A method for amplifying circular double-stranded DNA

Abstract

The present application provides a method for amplifying circular double-stranded DNA. The method comprises: performing polymerase chain reaction amplification on a circular template DNA using a forward primer and a reverse primer to obtain linear amplified DNA; wherein the forward primer is capable of binding to the starting site of the positive strand of the circular template DNA; and the reverse primer is capable of binding to the starting site of the negative strand of the circular template DNA; using a DNA endonuclease to cut the linear amplified DNA to obtain linear DNA fragments; wherein the length of the linear DNA fragments is the same as that of the circular template DNA; and using a DNA ligase to connect the two ends of the linear DNA fragments to obtain circular double-stranded DNA. The present application does not rely on living cells, but instead utilizes an in vitro system to directly amplify plasmids. This method has the advantages of faster amplification speed, lower contamination risk, no need for antibiotic selection, ability to accommodate large plasmids, and higher biosafety.

Description

Technical Field

[0001] The present application relates to the technical field of DNA synthesis, and in particular to a method for amplifying circular double-stranded DNA. Background Art

[0002] Plasmids are small, usually circular, double-stranded DNA molecules that occur naturally in bacteria and are capable of replicating independently of the chromosome within the cell. In biotechnology and molecular biology, plasmids are widely used as tools for gene cloning, gene expression, and genetic engineering.

[0003] Traditional plasmid amplification methods mainly rely on bacterial hosts, such as Escherichia coli (E. coli) and yeast (S. cerevisiae), to obtain large amounts of plasmids by introducing plasmids into cells and allowing them to replicate and amplify during culture.

[0004] However, the above technology has the following problems in practical application: It takes a long time: Bacterial culture requires a long time to reach a sufficient cell density for effective plasmid amplification. Taking Escherichia coli as an example, it usually takes 40-50 minutes for one division, and 10-50 ml of overnight culture is required to extract enough plasmids for plasmid extraction; The risk of contamination is relatively high: Bacterial culture may be contaminated by other biological molecules (such as host DNA, RNA and protein), which will affect the purity and yield of the plasmid. For example, when using Gram-negative bacteria (such as Escherichia coli) for plasmid amplification, the endotoxin (lipopolysaccharide) of the cell wall may contaminate the final plasmid preparation, which is a problem for those who use plasmids for clinical or in vivo research. The application of research is particularly important because endotoxins may cause immune reactions; antibiotic selection pressure is large: traditional amplification methods require the use of antibiotics to ensure that only bacteria containing plasmids survive, which increases costs and may have an impact on the environment; plasmid size is limited: some large plasmids have low replication efficiency in bacteria, which limits the amplification and application of these plasmids. Generally, a plasmid of 10,000 bp is the replication limit in bacteria, and due to the metabolic burden, single-copy or low-copy replication origins are generally selected for amplification, further increasing the liquid equivalent of bacteria required and increasing the risk of contamination; low biosafety: using bacteria for plasmid amplification may involve biosafety issues, especially when the plasmid carries potentially dangerous genes. Summary of the Invention

[0005] In view of the above-mentioned problems, the present application is proposed to provide a method for amplifying circular double-stranded DNA that overcomes the problems or at least partially solves the problems, comprising:

[0006] A method for amplifying circular double-stranded DNA, comprising:

[0007] A forward primer and a reverse primer are used to perform polymerase chain reaction amplification on the circular template DNA to obtain a linear amplified DNA; wherein the forward primer is capable of binding to the starting site of the positive strand of the circular template DNA; the reverse primer is capable of binding to the starting site of the negative strand of the circular template DNA; and the length of the linear amplified DNA is more than twice the length of the circular template DNA;

[0008] Cutting the linear amplified DNA with a DNA endonuclease to obtain linear DNA fragments; wherein the length of the linear DNA fragments is the same as the length of the circular template DNA;

[0009] DNA ligase is used to connect the two ends of the linear DNA fragment to obtain circular double-stranded DNA.

