A strain of Salmonella Indiana S0932 and its application

Abstract

The present invention discloses a strain of Indiana Salmonella S0932 and its application. The strain has been deposited at China Center for Type Culture Collection; address: Wuhan University, Wuhan, China; deposit date: April 19, 2024; deposit number: CCTCC NO.M 2024732. The present invention also provides the application of the Indiana Salmonella for the study of the CbtA / CbeA toxin-antitoxin system of Salmonella. The Indiana Salmonella S0932 genome contains a set of defective CbtA / CbeA toxin-antitoxin systems, and is sensitive to antibiotics such as chloramphenicol, ampicillin, and kanamycin, and can be used as a reference strain for the study of the defective CbtA / CbeA toxin-antitoxin system of Salmonella.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and specifically relates to a strain of Indiana Salmonella S0932 and application thereof in the research of CbtA / CbeA toxin-antitoxin system. Background Art

[0002] The bacterial toxin-antitoxin system (TAS) consists of two co-expressed genes, one of which encodes a toxin and the other encodes an antitoxin. TAS was first discovered in some low-copy plasmids. Its function is usually to maintain the stability of the plasmid in the bacterial community. When the plasmid is lost in the progeny bacteria, the antitoxin will be rapidly decomposed by the protease to produce free toxins, thereby killing the progeny bacteria that do not retain the plasmid. Subsequent studies have found that TAS is also widely present in the chromosomes of various bacteria. Under environmental stimulation or stress, the antitoxin is degraded or consumed by the protease. After the toxin is released, it interferes with or changes the cell's DNA replication, ATP and cell wall synthesis, leading to cell growth inhibition, death, and the formation of persisters. TAS can enable bacteria to maintain population continuity under stressful environments, so it is of great significance. TAS can be divided into different types according to the type of antitoxin and the difference in the way it neutralizes toxins. Among them, CbtA / CbeA (CbtA, cytoskeleton Binding Toxin A, cytoskeleton binding toxin A; CbeA, cytoskeleton bundling-enhancing factor A) belongs to type IV. Its mechanism of action is to inhibit cell division by toxin CbtA acting on cytoskeleton proteins (FtsZ and MreB). Antitoxin CbeA inhibits toxicity by competing with CbtA for cellular targets. CbtA / CbeA was first reported in Escherichia coli, but in recent years, it has been found that CbtA / CbeA-TAS is mainly distributed in the Indiana Salmonella epidemic strains in my country, but is rarely distributed in early strains. Amino acid sequence analysis of Indiana Salmonella CbtA / CbeA found that the toxin CbtA can be divided into two types according to its length: complete type (containing 128 amino acids) and defective type (containing 90 amino acids). Currently, there is almost no research on the biological functions of these two types of Salmonella CbtA / CbeA-TAS.

[0003] Indiana Salmonella is a Salmonella serotype that has been widely prevalent in my country in recent years. Its main characteristic is high drug resistance, especially almost complete resistance to common antibiotics such as chloramphenicol, ampicillin, and kanamycin. Since the current bacterial gene editing tools mainly carry resistance genes to the above common antibiotics, and the drug resistance characteristics of Indiana Salmonella make it difficult to mutate specific genes through bacterial gene editing tools. Therefore, how to obtain Indiana Salmonella that is sensitive to common antibiotics and genetically stable and then conduct related biological function research is a technical problem that needs to be solved urgently by technicians in this field. Summary of the invention

[0004] The purpose of the present invention is to provide a reference strain that can be used for the study of the CbtA / CbeA toxin-antitoxin system of defective Salmonella, and the mutation of the CbtA / CbeA toxin-antitoxin system can be carried out through bacterial gene editing tools, thereby conducting various biological function studies.

[0005] The technical solution of the present invention is as follows:

[0006] On the one hand, the present invention relates to Indiana Salmonella S0932, which is a strain obtained after repeated screening and verification for many years from more than 600 Indiana Salmonella strains collected and preserved over the years. The strain has a genome containing a defective CbtA / CbeA toxin-antitoxin system and is sensitive to antibiotics such as chloramphenicol, ampicillin, and kanamycin. The strain can be used as a reference strain for the study of the defective CbtA / CbeA toxin-antitoxin system of Indiana Salmonella.

[0007] The Salmonella Indiana S0932 of the present invention was sent to the China Center for Type Culture Collection (Wuhan University, Wuhan, China) for preservation on April 19, 2024. The name and identification characteristics are: Salmonella Indiana, strain number: S0932, and preservation number: CCTCCNO.M 2024732.

