Application of serum tRF in the preparation of diagnostic or detection reagents for non-small cell lung cancer

By using serum tRF-32-897PVP941QKSJ biomarker and quantitative real-time PCR, the specificity and sensitivity issues in the early diagnosis of non-small cell lung cancer have been resolved, enabling early molecular diagnosis and accurate staging of lung cancer, thus improving the diagnostic rate and treatment opportunities.

CN118421791BActive Publication Date: 2025-08-12NINGBO UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410467856.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-18
Publication Date
2025-08-12
Estimated Expiration
2044-04-18

AI Technical Summary

Technical Problem

Existing technologies are unable to provide highly specific and sensitive diagnostic markers for non-small cell lung cancer, making early diagnosis difficult and causing patients to miss the opportunity for surgery.

Method used

Serum tRF-32-897PVP941QKSJ was used as a diagnostic marker. The expression of tRF-32-897PVP941QKSJ was detected by specific hairpin reverse transcription primers and real-time PCR to prepare a diagnostic or detection reagent for non-small cell lung cancer.

Benefits of technology

It enables early molecular-level diagnosis of non-small cell lung cancer, with high specificity and sensitivity, accurately distinguishing different tumor stages and metastases, improving the diagnostic rate, and providing patients with early treatment opportunities.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118421791B_ABST
    Figure CN118421791B_ABST
Patent Text Reader

Abstract

The present invention discloses the use of serum tRF in preparing a diagnostic or detection reagent for non-small cell lung cancer. The invention is characterized in that the serum tRF is tRF-32-897PVP941QKSJ, the nucleotide sequence of which is TCCTCGTTAGTATAGTGGTGAGTATCCCCGCC, the upstream primer for fluorescence quantitative PCR specific amplification is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTT AGTATAGT. The invention also provides the use of the serum tRF in preparing a diagnostic or detection kit for non-small cell lung cancer, a target drug, tumor size, and a diagnostic or detection reagent for non-small cell lung cancer N0 and N1-3 stages, M0 and M1 stages, and I-II and III-IV stages in the TNM staging. The invention has the advantage of high specificity and sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biology, and in particular relates to an application of serum tRF in the preparation of a diagnostic or detection reagent for non-small cell lung cancer. Background Art

[0002] Lung cancer is the most common malignant tumor in the world, with the highest morbidity and mortality rates. Non-small-cell lung cancer (NSCLC) is the main pathological type of lung cancer, accounting for about 85% of all lung cancer cases. NSCLC is often asymptomatic or has unclear symptoms in the early stages, and many patients are already in the late stages when they are first diagnosed, losing the opportunity for surgery. With the continuous improvement of medical standards, a variety of treatment methods can now be used to treat patients, including chemotherapy, radiotherapy, immunotherapy, molecular targeted therapy, etc. However, according to statistics, the five-year survival rate of lung cancer is less than 30%, and the prognosis of patients is very bleak. Therefore, exploring new diagnostic markers for lung cancer is of great significance to improving patient survival rates.

[0003] tRNA-derived RNA fragments (tRFs) are produced by site-specific cleavage of mature tRNAs or their precursors. They are a class of small, non-coding RNAs widely present in the transcriptomes of both prokaryotes and eukaryotes. Similar to other non-coding RNAs, tRFs are tissue-specific and relatively stable. tRFs can regulate gene expression at the transcriptional and translational levels and are widely involved in the pathogenesis and progression of various diseases, including immune disorders, metabolic disorders, and the development of malignant tumors. In recent years, an increasing number of tumor-associated tRFs have been discovered, and their roles in cancer are constantly being revealed. tRFs are widely enriched in various biological fluids, making them a high-quality biomarker with the potential to become novel markers for tumor diagnosis. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an application of serum tRF with high specificity and sensitivity in the preparation of a diagnostic or detection reagent for non-small cell lung cancer.

[0005] The technical solution adopted by the present invention to solve the above technical problems is: an application of serum tRF in the preparation of a diagnostic or detection reagent for non-small cell lung cancer, wherein the serum tRF is tRF-32-897PVP941QKSJ, and the nucleotide sequence of the tRF-32-897PVP941QKSJ is TCCTCGTTAGTATAGTGGTGAGTATCCCCGCC.

[0006] Furthermore, the specific hairpin reverse transcription primer sequence of the serum tRF-32-897PVP941QKSJ is: GGGCGGACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT.