[0010] Preferably, the step of performing polymerase chain reaction amplification on the circular template DNA using a forward primer and a reverse primer to obtain a linear amplified DNA comprises:

[0011] A forward primer and a reverse primer are used to perform polymerase chain reaction amplification on the circular template DNA to obtain a forward linear single-stranded DNA and a reverse linear single-stranded DNA; wherein the forward primer can bind to the starting site of the positive strand of the circular template DNA; the reverse primer can bind to the starting site of the negative strand of the circular template DNA; the length of the forward linear single-stranded DNA is more than twice the length of the negative strand of the circular template DNA; and the length of the reverse linear single-stranded DNA is more than twice the length of the positive strand of the circular template DNA.

[0012] The forward linear single-stranded DNA and the reverse linear single-stranded DNA are amplified by polymerase chain reaction to obtain linear amplified DNA; wherein the length of the linear amplified DNA is more than twice the length of the circular template DNA.

[0013] Preferably, the length of the circular template DNA is greater than or equal to 10,000 bp.

[0014] Preferably, the length of the linearly amplified DNA is greater than or equal to 70,000 bp.

[0015] Preferably, the forward primer and / or the reverse primer are random primers.

[0016] Preferably, the DNA polymerase used in the polymerase chain reaction amplification is Phi29 polymerase.

[0017] Preferably, the DNA endonuclease is a type II restriction endonuclease or a type IIs restriction endonuclease.

[0018] Preferably, the DNA endonuclease is BbsI endonuclease, EcoRI endonuclease or Pst1 endonuclease.

[0019] Preferably, the DNA ligase is T3 ligase or T4 ligase.

[0020] Preferably, it also includes:

[0021] The circular double-stranded DNA is separated and purified.

[0022] This application has the following advantages:

[0023] In the embodiments of the present application, compared with the problems of existing methods such as long time consumption, high risk of contamination, high antibiotic selection pressure, limited plasmid size and low biosafety, the present application provides a solution for plasmid amplification in a cell-free manner, specifically: "Use forward primers and reverse primers to perform polymerase chain reaction amplification on circular template DNA to obtain linear amplified DNA; wherein, the forward primer can bind to the starting site of the positive chain of the circular template DNA; the reverse primer can bind to the starting site of the negative chain of the circular template DNA; the length of the linear amplified DNA is more than twice the length of the circular template DNA; the linear amplified DNA is cut using a DNA endonuclease to obtain a linear fragment DNA; wherein the length of the linear fragment DNA is the same as the length of the circular template DNA; and the two ends of the linear fragment DNA are connected using a DNA ligase to obtain a circular double-stranded DNA."

[0024] This application does not rely on living cells, but uses an in vitro system to directly amplify plasmids, which has the following advantages: fast amplification speed: this application only needs 2-4 hours to amplify from 10ng DNA to 10-15ug DNA, and the amplification multiple is close to 106, which is more efficient than traditional bacterial culture methods; lower contamination risk: this application does not rely on living cells, reduces the risk of microbial contamination, especially fundamentally avoids the risk of endotoxins and other bacterial residues, and improves the purity of the plasmid; no need for antibiotic selection: this application avoids the use of antibiotics, reduces costs, and reduces potential impacts on the environment; can accommodate large plasmids: this application can more efficiently replicate large plasmids, expand the scope of plasmid application, and this application has verified that large plasmids of about 20,000bp can be amplified with high fidelity; high biosafety: this application reduces biosafety risks when handling potentially dangerous genes. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solution of the present application, the following is a brief introduction to the drawings required for the description of the present application. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without any creative work.

