Application of a set of SNP molecular markers as detection targets in identifying Chinese pumpkin germplasm resources

Abstract

The invention belongs to the field of biotechnology, and discloses an application of a group of SNP molecular markers as detection targets in identifying Chinese pumpkin germplasm resources. The invention utilizes genome resequencing information of pumpkin germplasm resources, selects representative sites with good polymorphism from millions of SNP sites based on specific parameters and conditions, screens out 25 core SNP sites for developing SNP molecular markers, and then obtains 25 core SNP molecular markers with high polymorphism and uniform distribution on each chromosome and converts them into KASP primers; the invention can lay an important technical support for the identification of pumpkin germplasm resources, the construction of pumpkin DNA fingerprint map, pumpkin kinship analysis, pumpkin variety right protection, etc.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and discloses the application of a group of SNP molecular markers as detection targets in identifying Chinese pumpkin germplasm resources. Background Art

[0002] Chinese pumpkins are grown in all parts of my country, with many local varieties. Discovering and utilizing excellent genes from the rich local pumpkin germplasm resources provides a reliable genetic material basis for the sustainable development of the pumpkin industry. However, such rich local pumpkin germplasm resources and complex genetic backgrounds have brought great challenges to pumpkin variety identification.

[0003] DNA fingerprints can essentially reflect the differences between biological individuals, have high individual specificity and stable reliability, and can accurately and quickly identify new and existing varieties. There are many different DNA fingerprinting techniques, such as RFLP analysis, RAPD analysis, AFLP analysis, ISSR analysis, SSR analysis, SNP analysis, etc. All of these analysis methods are based on DNA polymorphism and produce DNA fingerprints with high individual specificity. RFLP, RAPD, and AFLP techniques have been used in database construction, but they have not been widely used due to technical stability, complexity, and data integration issues. The International Union for the Protection of New Varieties of Different Types recommends SSR and SNP as the preferred DNA fingerprinting marker technology. Since SNP markers have the advantages of covering the entire genome, high throughput, site specificity, co-dominant inheritance, low false positive rate, sharply reduced development and testing costs, and easy data integration, they will become the main marker type for genotype identification in the future.

[0004] KASP (Kompetitive Allele-Specific PCR) refers to competitive allele-specific PCR. It is based on touch-down PCR technology and uses universal fluorescent probes to accurately perform biallelic typing of target SNPs and InDels for a wide range of genomic DNA samples, including complex genomic DNA samples. It provides important technical support for the construction of Chinese pumpkin fingerprints, kinship analysis, variety protection, and identification of germplasm resources. Currently, there is no report on the application of KASP in pumpkin variety identification. Summary of the invention

[0005] In view of the above problems, the present invention discloses the application of a group of SNP molecular markers as detection targets in identifying Chinese pumpkin germplasm resources.

[0006] The purpose of the present invention is achieved through the following technical solutions.

[0007] The application of a group of SNP molecular markers as detection targets in identifying Chinese pumpkin germplasm resources is characterized by:

[0008] The SNP molecular markers include SNP markers as shown in SNP1 to 25:

[0009] The SNP1 differential base G / C is located at position 8067852 of the pumpkin chromosome 1 genome sequence;

[0010] The SNP2 differential base T / C is located at position 1125559 of the pumpkin chromosome 2 genome sequence;

[0011] The SNP3 difference base G / A is located at position 2407491 of the pumpkin chromosome 3 genome sequence;

[0012] The SNP4 differential base C / T is located at position 7694202 of the pumpkin chromosome 3 genome sequence;

[0013] The SNP5 differential base G / A is located at position 11847205 of the pumpkin chromosome 4 genome sequence;

[0014] The SNP6 differential base T / G is located at position 12078770 in the genome sequence of pumpkin chromosome 4;

[0015] The SNP7 differential base TA is located at position 17601626 of the pumpkin chromosome 4 genome sequence;

[0016] The SNP8 differential base T / G is located at position 6361531 of the pumpkin chromosome 5 genome sequence;

[0017] The SNP9 differential base C / T is located at position 9963691 of the pumpkin chromosome 6 genome sequence;

[0018] The SNP10 differential base C / T is located at position 7662052 of the pumpkin chromosome 7 genome sequence;

[0019] The SNP11 differential base A / C is located at position 7244778 of the pumpkin chromosome 11 genome sequence;

[0020] The SNP12 differential base T / G is located at position 7323225 of the pumpkin chromosome 11 genome sequence;

[0021] The SNP13 difference base C / A is located at position 5932910 of the pumpkin chromosome 12 genome sequence;

[0022] The SNP14 differential base T / C is located at position 6638035 of the pumpkin chromosome 12 genome sequence;

[0023] The SNP15 differential base A / G is located at position 3199364 of the pumpkin chromosome 13 genome sequence;