[0007] Furthermore, the upstream primer sequence for the fluorescent quantitative PCR specific amplification of tRF-32-897PVP941QKSJ is 5'-GAGAACACTGACAGCACGAG-3', and the downstream primer sequence is 5'-CCTTCCTCGTTAGTATAGT-3'. These primers can specifically detect the expression of tRF-32-897PVP941QKSJ in serum. Conventional fluorescent quantitative PCR can be used to quickly, easily, intuitively, and inexpensively obtain test results, enabling diagnosis.

[0008] The present invention also provides the use of the serum tRF in preparing a diagnostic or detection kit for non-small cell lung cancer.

[0009] The present invention also provides the use of the serum tRF in the diagnosis of non-small cell lung cancer or the detection of target drugs.

[0010] The present invention also provides the use of the serum tRF in preparing a reagent for diagnosing or detecting the size of non-small cell lung cancer tumors, wherein the tumor size is divided into less than 5 cm and greater than or equal to 5 cm.

[0011] The present invention also provides the use of the above serum tRF in the preparation of diagnostic or detection reagents for N0 and N1-3 stages of non-small cell lung cancer, wherein the NO stage indicates no lymph node metastasis and the N1-3 stage indicates lymph node metastasis.

[0012] The present invention also provides the use of the above serum tRF in the preparation of diagnostic or detection reagents for non-small cell lung cancer M0 and M1 stages, wherein the MO stage indicates no distant metastasis and the M1 stage indicates distant metastasis.

[0013] The present invention also provides the use of the serum tRF in preparing a diagnostic or detection reagent for stage I-II and stage III-IV in the TNM staging of non-small cell lung cancer.

[0014] Compared with the existing technology, the advantages of the present invention are: the present invention provides an application of serum tRF in the diagnosis or detection of non-small cell lung cancer, and discloses for the first time a serum tRF for the diagnosis or detection of non-small cell lung cancer: tRF-32-897PVP941QKSJ. The tRF-32-897PVP941QKSJ marker is highly expressed in the serum of patients with non-small cell lung cancer, and its expression level is positively correlated with the malignancy of non-small cell lung cancer (tumor size, pathological stage, lymph node metastasis and distant metastasis). By using serum specimens that are easy to collect and detecting tRF in serum, non-small cell lung cancer can be diagnosed early at the molecular level quickly, conveniently and efficiently, with high specificity, high sensitivity, strong targeting, good reliability, and more accurate results. This improves the diagnosis rate of NSCLC, tracks tumor progression, and provides more opportunities for early treatment of patients. It has a large and relatively innovative application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 This is the sequencing result of tRF-32-897PVP941QKSJ;

[0016] Figure 2 is the standard curve of tRF-32-897PVP941QKSJ;

[0017] Figure 3 The expression of serum tRF-32-897PVP941QKSJ in NSCLC cases, pneumonia cases (Pneumonia), benign tumor cases (Benign), and healthy people (Healthy);

[0018] Figure 4 ROC curve for distinguishing healthy subjects from NSCLC patients using serum tRF-32-897PVP941QKSJ;

[0019] Figure 5 The expression of serum tRF-32-897PVP941QKSJ in lung tumors smaller than 5 cm and larger than 5 cm;

[0020] Figure 6 The expression of serum tRF-32-897PVP941QKSJ in N0 stage and N1-3 stage;

[0021] Figure 7 The expression of serum tRF-32-897PVP941QKSJ in M0 and M1 stages;

[0022] Figure 8 The expression of serum tRF-32-897PVP941QKSJ in pathological stages I-II and III-IV. DETAILED DESCRIPTION

[0023] The present invention will be described in further detail below with reference to the accompanying drawings and embodiments. Specific embodiment 1

[0025] 1. Screening of serum tRF markers

[0026] We randomly selected samples from the clinical laboratory of Ningbo University Affiliated Li Huili Hospital before surgery or treatment as serum marker screening samples in April 2023. In this study, each subject completed an informed consent form requesting that their blood be used for research, and all blood collection was approved by the Clinical Research Ethics Committee of the Ningbo University School of Medicine and complied with the principles of the Declaration of Helsinki.