[0026] Figure 1 This is a schematic diagram of a process for amplifying large DNA fragments provided in one embodiment of the present application;

[0027] Figure 2 This is a flowchart of the steps of a method for amplifying large DNA fragments provided in one embodiment of the present application;

[0028] Figure 3 This is a flowchart of the steps of a method for amplifying large DNA fragments provided in another embodiment of the present application;

[0029] Figure 4 is a sequence map of circular double-stranded DNA in a specific implementation of the present application;

[0030] Figure 5 is a coverage depth graph of circular double-stranded DNA sequencing in a specific implementation of the present application;

[0031] Figure 6 is a read length distribution diagram of circular double-stranded DNA sequencing in a specific implementation of the present application;

[0032] Figure 7 This is the plasmid concentration test result of the amplified products of plasmids P1-P6 in Experimental Example 1 of this application;

[0033] Figure 8 is the calculation result of the amplification fold of the amplified products of plasmids P1-P6 in Experimental Example 1 of this application;

[0034] Figure 9 This is a gel electrophoresis image of the specific PCR product of the GGA assembly product and its amplified product in Experimental Example 2 of this application;

[0035] Figure 10 yes Figure 9 Comparison of sequencing and amplified sequences in lanes 4-6;

[0036] Figure 11 This is the statistical result of the transformed colony count of the GGA assembly product and its processed product in Experimental Example 3 of this application;

[0037] Figure 12 This is an image of a bacterial transformation plate of the GGA assembly product and its processed product in Experimental Example 3 of this application;

[0038] Figure 13This is the gel electrophoresis image of the GGA assembly product and its processed product in Experimental Example 4 of this application. DETAILED DESCRIPTION

[0039] To make the objectives, features, and advantages of this application more readily apparent, the present application is further described below in conjunction with the accompanying drawings and specific embodiments. Obviously, the embodiments described are only a portion of the embodiments of this application, not all of them. All other embodiments derived by persons of ordinary skill in the art based on the embodiments in this application without inventive effort are also within the scope of protection of this application.

[0040] Reference Figure 1 、 2 , shows a method for amplifying circular double-stranded DNA provided by one embodiment of the present application, comprising:

[0041] S110, performing polymerase chain reaction amplification on the circular template DNA using a forward primer and a reverse primer to obtain two or more linear amplified DNAs; wherein the forward primer is capable of binding to the starting site of the positive strand of the circular template DNA; the reverse primer is capable of binding to the starting site of the negative strand of the circular template DNA; and the length of the linear amplified DNA is at least twice the length of the circular template DNA;

[0042] S120, cutting the linear amplified DNA with a DNA endonuclease to obtain linear DNA fragments; wherein the length of the linear DNA fragments is the same as the length of the circular template DNA;

[0043] S130, using DNA ligase to connect the two ends of the linear DNA fragment to obtain circular double-stranded DNA.

[0044] In the embodiments of the present application, compared with the existing methods that are time-consuming, have a greater risk of contamination, have greater antibiotic selection pressure, are limited in plasmid size, and have low biosafety, the present application provides a solution for plasmid amplification using a cell-free method.

[0045] This application does not rely on living cells, but uses an in vitro system to directly amplify plasmids, which has the following advantages: fast amplification speed: this application only needs 2-4 hours to amplify from 10ng DNA to 10-15ug DNA, and the amplification multiple is close to 106, which is more efficient than traditional bacterial culture methods; lower contamination risk: this application does not rely on living cells, reduces the risk of microbial contamination, especially fundamentally avoids the risk of endotoxins and other bacterial residues, and improves the purity of the plasmid; no need for antibiotic selection: this application avoids the use of antibiotics, reduces costs, and reduces potential impacts on the environment; can accommodate large plasmids: this application can more efficiently replicate large plasmids, expand the scope of plasmid application, and this application has verified that large plasmids of about 20,000bp can be amplified with high fidelity; high biosafety: this application reduces biosafety risks when handling potentially dangerous genes.

[0046] Next, a method for amplifying a circular double-stranded DNA in this exemplary embodiment will be further described.

