV and indel variations using the Vardict software. SnpEff was used for variant annotation, and variant analysis was performed with reference to the variant classification guidelines published by ACMG and AMP.
[0063] 6. Variant Validation
[0064] Sanger sequencing was used to validate positive SNV / indel variations, and the FQ-PCR method was used to validate CNV.
[0065] II. Multiplex PCR Detection of SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 Genes
[0066] 1. DNA Extraction
[0067] The following steps were used to extract DNA from blood samples:
[0068] 1) Collect whole blood samples containing 15% EDTA;
[0069] 2) Add 1 mL of blood to 5 times the volume of red blood cell lysis buffer and incubate for 30 minutes to remove red blood cells;
[0070] 3) Add cell lysis buffer and proteinase K, mix well, and incubate in a 50 °C water bath for 3 hours;
[0071] 4) Transfer the digested liquid into a 1.5 mL EP tube, add an equal volume of saturated phenol, mix well, and centrifuge at 14000 rpm for 5 minutes;
[0072] 5) Aspirate the supernatant and transfer it to another EP tube, add an equal volume of phenol-chloroform (saturated phenol and chloroform-isoamyl alcohol 1:1), mix well, and centrifuge at 14000 rpm for 5 minutes;
[0073] 6) Transfer the supernatant to another EP tube, add 1 / 10 volume of NaAC (sodium acetate) and an equal volume of isopropanol, mix well, and place in a -20 °C refrigerator for 3 hours;
[0074] 7) Centrifuge at 14000 rpm for 10 minutes and discard the supernatant;
[0075] 8) Add 1 mL of 70% ethanol, gently shake a few times, centrifuge at 14000 rpm for 10 minutes, discard the supernatant to obtain DNA;
[0076] 9) Wash the DNA with 70% ethanol once more;
[0077] 10) Place the washed DNA in a laminar flow hood to dry for 10 minutes;
[0078] 11) Add 50 μL of deionized water to dissolve the precipitated DNA and store it at -20 °C.
[0079] The extracted DNA can be stored at -25 to -15 °C for no more than 6 months and at -70 °C or below for 12 months without repeated freezing and thawing.
[0080] 2. Long fragment amplification
[0081] a. First-round PCR amplification
[0082] 1) The DNA input is 20 μL. Take out the amplification PCR Enzyme Mix and specific amplification PCR PrimerPool, thaw and mix well, briefly centrifuge to collect at the bottom of the tube, and prepare the reaction solution for the first-round PCR amplification on ice. The ratio is as shown in Table 3 below:
[0083] Table 3
[0084] Component Name Volume (μL) DNA Sample 20 Amplification PCREnzymeMix 25 Specific Amplification PCRPrimerPool 5 Total 50
[0085] 2) Use a pipette to pipette up and down or vortex to mix evenly, and briefly centrifuge to collect the reaction solution at the bottom of the tube;
[0086] 3) Immediately place the PCR tube in the PCR instrument for reaction. The reaction temperature and time are as shown in Table 4 below:
[0087] Table 4
[0088]
[0089]
[0090] 4) After the reaction is completed, briefly centrifuge to collect the reaction solution at the bottom of the tube.
[0091] b. Purification of the first-round PCR amplification product
[0092] Pre-equilibrate the purification magnetic beads at room temperature for 30 min for later use. After combining the amplified products, perform purification. The purification steps are as follows:
[0093] 1) After the purification magnetic beads are equilibrated to room temperature, vortex to mix evenly before use;
[0094] 2) Transfer the system (50 μL) after the first-round PCR amplification to a 1.5 mL EP tube, add 1.2× (60 μL) magnetic beads, pipette up and down 10 times to mix evenly, and let it stand at room temperature for 5 min;
[0095] 3) Place the 1.5 mL EP tube on the magnetic rack. After the solution becomes clear (about 5 min of standing), remove the supernatant;
[0096] 4) Wash the magnetic beads on the rack with freshly prepared 180 μL of 80% ethanol, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat this step for a total of two rinses;
[0097] 5) After removing the 80% ethanol, briefly centrifuge, then place it on the magnetic rack again. Use a 10 μL pipette to remove the residual ethanol, and open the lid to dry the magnetic beads for 10 min until the ethanol completely evaporates;
[0098] 6) Take out the 1.5 mL EP tube from the magnetic rack and perform elution: add 25 μL of elution buffer, gently pipette up and down to mix evenly, let it stand at room temperature for 5 min, briefly centrifuge the 1.5 mL EP tube and place it on the magnetic rack to stand. After the solution becomes clear, transfer 23 μL of the supernatant to a new 1.5 mL EP tube.