[0008] The present invention provides application of the Indiana Salmonella in the study of defective CbtA / CbeA toxin-antitoxin system.

[0009] The Indiana Salmonella S0932 genome provided by the present invention contains a defective CbtA / CbeA toxin-antitoxin system and is sensitive to antibiotics such as chloramphenicol, ampicillin, kanamycin, etc., and can be used as a reference strain for studying the defective CbtA / CbeA toxin-antitoxin system of Indiana Salmonella. BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1The results of the detection of CbtA / CbeA-TAS of some S0932 passaged strains in Example 1. In the figure: M is a DNA molecular weight standard Marker (100-2000bp), lanes 1 and 6 are strains passaged 10 times, lanes 2 and 7 are strains passaged 20 times, lanes 3 and 8 are strains passaged 30 times, lanes 4 and 9 are strains passaged 40 times, lanes 5 and 10 are strains passaged 50 times, and lane 11 is a negative control.

[0011] Figure 2 The results are the verification of the S0932ΔCbtA / CbeA deletion mutant constructed in Example 2. In the figure: M is a DNA molecular weight standard Marker (100-2000 bp), lane 1 is S0932, lane 2 is S0932ΔCbtA / CbeA:cat, lane 3 is S0932ΔCbtA / CbeA, and lane 4 is a negative control.

[0012] Figure 3 These are the test results of the adhesion rate of the S0932 wild-type strain and the S0932ΔCbtA / CbeA mutant strain to IPEC-J2 intestinal epithelial cells in Example 3.

[0013] Figure 4 These are the test results of the invasion rate of the S0932 wild-type strain and the S0932ΔCbtA / CbeA mutant strain on IPEC-J2 intestinal epithelial cells in Example 4. DETAILED DESCRIPTION

[0014] The present invention is further described below in conjunction with the embodiments and drawings. The following description is only a preferred embodiment of the present invention and does not limit the present invention in other forms. Any technician familiar with the profession may use the above disclosed technical content to change it into an equivalent embodiment with equivalent changes. Any simple modification or equivalent change made to the following embodiments based on the technical essence of the present invention without departing from the content of the present invention is within the protection scope of the present invention.

[0015] Example 1 Basic biological characteristics of Salmonella Indiana S0932

[0016] 1) Isolation, purification and staining microscopy

[0017] The Indiana Salmonella S0932 strain was isolated from chicken in Zibo City, Shandong Province in October 2010. The specific isolation method is: aseptically collect chicken samples and add them to SC selective enrichment broth for overnight culture at 37°C, then inoculate xylose lysine deoxycholate agar for overnight culture at 37°C, pick colonies with metallic black centers, inoculate them in LB agar medium, and culture them at 37°C for 24 hours. The pure cultured bacteria were examined by Gram staining and then observed under an optical microscope, showing elongated rods with slightly rounded ends.

[0018] 2) Biochemical identification

[0019] Colonies were picked from the LB agar plate for biochemical identification tests. Microbiological identification tubes were purchased from Hangzhou Microbiological Reagent Co., Ltd. and were operated according to the instructions. Results All biochemical indicators of the strain (see Table 1) were consistent with the biochemical characteristics of Salmonella.

[0020] Table 1. Biochemical identification results of S0932

[0021] Biochemical indicators <![CDATA[H2S]]> Indigo Urea KCN Lysine Mannitol Sorbitol ONPG Test results + - - - + + + -

[0022] 3) Serological typing

[0023] Pick colonies from the LB agar plate and place them in saline. Use turbidimetry to adjust the bacterial concentration to 1.0 × 10 per ml. 10 CFU, the slide agglutination method is used to perform serological typing of the strain. The specific operation method is as follows: take a clean slide, use a micropipette to draw 25μl of Salmonella positive serum (purchased from Thailand S&A Laboratory) and drop it on the slide, draw another 25μl of saline as a control, and then draw 25μl of bacterial solution and add it to the serum and saline respectively, and mix them thoroughly. Gently shake the slide and determine the result after 2 minutes. The test results show that the Salmonella antigen formula is 4,12:z;1,7 According to the antigen formula, the Salmonella is determined to be Salmonella Indiana.

[0024] Table 2. S0932 serological typing results

[0025]

[0026]

[0027] Note: “+” represents agglutination, and “-” represents no agglutination.