[0047] As described in step S110, the circular template DNA is amplified by polymerase chain reaction using a forward primer and a reverse primer to obtain a linear amplified DNA; wherein the forward primer can bind to the starting site of the positive strand of the circular template DNA; the reverse primer can bind to the starting site of the negative strand of the circular template DNA; and the length of the linear amplified DNA is more than twice the length of the circular template DNA.

[0048] The plasmid to be amplified is used as a circular template DNA. A polymerase chain reaction (PCR) amplification is performed on the circular template DNA using a forward primer and a reverse primer to obtain a forward linear single-stranded DNA and a reverse linear single-stranded DNA. The forward primer is capable of binding to the starting site of the positive strand of the circular template DNA; the reverse primer is capable of binding to the starting site of the negative strand of the circular template DNA; the length of the forward linear single-stranded DNA is at least twice the length of the negative strand of the circular template DNA; and the length of the reverse linear single-stranded DNA is at least twice the length of the positive strand of the circular template DNA.

[0049] The forward linear single-stranded DNA and the reverse linear single-stranded DNA are amplified by PCR to obtain linear amplified DNA; wherein the length of the linear amplified DNA is more than twice the length of the circular template DNA.

[0050] The DNA polymerase in PCR amplification can be Phi29 polymerase, which is capable of continuous and efficient synthesis of long-chain DNA (e.g., large fragments of more than 10,000 bp).

[0051] Specifically, the circular template DNA, the forward primer, the reverse primer, the deoxynucleoside triphosphate mixture, the DNA polymerase and the reaction buffer are mixed, and PCR amplification is performed in a constant temperature mode or a cycling mode; wherein the reaction conditions of the constant temperature mode are: constant temperature incubation at 30°C for 4 hours; the reaction conditions of the cycling mode are: 30°C for 5 minutes, 42°C for 15 seconds, 44 cycles, and inactivation at 65°C for 10 minutes.

[0052] In one embodiment of the present application, the length of the circular template DNA is greater than or equal to 10,000 bp, and the length of the linear amplification DNA is greater than or equal to 70,000 bp.

[0053] In one embodiment of the present application, the forward primer and the reverse primer are both specific primers, which have specific sequences and can complementarily bind to specific sites of the circular template DNA, thereby reducing nonspecific amplification and improving the accuracy of the results.

[0054] As an example, the sequence of the forward primer is shown in SEQ ID NO. 1, which is CTGCAGCGGCCGCTACTAGTA, and the sequence of the reverse primer is shown in SEQ ID NO. 2, which is GAATTCGCGGCCGCTTCTAGAG. The free energy change (ΔG) of both the forward and reverse primers is greater than or equal to -3.0 kcal / mol, and the difference in annealing temperature (Tm) between the forward and reverse primers is less than or equal to 5°C. By designing the primers to have a ΔG greater than or equal to -3.0 kcal / mol, the secondary structure of the primers is relatively unstable, preventing the primers from forming secondary structures or dimers, thereby improving the binding efficiency of the primers to the template DNA. By designing the difference in Tm between the two primers to be less than or equal to 5°C, during PCR amplification, the two primers can anneal to the template DNA within the same or similar temperature range, thereby improving the efficiency of PCR amplification.

[0055] In one embodiment of the present application, the forward primer and the reverse primer are both random primers, whose sequences have a certain degree of randomness and can bind to multiple sites of the circular template DNA, thereby facilitating coverage of unknown sequences, simplifying experimental design and improving amplification efficiency.

[0056] As an example, the forward primer and the reverse primer are oligonucleotides composed of multiple random nucleotides, such as 6-mer (composed of 6 random nucleotides) and 9-mer (composed of 9 random nucleotides), which are shorter in length and have more binding sites, and are suitable for covering unknown sequences.