[0099] c. Second-round PCR amplification
[0100] 1) After thawing UDIPrimer 1 - UDIPrimer 96 and the amplification PCR Enzyme Mix, invert and mix well, briefly centrifuge to collect at the bottom of the tube, and prepare the following reaction in a sterilized PCR tube with the ratios as shown in Table 5 below:
[0101] Table 5
[0102]
[0103]
[0104] UDIPrimer 1 - UDIPrimer 96 are 96 different UDI - tagged primers, each containing a different UDI, and only one UDI is used in each reaction. Select the required UDI according to different library construction strategies.
[0105] When sequencing, it is used to distinguish different samples, which is the NNNNNN sequence in the primer. The primer sequences are:
[0106] F:
[0107] AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO.451);
[0108] R:
[0109] CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTC AGACGTGTGCTCTTCCGATCT (SEQ ID NO.452).
[0110] 2) Use a pipette to gently pipette and mix well, and briefly centrifuge to collect the reaction solution at the bottom of the tube.
[0111] 3) Place the PCR tube in a PCR instrument for reaction. The reaction temperature and time are shown in Table 6 below:
[0112] Table 6
[0113]
[0114] 4) After the reaction is completed, briefly centrifuge to collect the reaction solution at the bottom of the tube.
[0115] d. Purification of the second - round PCR amplification products:
[0116] Pre - equilibrate the purification magnetic beads at room temperature for 30 min for standby. After combining the products amplified from the two pools, perform purification. The purification steps are as follows:
[0117] 1) After purifying magnetic beads and equilibrating them to room temperature, vortex them thoroughly before use.
[0118] 2) Transfer the system (50 μL) after the first-round PCR amplification to a 1.5 mL EP tube, add 1.2× (60 μL) magnetic beads, pipette and mix well 10 times, and let it stand at room temperature for 5 min.
[0119] 3) Place the 1.5 mL EP tube on a magnetic stand. After the solution becomes clear (about 5 min of standing), remove the supernatant.
[0120] 4) Wash the magnetic beads on the stand with freshly prepared 180 μL of 80% ethanol, incubate at room temperature for 30 sec, carefully remove the supernatant, and repeat this step for a total of two rinses.
[0121] 5) After removing the 80% ethanol, centrifuge briefly, then place it on the magnetic stand again. Use a 10 μL pipette to remove the residual ethanol, open the lid and dry the magnetic beads for 10 min until the ethanol completely evaporates.
[0122] 6) Take the 1.5 mL EP tube out of the magnetic stand and perform elution: Add 25 μL of elution buffer, gently pipette and mix well, let it stand at room temperature for 5 min, briefly centrifuge the 1.5 mL EP tube and place it on the magnetic stand to stand. After the solution becomes clear, transfer 23 μL of the supernatant to a new 1.5 mL EP tube.
[0123] 3. Library Preparation
[0124] Use a commercial enzymatic digestion kit for enzymatic digestion, fragmentation, and library construction. The target fragment length is about 300 bp.
[0125] 4. PE150 Sequencing
[0126] Use a Genolab_M sequencer for PE150 sequencing to achieve almost complete coverage of the detection region, with an average sequencing depth of more than 500X, a 200X coverage of ≥98%, and a 100X coverage of ≥99%.
[0127] 5. Data Analysis
[0128] Align the FASTQ files with the reference genome (hg38) using the Burrows—Wheeler Aligner MEM algorithm. For germline variations, use GATK HaplotypeCaller to analyze SNV and indel variations. For somatic variations, use the Vardict software to analyze SNV and indel variations, and use SnpEff for variant annotation. Conduct variant analysis according to the variant classification guidelines published by ACMG and AMP.