[0027] To identify NSCLC-associated tRFs, we isolated RNA from serum samples from four healthy individuals and four NSCLC patients using Trizol reagent (Invitrogen, USA) (concentration ≥ 200 ng / μL, total volume ≥ 10 μg, OD260 / 280 between 1.8 and 2.2). Subsequently, the eight isolated RNA samples were sequenced using a small RNA sequencing platform. The most significantly differentially expressed tRFs were selected based on P values and fold change values as candidate predictive markers for the diagnosis or detection of NSCLC. The nucleotide sequence of the tRF-32-897PVP941QKSJ gene was obtained from MINTbase (https: / / cm.jefferson.edu / MINTbase / ) as follows: 5'-TCCTCGTTAGTATAGTGGTGAGTATCCCCGCC-3'.

[0028] The steps for extracting RNA from serum are as follows: First, 400 μL of serum was transferred to a 1.5 mL enzyme-free EP tube and centrifuged at 2000 g for 30 minutes at 4°C. After centrifugation, 350 μL of the supernatant was transferred to a new 2 mL enzyme-free EP tube. 1 mL of Trizol reagent (Thermo Fisher Scientific, USA) was added, and the cells were lysed on ice for 3 minutes. Then, 200 μL of chloroform (ChemMall, China) was added and incubated on ice for 5 minutes. Next, the mixture was centrifuged at 12,000 g for 15 minutes at 4°C. The supernatant was transferred to a new 1.5 mL EP tube, 500 μL of isopropanol (ChemMall, China) was added, and the tube was mixed by inversion. The tube was then incubated on ice for 10 minutes. Next, the tube was centrifuged at 12,000 g for 10 minutes at 4°C. The precipitate was washed twice with 1 mL of 75% ethanol and finally dissolved in 50 μL of nuclease-free water to obtain the RNA extract, which was stored at -80°C until use. RNA concentration was measured on a NanoDrop spectrophotometer (NanoDropTM One, Thermo Fisher Scientific, USA). Specific embodiment 2

[0030] 1. Collection of clinical samples

[0031] With the approval of the hospital ethics committee and informed consent from the patients, serum samples were randomly collected from patients with NSCLC (n=130), benign lung tumors (n=37), and pneumonia (n=40) before surgery or treatment at the clinical laboratory of Li Huili Hospital, Ningbo University, between mid-2022 and the end of 2023. Forty-six serum samples were obtained from healthy individuals with no history of cancer at Ningbo Kangning Hospital, affiliated with the Ningbo University School of Medicine. These samples served as validation samples. The clinical characteristics of all participating patients (age, sex, smoking status, histological subtype, TNM stage, lymph node metastasis, distant metastasis, tumor size, etc.) are shown in Table 1.

[0032] Table 1 Serum samples and corresponding clinical parameters in this study

[0033]

[0034]

[0035] 2. Primer design

[0036] tRF primer design: We first obtained the tRF-32-897PVP941QKSJ 5'-3' sequence (TCCTCGTTAGTATAGTGGTGAGTATCCCCGCC) from MINTbase (https: / / cm.jefferson.edu / MINTbase / ). A specific hairpin reverse transcription primer sequence was designed: 3'-GGGCGGACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT-5'. The upstream primer sequence for specific tRF amplification by quantitative fluorescence PCR was 5'-GAGAACACTGACAGCACGAG-3', and the downstream primer sequence was 5'-CCTTCCTCGTTAGTATAGT-3'. The specificity of the designed primers was preliminarily verified using the BLAST primer tool in NCBI. The specificity of the tRF product was also verified by real-time quantitative polymerase chain reaction (qRT-PCR) and agarose gel electrophoresis. All primers were synthesized by Beijing Genomics Institute, China.

[0037] 3. cDNA Synthesis

[0038] cDNA was synthesized using a Life Touch TC-96 / G / H(b)b PCR instrument (Bioer, China) using ReverTra Ace qPCR RT Master Mix and gDNA Removal Reagent (TOYOBO, Japan) according to the manufacturer's recommendations. The specific experimental steps are as follows:

[0039] (1) Genomic DNA removal

[0040] The genomic DNA removal reaction system was prepared in an RNase-free centrifuge tube as follows: 2 μL 5×gDNA WiperMix, 8 μL RNA extraction solution (see specific example 1 for extraction method). After the preparation was completed, the mixture was mixed and reacted at 42° C. for 2 minutes.