[0057] As another example, the forward primer and the reverse primer are random hexamer primers with the sequence 5'-NpNpNpNpsNpsN-3', where N represents any nucleotide, p represents a common phosphate bond, and s represents a phosphorothioate bond. Because some DNA polymerases (such as Phi29 DNA polymerase) have proofreading properties (i.e., 3' to 5' exonuclease activity), primers are easily degraded during amplification, thereby reducing yield. By using phosphorothioate bonds at the two 3'-terminal nucleotides, exonuclease-resistant random hexamer primers are obtained, which can extend reaction times and allow the use of higher DNA polymerase concentrations.

[0058] As described in step S120, the linear amplified DNA is cut with a DNA endonuclease to obtain a linear DNA fragment; wherein the length of the linear DNA fragment is the same as the length of the circular template DNA.

[0059] The linear amplified DNA is cut using a DNA endonuclease to obtain linear fragment DNA; wherein the DNA endonuclease only cuts at a single site in the circular template DNA, so that the length of the linear fragment DNA obtained by cutting is the same as the length of the circular template DNA; the DNA endonuclease can be a type II restriction endonuclease or a type IIs restriction endonuclease (e.g., BbsI endonuclease, EcoRI endonuclease, and Pstl endonuclease).

[0060] As an example, the DNA endonuclease is BsmbI endonuclease or EcoRI endonuclease, and its cutting interface is greater than or equal to 4 bp. By designing a longer cutting interface, the accuracy and stability of pairing can be increased, and the efficiency and success rate of subsequent ligation reactions can be improved.

[0061] As another example, the DNA endonuclease is IsceuI endonuclease or IceuI endonuclease, which has a longer recognition sequence, can improve the accuracy of cutting and avoid unnecessary impact on subsequent applications.

[0062] Specifically, the linear amplified DNA is mixed with the DNA endonuclease, and a reaction buffer is added to ensure that the pH and ionic strength of the reaction environment are suitable for the activity of the DNA endonuclease; the mixture is incubated at an appropriate temperature, and the linear amplified DNA is recognized and cut by the DNA endonuclease to obtain linear fragment DNA.

[0063] As described in step S130, DNA ligase is used to connect the two ends of the linear DNA fragment to obtain circular double-stranded DNA.

[0064] DNA ligase is used to connect the two ends of the linear DNA fragment to obtain circular double-stranded DNA; wherein the DNA ligase is T3 ligase or T4 ligase, preferably T4 ligase, which is particularly suitable for connecting DNA molecules with sticky ends.

[0065] Specifically, the cut linear DNA fragment is mixed with the DNA ligase, and adenosine triphosphate and a reaction buffer are added; the mixture is incubated at an appropriate temperature, and the DNA ligase catalyzes the formation of a phosphodiester bond between the two ends of the DNA fragment to obtain a circular double-stranded DNA.

[0066] Reference Figure 3 In one embodiment of the present application, the amplification method further comprises:

[0067] S140, separating and purifying the circular double-stranded DNA.

[0068] As described in step S140, the circular double-stranded DNA is separated and purified.

[0069] The circular double-stranded DNA is separated and purified, and this step can be achieved by any of the following methods:

[0070] (1) Isolating and purifying the circular double-stranded DNA by gel electrophoresis, specifically as follows: Separating the circular double-stranded DNA from other impurities by agarose gel electrophoresis. The circular double-stranded DNA migrates at a different rate than other impurities, and the circular double-stranded DNA can be accurately identified and recovered based on the electrophoresis pattern. Observing and excising the target DNA band using ultraviolet light, the purified circular double-stranded DNA is then recovered using a freeze-thaw method or a gel extraction kit.

[0071] (2) separating and purifying the circular double-stranded DNA by column chromatography, specifically by selecting a suitable column (e.g., a centrifugal column, a gel filtration column, or an ion exchange column, etc.) filler and buffer system to separate the circular double-stranded DNA from other impurities.