[0129] 6. Variant Validation
[0130] Positive SNV / indel variations were verified by Sanger sequencing, and CNV was verified by FQ-PCR method.
[0131] After the above amplification and library construction steps, by sequencing 20M reads, 100% coverage of the corresponding regions of NF1 and SPRED1, GNAS, PTPN11, MLH1, MSH2, MSH6, and PMS2 can be achieved, and at the same time, its average depth is greater than 1000X, and the coverage area above 500X is greater than 99%.
[0132] Example 2
[0133] 1. The steps for extracting tissue DNA samples are as follows:
[0134] 1) Thaw the tissue block, wash away the blood stains with physiological saline, cut about 0.5 g of tissue, put it into a 1.5 ml centrifuge tube, and cut it into pieces;
[0135] 2) Add 0.45 ml of TES buffer and mix well, then add 50 μl of SDS (10%), 5 μl of proteinase K (20 mg / ml), mix well, incubate at 56 °C for 4 - 6 h, and shake once every 2 h;
[0136] 3) Let it cool to room temperature, add an equal volume of saturated phenol (500 μl), invert and mix well, centrifuge at 10000 rpm for 10 m, separate the aqueous phase and the organic phase, carefully aspirate the upper nucleic acid-containing aqueous phase into a new 1.5 ml centrifuge tube;
[0137] 4) Add an equal volume of phenol:chloroform:isoamyl alcohol (25:24:1), invert and mix well, centrifuge at 10000 rpm for 10 minutes, transfer the upper layer to a new 1.5 ml centrifuge tube;
[0138] 5) Add an equal volume of chloroform:isoamyl alcohol (24:1), invert and mix well, centrifuge at 10000 rpm for 10 minutes, take the upper supernatant into a new 1.5 ml centrifuge tube;
[0139] 6) Add 2.5 times the volume of -20 °C pre-cooled absolute ethanol to precipitate DNA, and observe after the precipitate appears;
[0140] 7) Centrifuge at 12000 r / m for 10 minutes, discard the ethanol;
[0141] 8) Wash with 75% ethanol stored at -20 °C, centrifuge at 10000 rpm for 5 minutes, remove the ethanol, and dry the DNA at 55 °C;
[0142] 9) Add an appropriate amount of TE to dissolve the DNA and store it at -20 °C for standby.
[0143] The extracted DNA can be stored at -25 to -15°C for no more than 6 months without repeated freezing and thawing, and can be stored for 12 months under the condition of -70°C or below.
[0144] 2. The steps of long fragment amplification, library preparation, PE150 sequencing, data analysis, variant verification, etc. are the same as those of the blood DNA in Example 1.
[0145] After the above amplification and library construction steps, by sequencing 20M reads, 100% coverage of the corresponding regions of NF1 and SPRED1, GNAS, PTPN11, MLH1, MSH2, MSH6, PMS2 can be achieved. At the same time, its average depth is greater than 1000X, and the coverage area above 500X is greater than 99%.
[0146] Test Example 1
[0147] 1. Experimental method: The accuracy of the detection method of the present invention was tested by using the blood samples of 20 retrospective patients with type I neurofibromatosis (subjects No. 1 - 20 in Table 7) and 15 healthy people (subjects No. 21 - 35 in Table 7).
[0148] 2. Experimental content: Using the method described in the present invention, the blood samples of 20 patients with type I neurofibromatosis or suspected patients and 15 healthy people provided by the Department of Neurosurgery of a general hospital were detected. The detection method was carried out according to the steps of Example 1, including DNA extraction, amplification and purification, library construction, and PE150 sequencing of the sample library using a high-throughput sequencing platform, with an average sequencing depth greater than 1000X.
[0149] 3. Analyze the sequencing results, and use a comparative method to verify the detected positive variant sites, and compare the differences between the results. The specific results are shown in Table 7 as follows:
[0150] Table 7
[0151]
[0152]
[0153]
[0154] It can be seen from the results that the accuracy rate of the detection results of the present invention can reach more than 95%, 100% coverage of the corresponding regions of NF1 and SPRED1, GNAS, PTPN11, MLH1, MSH2, MSH6, PMS2 can be achieved. At the same time, its average depth is greater than 1000X, and the coverage area above 500X is greater than 99%.