[0041] (2) First-strand cDNA synthesis

[0042] Prepare the following mixture in an RNase-free centrifuge tube:

[0043] Table 2 Reverse transcription reaction system

[0044]

[0045] After preparation, mix thoroughly and react at the following temperatures: 25°C for 5 minutes, 50°C for 15 minutes, and 85°C for 5 minutes. After the reaction, the mixture can be stored at -20°C.

[0046] 4. The expression level of tRF-32-897PVP941QKSJ selected in this study was quantitatively detected by qRT-PCR

[0047] qRT-PCR reaction system: SYBR Green buffer (Yeasen Biotech, China), 5 μL; 10 μM upstream primer, 0.5 μL; 10 μM downstream primer, 0.5 μL; cDNA template, 1 μL; sterile enzyme-free water, 3 μL.

[0048] After the solution was prepared, the reaction was carried out at the following temperature: 95°C for 10 min, followed by 40 cycles of 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s, and finally stored at 4°C. The reaction was performed on a Mastercycler gradient instrument (Vaudaux-Eppendorf, Germany).

[0049] 5. Preparation of standard curve

[0050] (1) Construct plasmid standards of known concentration and analyze the concentrations of plasmids on a NanoDrop spectrophotometer. TMOne, ThermoFisher Scientific, USA) to measure the OD of the plasmid stock solution 260 (Absorbance at 260 nm wavelength).

[0051] (2) Dilute the standard plasmid stock solution in 12 gradients at a 10-fold ratio. Calculate gene copy number.

[0052] (3) The diluted plasmid solution is measured by qRT-PCR to obtain the ct value at the corresponding concentration. The qRT-PCR reaction system is the same as that in step 4.

[0053] (4) Using the logarithmic value of the copy number as the horizontal axis and the ct value as the vertical axis, we plotted R using 6 gradient concentrations. 2 The linear equation of the standard curve with a p-value greater than or equal to 0.999 is y = -klgx + b, where x is the number of cDNA copies per microliter.

[0054] (5) Use the standard curve to evaluate the specificity of the qRT-PCR product. Compare the ct value of the unknown serum sample with the standard curve to obtain the corresponding copy number x, multiply it by 20 to get the gene copy number in 8 microliters of RNA extract, divide it by 8 / 50 and then divide it by 350 to get the gene copy number per microliter of serum. The standard curve constructed by the plasmid standard is as follows Figure 1 As shown by Figure 1 It can be seen that the logarithm of the copy number is negatively correlated with the ct value, and the fit is good R 2 =0.9999.

[0055] 6. Sanger sequencing

[0056] We wanted to confirm that the tRF amplified by the designed primers was the desired tRF. We sent the PCR products after qRT-PCR to Beijing Genomics Institute (Beijing Genomics Institute, China) for Sanger sequencing, compared the tRF sequences and analyzed the splicing sites of the tRF to confirm the accuracy of the tRF. Figure 2 As shown, by performing Sanger sequencing on the PCR products after the qRT-PCR reaction, it was successfully identified that the amplified product was indeed a fragment of the tRF-32-897PVP941QKSJ marker.

[0057] 7. Statistical analysis

[0058] Statistical analysis was performed using SPSS 26.0 software package (SPSS Inc., Chicago, USA) and GraphPad Prism 8.0 (GraphPad Software, USA).

[0059] 8. Research Results

[0060] To investigate the diagnostic potential of tRF-32-897PVP941QKSJ in NSCLC patients, we quantified serum tRF-32-897PVP941QKSJ expression levels in four sample groups: healthy controls, pneumonia, benign lung tumors, and non-small cell lung cancer. After transforming the tRF-32-897PVP941QKSJ copy number to a normal distribution using LN, we analyzed statistical differences in tRF-32-897PVP941QKSJ levels among healthy controls, pneumonia, benign lung tumors, and non-small cell lung cancer using ANOVA and Tukey's HSD tests. We then compared tRF-32-897PVP941QKSJ expression levels among different groups (tumors less than 5 cm and greater than 5 cm, N0 and N1-3 stages, M0 and M1 stages, and stages I-II and III-IV) using the nonparametric Mann-Whitney U test. At the same time, the diagnostic ability of tRF-32-897PVP941QKSJ was tested by the receiver operating characteristic (ROC) curve, and the area under the curve (AUC) was calculated to evaluate the sensitivity and specificity of tRF-32-897PVP941QKSJ in distinguishing healthy and NSCLC patients. P < 0.05 was considered statistically significant, and all P values were two-sided. The results are as follows Figure 3-7 shown.