[0072] In a specific implementation of the present application, the amplification method includes:

[0073] The plasmid to be amplified (plasmid YYHS_0020, total length 9459 bp) was used as a circular template DNA. PCR amplification was performed on the circular template DNA using forward and reverse primers to produce a linear amplified DNA at least twice the length of the circular template DNA. The forward primer was capable of binding to the start site of the positive strand of the circular template DNA, and the reverse primer was capable of binding to the start site of the negative strand of the circular template DNA. The DNA polymerase used in the PCR amplification was Phi29 polymerase, and the reaction conditions were: constant incubation at 30°C for 4 hours.

[0074] The linear amplified DNA is mixed with the DNA endonuclease, and a reaction buffer of the endonuclease is added to ensure that the pH and ionic strength of the reaction environment are suitable for the activity of the DNA endonuclease; the mixture is incubated at an appropriate temperature, and the linear amplified DNA is recognized and cut by the DNA endonuclease to obtain a linear fragment DNA with the same length as the circular template DNA; wherein the DNA endonuclease is BbsI endonuclease, 1 μL of BbsI endonuclease cuts 1 μg of substrate, the reaction buffer is rCutsmart buffer with a final concentration of 1×, and the mixture is incubated at 37°C for 1 hour.

[0075] The cut linear DNA fragment is mixed with the DNA ligase, and a reaction buffer is added; the mixture is incubated at an appropriate temperature, and the DNA ligase catalyzes the formation of a phosphodiester bond between the two ends of the linear DNA fragment to obtain a circular double-stranded DNA; wherein the DNA ligase is T4 ligase, 1 μL of T4 ligase is added to the enzyme digestion system, the reaction buffer is a T4 ligase buffer with a final concentration of 1×, the reaction is incubated at 25°C for 0.5h or at 16°C overnight, and the reaction is heated at 65°C for 10min to inactivate. The ligation product can be directly transformed.

[0076] The circular double-stranded DNA is separated from other impurities by agarose gel electrophoresis, the target DNA band is observed and cut out using an ultraviolet lamp, and the purified circular double-stranded DNA is recovered by a freeze-thaw method or a gel extraction kit.

[0077] The circular double-stranded DNA was verified by nanopore sequencing, and the sequencing results were completely consistent with the expected target sequence. Figure 4 The sequencing results of the circular double-stranded DNA are shown. Figure 5 、 6 The coverage depth and read length distribution of sequencing are shown respectively.

[0078] Experimental Example 1

[0079] The concentration of the products of plasmids of different sizes amplified by the method of the present application was detected and the amplification factor was calculated; wherein, the amplification time was within 2 hours; the concentration detection method was: extract the amplified product sample, add the sample to the fluorescent quantitative detection solution, read the fluorescence intensity on the fluorometer, and calculate the DNA concentration (unit: ng / μL), and repeat the measurement three times for each sample; amplification factor = concentration after amplification / concentration before amplification.

[0080] Figure 7The plasmid concentrations of the amplified products of plasmids of different sizes are shown, among which plasmid P1 is DVA_AE with a total length of 2606 bp, plasmid P2 is MC3 with a total length of 7707 bp, plasmid P3 is MC6 with a total length of 10437 bp, plasmid P4 is GBI with a total length of 10097 bp, plasmid P5 is PLD3 with a total length of 23386 bp, and plasmid P6 is PLD2 with a total length of 19960. Figure 8 The amplification multiples of the amplified products of plasmids P1 to P6 are shown. It can be seen that the present invention can amplify a large number of plasmids in a short period of time and is not limited in plasmid size.

[0081] Experimental Example 2

[0082] The GGA (Golden Gate, i.e., DNA splicing technology based on type IIs restriction endonucleases) assembly products and the products amplified by the method of the present application were subjected to specific PCR amplification (target band length 992 bp), and the specific PCR products were subjected to agarose gel electrophoresis (electrophoresis conditions: 1% agarose gel, 1× TAE buffer, 160 V voltage, 28 min, and 2 μL of each sample was added).