[0028] 4) Drug resistance test

[0029] The broth dilution method combined with the disk diffusion method was used to test the sensitivity of S0932 to common drugs, and the results were determined according to the international bacterial resistance detection standards such as Clinical and Laboratory Standards Institute (CLSI), US National Antimicrobial Resistance Monitoring System (NARMS) and European Committee on Antimicrobial Susceptibility Testing (EUCAST). The results are shown in Table 3. It can be seen that S0932 is resistant to only three drugs, streptomycin, nalidixic acid and ciprofloxacin, and is sensitive to 17 drugs, including ampicillin, cefazolin, cefotaxime, ceftriaxone, ceftazidime, aztreonam, imipenem, gentamicin, kanamycin, amikacin, tetracycline, sulfamethoxazole, trimethoprim, co-trimoxazole, chloramphenicol, polymyxin B and rifampicin.

[0030] Table 3. S0932 drug resistance test results

[0031]

[0032]

[0033] 5) Genomic analysis

[0034] After S0932 was enriched in LB broth, bacterial genomic DNA was extracted using a bacterial genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.) for Illumina sequencing, and the inactivated bacteria were sequenced by Pacbio (both completed by Nanjing Paisonno Gene Technology Co., Ltd.). The above sequence splicing showed that the S0932 genome size was 4,969,856bp. After annotating the genome sequence, it was found that there was a defective CbtA / CbeA toxin-antitoxin system in its genome, and the gene sequence is shown in SEQ NO: 1. (GTGTCAGACACTCTCCCCGGGACAACGCATCCCGACGATAACAACGACCGCCCCTG)

[0035] 6) Genetic stability test of CbtA / CbeA-TAS of S0932 subculture strain

[0036] S0932 was subcultured continuously overnight using LB broth, and LB agar was inoculated once every 10 generations. Ten colonies were randomly selected from the agar and the genetic stability of CbtA / CbeA-TAS was determined by PCR. A total of 50 generations were subcultured and LB agar was inoculated 10 times, and a total of 50 subcultured bacteria were obtained. According to the CbtA / CbeA-TAS nucleotide sequence of S0932, a pair of primers were designed, F: 5-TATCAGAGGCCGGTTCAG-3, R: 5-CCAGATGGTGACGGGAGA-3; amplification conditions: pre-denaturation at 94°C for 5min; denaturation at 94°C for 30s; annealing at 58°C for 30s; extension at 72°C for 30s; 30 cycles in total, and finally extension at 72°C for 8min. The negative control was sterile double distilled water. The CbtA / CbeA-TAS of the subcultured strains was detected by PCR, and the results showed that the detection results of all subcultured strains were positive (such as Figure 1 , PCR test results of some S0932 subculture strains), indicating that the CbtA / CbeA-TAS contained in S0932 has good genetic stability.

[0037] Example 2 Construction of CbtA / CbeA-TAS deletion mutant of S0932 using Red homologous recombination system

[0038] Primers were designed based on the upstream and downstream gene sequences of CbtA / CbeA-TAS in the S0932 genome sequence. Primers ΔCbtA / CbeA-F / ΔCbtA / CbeA-R were used to identify the size of the fragments before and after the deletion of the CbtA / CbeA-TAS gene, and primers CAT-CbtA / CbeA-F / CAT-CbtA / CbeA-R were used to amplify the chloramphenicol resistance gene, as shown in Table 3.

[0039] Table 4. CbtA / CbeA-TAS mutation primer sequences

[0040]

[0041] Note: The underlined part is a 50bp homologous sequence

[0042] Using CAT-CbtA / CbeA-F and CAT-CbtA / CbeA-R as primers and pKD3 plasmid as template PCR, DNA fragments with homology to the upstream and downstream sequences of CbtA / CbeA genes at both ends and CAT in the middle of the chloramphenicol resistance gene were amplified, and the products after PCR amplification were cut and recovered. S0932 prepared competent cells were mixed with pKD46 plasmid and then electrotransformed, and the transformed bacterial solution was coated on an LB plate containing ampicillin resistance, and the transformants were screened by overnight culture. The positive single colony was pure cultured to construct the S0932-pKD46 strain. The S0932-pKD46 strain was added to LB broth containing L-arabinose for culture, and further made into competent cells, mixed with the CbtA / CbeA target fragment, and then electrotransformed, and the transformants were screened on an LB plate containing chloramphenicol. The transformants were cultured at 42°C to induce the loss of the auxiliary plasmid pKD46. The loss strain of the auxiliary plasmid pKD46 was screened according to the ampicillin antibiotic test, thereby obtaining a deletion mutant of S0932ΔCbtA / CbeA:cat containing only chloramphenicol resistance. The pCP20 plasmid carrying the FLP recombinase was mixed with the S0932ΔCbtA / CbeA:cat competent cells and then electrotransformed. The transformants were screened on an LB plate containing ampicillin and chloramphenicol resistance, and then transferred to a non-resistant LB plate for culture at 42°C to detect the loss of the auxiliary plasmid pCP20 and CAT resistance genes, thereby obtaining a non-resistant gene mutant, named S0932ΔCbtA / CbeA.