[0061] like Figure 3 As shown in the data, the expression level of serum tRF-32-897PVP941QKSJ in NSCLC patients was higher than that in healthy people. The expression level of serum tRF-32-897PVP941QKSJ in NSCLC patients was significantly different from that in healthy people, which can be used to distinguish healthy people from NSCLC patients.

[0062] like Figure 4 As shown in the figure, further ROC curve analysis revealed that the AUC for the tRF-32-897PVP941QKSJ gene expression level was 0.680, with a sensitivity and specificity of 0.400 and 0.935, respectively. Therefore, we concluded that tRF-32-897PVP941QKSJ can distinguish healthy individuals from NSCLC patients.

[0063] like Figure 5 As shown in the figure, the expression level of serum tRF-32-897PVP941QKSJ in NSCLC patients with tumors smaller than 5 cm was significantly lower than that in the group with tumors larger than 5 cm.

[0064] like Figure 6As shown in the data, the expression level of serum tRF-32-897PVP941QKSJ in N1-3 groups of NSCLC patients was significantly higher than that in N0 group.

[0065] like Figure 7 As shown in the figure, the expression level of serum tRF-32-897PVP941QKSJ in the M1 group of NSCLC patients was significantly higher than that in the M0 group.

[0066] like Figure 8 As shown, the expression level of serum tRF-32-897PVP941QKSJ in group III-IV of NSCLC patients was significantly higher than that in group I-II.

[0067] Therefore, we concluded that tRF-32-897PVP941QKSJ can distinguish healthy individuals from NSCLC patients. Furthermore, by detecting the copy number of tRF-32-897PVP941QKSJ in different subgroups (tumors less than 5 cm and greater than 5 cm, N0 and N1-3, M0 and M1, and stages I-II and III-IV), we found that tRF-32-897PVP941QKSJ can effectively distinguish NSCLC tumors less than 5 cm and greater than 5 cm, N0 and N1-3, M0 and M1, and stages I-II and III-IV.

[0068] In summary, this study identified a serum gene, tRF-32-897PVP941QKSJ, associated with NSCLC. By using qRT-PCR to absolutely quantify tRF-32-897PVP941QKSJ levels, we compared tRF-32-897PVP941QKSJ copy number differences in the serum of four study cohorts (healthy individuals, pneumonia, benign lung tumors, and non-small cell lung cancer). We found that tRF-32-897PVP941QKSJ was abnormally expressed in the serum of NSCLC patients and had the ability to distinguish healthy individuals from NSCLC. The expression levels of tRF-32-897PVP941QKSJ in different subgroups (tumors less than 5 cm and greater than or equal to 5 cm, N0 and N1-3 stages, less than 5 cm and greater than or equal to 5 cm, N0 and N-3, M0 and M1, I-II and III-IV) were compared, and it was found that tRF-32-897PVP941QKSJ could better distinguish tumor size, N0 and N1-3 stages, M0 and M1 stages, I-II stages and III-IV stages.

[0069] The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by persons of ordinary skill in the art within the spirit and scope of the present invention shall also fall within the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting the expression level of tRF in serum in the preparation of a diagnostic reagent for non-small cell lung cancer, characterized in that: The serum tRF is tRF-32-897PVP941QKSJ, and the nucleotide sequence of tRF-32-897PVP941QKSJ is TCCTCGTTAGTATAGTGGTGAGTATCCCCGCC.

2. Use of the reagent for detecting the expression level of tRF in serum according to claim 1 in the preparation of a diagnostic reagent for non-small cell lung cancer, characterized in that: The specific hairpin reverse transcription primer sequence of the serum tRF-32-897PVP941QKSJ is: GGGCGGACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT.

3. Use of the reagent for detecting the expression level of tRF in serum according to claim 2 in the preparation of a diagnostic reagent for non-small cell lung cancer, characterized in that: The upstream primer sequence of the fluorescent quantitative PCR specific amplification of tRF-32-897PVP941QKSJ is 5'-GAGAACACTGACAGCACGAG -3', and the downstream primer sequence is 5'-CCTTCCTCGTTAGTATAGT-3'.

4. Use of the reagent for detecting the expression level of tRF in serum according to any one of claims 1 to 3 in the preparation of a diagnostic or detection kit for non-small cell lung cancer.

Citation Information

Patent Citations

  • TREM compositions and uses thereof

    CA3179869A1