[0083] Figure 9 The gel electrophoresis images of the specific PCR products of the GGA assembly product and its amplification products are shown. Lane 1 is the electrophoresis band of PolyM5 HiClear 1kb plus DNA Ladder (including DNA fragments of known length), and lanes 2-7 are the specific PCR products of the GGA assembly product (GGA-PCR), the specific PCR products of the blank control without GGA assembly products (Blank-PCR), the specific PCR products of amplification product 1 (i.e., the product obtained by amplifying the GGA assembly product using Phi29, BbsI, and T4) (GGA-RCA-BbsI-T4-PCR), and the specific PCR products of amplification product 2 (i.e., the product obtained by amplifying the GGA assembly product using T7, BbsI, and T4). Electrophoretic bands are shown for the specific PCR product (GGA-RCA-T7-BbsI-T4-PCR) of amplification product 1 (i.e., the product obtained by amplifying the GGA assembly product using Phi29, EcoRI, and T4) (GGA-RCA-EcoRI-T4-PCR), and the specific PCR product (GGA-RCA-T7-EcoRI-T4-PCR) of amplification product 4 (i.e., the product obtained by amplifying the GGA assembly product using T7, EcoRI, and T4). It can be seen that the background bands of the GGA assembly product can be significantly reduced after amplification using the method of this application.

[0084] Figure 10 Shown Figure 9Comparison of the sequencing sequences and amplified sequences in lanes 4-6, where the sequencing sequences and amplified sequences in lanes 4-6 are shown from top to bottom. It can be seen that the mutation rate of the GGA assembly product after amplification by the method of the present application is 0.

[0085] Experimental Example 3

[0086] The GGA assembly product (DVK-GGA, total length 3153 bp) and its product treated by the method of the present application were transformed into bacteria (transformation method: 5 μL of sample was heat-shocked and transformed into DH5α bacteria) and the number of transformed colonies was counted (each sample was measured three times).

[0087] Figure 11 The transformed colony numbers of the GGA assembly product and its processed products are shown, where a is the GGA assembly product, b is the processed product 1 (DVK-GGA-RCA, i.e., the product of the GGA assembly product after amplification in step S110), c is the processed product 2 (DVK-GGA-RCA-Pstl, i.e., the product of the GGA assembly product after amplification in step S110 and enzyme digestion in step S120), and d is the processed product 3 (DVK-GGA-RCA-Pstl-T4, i.e., the product of the GGA assembly product after amplification in step S110, enzyme digestion in step S120, and ligation in step S130). Figure 12 The following images show bacterial transformation plates of GGA assembly products and their treated products. "Ad" has the same meaning as above. Correctly assembled colonies exhibit green fluorescence. It can be seen that the number of transformed colonies in the GGA assembly product treated with this application (treated product 3) is significantly different from that in the untreated GGA assembly product (p < 0.001).

[0088] Experimental Example 4

[0089] The GGA assembly product (pYTK-GGA, total length 5894 bp) and the product treated by the method of the present application were subjected to agarose gel electrophoresis (electrophoresis conditions: 1% agarose gel, 1× TAE buffer, 160 V voltage, 28 min, and 2 μL of each sample was added).

[0090] Figure 13Gel electrophoresis images of GGA assembly products and their processed products are shown. Lane 1 in A is the electrophoresis band of PolyM5 HiClear 1kb plus DNA Ladder, and lanes 2-5 are the electrophoresis bands of GGA assembly products, processed product 1 (pYTK-GGA-RCA, i.e., the product after the GGA assembly product is amplified in step S110), a blank control (Blank) without GGA assembly products, and a negative control (Control) without primers, respectively; Lane 1 in B is the electrophoresis band of PolyM5 HiClear 1kbplus DNA Ladder, and lane 2 is the electrophoresis band of processed product 2 (pYTK-GGA-RCA-Pstl, i.e., the product after the GGA assembly product is amplified in step S110 and digested in step S120); Lane 1 in C is the electrophoresis band of PolyM5 HiClear 1kbplus DNA Ladder. Ladder electrophoresis bands. Lane 2 shows the electrophoresis band of treatment product 3 (pYTK-GGA-RCA-Pstl-T4, the product of the GGA assembly after amplification in step S110, enzyme digestion in step S120, and ligation in step S130). This shows that the GGA assembly product successfully underwent specific rolling circle amplification, and the lengths of the digested and ligated products met expectations.