[0043] The genomic DNA of S0932ΔCbtA / CbeA:CAT and S0932ΔCbtA / CbeA was extracted, and the wild-type DNA was used as a control. The ΔCbtA / CbeA-F / ΔCbtA / CbeA-R primers in Table 1 were used for PCR amplification and identification. The gel electrophoresis results showed that the CbtA / CbeA-TAS deletion mutation was successful. After the chloramphenicol resistance gene replaced the target gene, the CbtA / CbeA-TAS sequence size was about 1633 bp. After the chloramphenicol resistance plate identified the elimination of the resistance gene, the size of the target gene was about 619 bp, and the size of the wild-type amplification was about 1310 bp. ( Figure 2 ).

[0044] Example 3 Adhesion test of S0932 wild-type strain and ΔCbtA / CbeA-TAS mutant strain to IPEC-J2 intestinal epithelial cells

[0045] IPEC-J2 cells were vibrated into a single cell suspension using 1640 medium containing 10% FBS, and 500 μL was inoculated into a 24-well cell culture plate. The cells were cultured until a monolayer of cells was formed. 5The pure bacterial suspension of S0932 wild-type strain and ΔCbtA / CbeA-TAS mutant strain was adjusted to OD600 = 0.4, washed 3 times with PBS and placed on ice, and 1×10 cells were inoculated into each well. 7 The cells were incubated at 37℃ for 2h, washed with PBS 3 times, and then 300μL / well of trypsin was added for 5min. Then 5% BSA-PBS was added to blow the cells evenly, and the cells were transferred to EP tubes. The cells were diluted with 15% glycerol PBS and coated on plates. After overnight incubation, the cells were counted and the adhesion rates of different bacteria were calculated. The results showed that the adhesion rate of the wild strain was higher than that of the deletion strain ( Figure 3 ).

[0046] Example 4 Invasion assay of S0932 wild-type strain and ΔCbtA / CbeA-TAS mutant strain on IPEC-J2 intestinal epithelial cells

[0047] IPEC-J2 cells were vibrated into a single cell suspension using 1640 medium containing 10% FBS, and 500 μL was inoculated into a 24-well cell culture plate. The cells were cultured until a monolayer of cells was formed. 5 The pure bacterial suspension of S0932 wild-type strain and ΔCbtA / CbeA-TAS mutant strain was adjusted to OD600 = 0.4, washed 3 times with PBS and placed on ice, and 1×10 cells were inoculated into each well. 7 Bacteria were cultured at 37℃ for 2h; washed 3 times with PBS, and the culture medium was replaced with 1640 medium containing 100μg / mL gentamicin, and cultured in a 37℃ 5% CO2 incubator for 90min to kill extracellular bacteria, and then washed 3 times with PBS, and 1ml of sterile double distilled water was added to lyse the cells to release bacteria, and the lysate was transferred to an EP tube, diluted with 15% glycerol PBS and plated, and cultured at 37℃ for 18h to count, and the invasion rate of bacteria on IPEC-J2 intestinal epithelial cells was calculated by the number of invading bacteria / the number of inoculated bacteria. The results showed that the invasion rate of the wild strain was higher than that of the deletion strain ( Figure 4 ).

[0048] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A strain of Salmonella Indiana ( Salmonella Indiana )S0932, characterized in that: The strain has been deposited in the China Center for Type Culture Collection; Address: Wuhan University; Deposit date: April 19, 2024; Deposit number: CCTCCNO.M 2024732.

2. Use of Indiana Salmonella S0932 according to claim 1 in the study of CbtA / CbeA toxin-antitoxin system.

3. The use of Indiana Salmonella S0932 in the study of CbtA / CbeA toxin-antitoxin system according to claim 1, characterized in that: Bacterial gene editing tools containing chloramphenicol, ampicillin and / or kanamycin resistance tags were used to construct CbtA / CbeA toxin-antitoxin system mutant strains of Indiana Salmonella S0932.

4. The use according to claim 3, characterized in that: Use Red homologous recombination system, RecET homologous recombination system, CRISPR gene editing system, Cre-lox recombination system, FLP-FRT recombination system, suicide plasmid vector and / or transposon vector bacterial gene editing tools.

Images