[0155] Although the present invention has been described in detail above with general descriptions and specific embodiments, on the basis of the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of the present invention claimed.
Claims
1. Use of reagents for LR-PCR detection of the NF1 gene and reagents for multiplex PCR detection of the SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes in the preparation of a product for detecting NF1 gene mutations; LR-PCR detection of the NF1 gene and multiplex PCR detection of the SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes include the following steps: DNA extraction, long fragment amplification, library preparation, PE150 sequencing, data analysis, and variant verification; The reagent for LR-PCR detection of the NF1 gene is 24 pairs of NF1 amplification primers, divided into 4 multiplex groups A, B, C, and D; Among them, The NF1 amplification primers included in group A are the nucleotide sequences shown in SEQ ID NO.: 1-2 and SEQ ID NO.: 45-46; Among them, the NF1 amplification primers included in group B are the nucleotide sequences shown in SEQ ID NO.: 5-8, SEQ ID NO.: 15-16, SEQ ID NO.: 19-20, SEQ ID NO.: 25-26, and SEQ ID NO.: 37-40; Among them, the NF1 amplification primers included in group C are the nucleotide sequences shown in SEQ ID NO.: 3-4, SEQ ID NO.: 9-14, SEQ ID NO.: 17-18, SEQ ID NO.: 23-24, SEQ ID NO.: 29-32, SEQ ID NO.: 35-36, and SEQ ID NO.: 43-44; Among them, the NF1 amplification primers included in group D are the nucleotide sequences shown in SEQ ID NO.: 21-22, SEQ ID NO.: 27-28, SEQ ID NO.: 33-34, SEQ ID NO.: 41-42, and SEQ ID NO.: 47-48; The reagent for multiplex PCR detection of the SPRED1, PTPN11, MLH1, MSH2, MSH6, and PMS2 genes is amplification primers; Among them, the amplification primer sequences shown in SEQ ID NO.: 49-100 correspond to the PTPN11 gene; Among them, the amplification primer sequences shown in SEQ ID NO.: 101-130 correspond to the SPRED1 gene; Among them, the amplification primer sequences shown in SEQ ID NO.: 131-200 correspond to the MSH2 gene; Among them, the amplification primer sequences shown in SEQ ID NO.: 201-262 correspond to the MSH6 gene; Among them, the amplification primer sequences shown in SEQ ID NO.: 325-390 correspond to the MLH1 gene; Among them, the amplification primer sequences shown in SEQ ID NO.: 391-450 correspond to the PMS2 gene.
2. The application according to claim 1, characterized in that, The samples used for DNA extraction are blood or tissues, and the reagents used for sample processing include: cell lysate, saturated phenol, phenol-chloroform, sodium acetate, isopropanol, 70% ethanol, and 75% ethanol.
3. The application according to claim 1, wherein The library preparation steps include: using an enzyme digestion kit for enzyme digestion and library construction, with the target fragment length being 300 bp.
4. The application according to claim 1, wherein The PE150 sequencing step is: performing PE150 sequencing using a sequencer.
5. The application according to claim 1, wherein The data analysis steps are: aligning the FASTQ file with the reference genome hg38 using the Burrows—Wheeler Aligner MEM algorithm; analyzing germline variations to obtain SNV and indel variations using GATK HaplotypeCaller; analyzing somatic variations to obtain SNV and indel variations using the Vardict software, and performing variant annotation using SnpEff, and conducting variant analysis with reference to the variant classification guidelines published by ACMG and AMP.
6. The application according to claim 1, characterized in that The variant validation steps are: validating positive SNV / indel variations using Sanger sequencing; validating CNV using the FQ-PCR method.
Citation Information
Patent Citations
Method and primers for detecting 31st-34th whole exons of NF1 gene
CN104745697A
Kit for external detection of Neurofibromastosis 2 disease causative gene NF2 c.1598delA mutation
CN104878079A