[0091] Although preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they become aware of the basic inventive concepts. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the embodiments of the present invention.

[0092] Finally, it should be noted that, in this document, relational terms such as first and second, etc., are used only to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprises," "comprising," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or terminal device that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or elements inherent to such process, method, article, or terminal device. In the absence of further limitations, an element defined by the phrase "comprising a ..." does not exclude the presence of additional identical elements in the process, method, article, or terminal device that includes the element.

[0093] The above is a detailed introduction to the circular double-stranded DNA amplification method provided by the present application. Specific examples are used herein to illustrate the principles and implementation methods of the present application. The description of the above embodiments is only used to help understand the method and core ideas of the present application. At the same time, for those skilled in the art, according to the ideas of the present application, there may be changes in the specific implementation methods and application scopes. In summary, the content of this specification should not be understood as limiting the present application.

Claims

1. A method for amplifying circular double-stranded DNA, characterized in that: include: (1) The GGA assembly product is used as a circular template DNA, wherein the GGA assembly product is an assembly product based on DNA splicing technology using a type IIs restriction endonuclease. The circular template DNA is amplified by PCR using a forward primer and a reverse primer to obtain a linear amplified DNA with a length more than twice that of the circular template DNA; wherein the forward primer can bind to the starting site of the positive chain of the circular template DNA; the reverse primer can bind to the starting site of the negative chain of the circular template DNA; the DNA polymerase in the PCR amplification is Phi29 polymerase, and the reaction conditions are: constant temperature incubation at 30°C for 4 hours; When the forward primer and the reverse primer are specific primers, the sequence of the forward primer is shown in SEQ ID NO.1, which is CTGCAGCGGCCGCTACTAGTA, and the sequence of the reverse primer is shown in SEQ ID NO.2, which is GAATTCGCGGCCGCTTCTAGAG. When the forward primer and the reverse primer are non-specific primers, the forward primer and the reverse primer are random hexamer primers, and the sequence thereof is 5'-NpNpNpNpsNpsN-3', wherein N represents any nucleotide, p represents a common phosphate bond, and s represents a phosphorothioate bond; (2) Mixing the linear amplified DNA with a DNA endonuclease and adding a reaction buffer of the endonuclease to ensure that the pH and ionic strength of the reaction environment are suitable for the activity of the DNA endonuclease; incubating the mixture at an appropriate temperature, allowing the DNA endonuclease to recognize and cut the linear amplified DNA to obtain a linear fragment DNA with the same length as the circular template DNA; wherein the DNA endonuclease is BbsI endonuclease, 1 μL of BbsI endonuclease cuts 1 μg of substrate, the reaction buffer is a final concentration of 1× rCutsmart buffer, and incubating at 37°C for 1 hour; (3) Mixing the cut linear DNA fragment with DNA ligase and adding reaction buffer; incubating the mixture at an appropriate temperature, catalyzing the formation of a phosphodiester bond between the two ends of the linear DNA fragment by the DNA ligase to obtain a circular double-stranded DNA; wherein the DNA ligase is T4 ligase, adding 1 μL of T4 ligase to the enzyme digestion system, the reaction buffer is a T4 ligase buffer with a final concentration of 1×, incubating at 25°C for 0.5h or at 16°C overnight, heating and inactivating at 65°C for 10min, and the ligation product can be directly transformed; (4) Separate the circular double-stranded DNA from other impurities by agarose gel electrophoresis, observe and cut out the target DNA band using ultraviolet light, and recover the purified circular double-stranded DNA by freeze-thaw method or gel extraction kit.

Images