[0024] The SNP16 differential base G / C is located at position 7306064 of the pumpkin chromosome 14 genome sequence;

[0025] The SNP17 differential base G / A is located at position 499307 of the pumpkin chromosome 15 genome sequence;

[0026] The SNP18 differential base C / G is located at position 6577835 of the pumpkin chromosome 16 genome sequence;

[0027] The SNP19 differential base T / G is located at position 4382782 of the pumpkin chromosome 17 genome sequence;

[0028] The SNP20 differential base C / G is located at position 4985309 of the pumpkin chromosome 17 genome sequence;

[0029] The SNP21 differential base G / A is located at position 499985 of the pumpkin chromosome 17 genome sequence;

[0030] The SNP22 differential base G / C is located at position 5648033 of the pumpkin chromosome 18 genome sequence;

[0031] The SNP23 differential base A / G is located at position 3516127 of the pumpkin chromosome 19 genome sequence;

[0032] The SNP24 differential base A / C is located at position 3604243 of the pumpkin chromosome 19 genome sequence;

[0033] The SNP25 differential base C / T is located at position 5918093 of the pumpkin chromosome 12 genome sequence.

[0034] Furthermore, the KASP primers for the above-mentioned SNP molecular markers, the sequences of the primers are shown in SEQ ID NO.1-75.

[0035] Furthermore, the KASP primers of the SNP molecular markers are provided with F1 upstream typing primer 1, F2 upstream typing primer 2 and downstream universal primer for each SNP site; the 5' end of the F1 upstream typing primer 1 is provided with a fluorescent marker FAM, and the 5' end of the F2 upstream typing primer 2 is provided with a fluorescent marker VIC.

[0036] Furthermore, the present invention also discloses the application of the KASP primers in identifying Chinese pumpkin germplasm resources.

[0037] Furthermore, the present invention discloses a kit for identifying Chinese pumpkin germplasm resources, comprising the KASP primers as described above.

[0038] Furthermore, the present invention discloses a method for using the above kit, comprising the following steps:

[0039] 1) Primers were diluted to 10 μM with TE (pH 8.0), and then mixed in a ratio of 1:1:3 for upstream typing primer 1:upstream typing primer 2:downstream universal primer. 1.25 uL of primer mixture was added to every 5 μL reaction system.

[0040] 2) Extracting DNA samples from experimental materials, diluting the entire batch of samples according to the ratio of the lowest concentration sample to single digits, and each 5ul reaction system contains 1.25ul of the diluted DNA sample;

[0041] 3) Constructing a PCR reaction system in a 96-well plate;

[0042] 4) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed;

[0043] 5) PCR reaction.

[0044] Furthermore, in the above method, the PCR reaction system in step 3) is as follows:

[0045] Plate format 96well plate 2*KASP master mix 2.5ul primer mix 1.25ul DNA samples 1.25ul <![CDATA[H2O]]> 0ul Total 5ul 1reaction

[0046] Furthermore, in the above method, the PCR reaction conditions in step 5) are as follows:

[0047]

[0048] Furthermore, in the above method, if the typing result is not ideal, the PCR reaction is added for optimization, and the added PCR reaction conditions are as follows:

[0049] Step Tem Time NO.of cycle 1 95℃ 20sec 3 55℃ 60sec

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] The present invention uses the genome resequencing information of pumpkin germplasm resources, selects representative and polymorphic sites from millions of SNP sites based on specific parameters and conditions, and screens out 25 core SNP sites for the development of SNP molecular markers, thereby obtaining 25 core SNP molecular markers with high polymorphism and uniform distribution on each chromosome and converting them into KASP primers. The 25 core SNP molecular markers were used to verify and analyze the evolutionary tree of 43 pumpkin commercial varieties, and DNA fingerprints of 43 pumpkin varieties were established. The present invention can lay an important technical support for the identification of pumpkin germplasm resources, the construction of pumpkin DNA fingerprints, pumpkin kinship analysis, and pumpkin variety rights protection. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1 : Typing results;

[0053] Figure 2 : Cluster diagram of 43 pumpkin planting resources based on 25 SNP loci.

[0054] Figure 3 : Schematic diagram of ideal typing results: In the figure, the horizontal axis FAM fluorescence accounts for a higher proportion, which is homozygous type 1 (yellow dots); the vertical axis VIC / HEX fluorescence accounts for a higher proportion, which is homozygous type 2 (blue squares); the two fluorescence proportions in the middle area are equal, which is heterozygous (green triangles); the black in the lower left corner is the negative control (NTC) DETAILED DESCRIPTION

[0055] In order to make the purpose, technical scheme and advantages of the present invention clearer, the present invention is further described in detail below through embodiments. However, it should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the scope of the present invention. In addition, in the following description, the description of known structures and technologies is omitted to avoid unnecessary confusion of the concept of the present invention.

[0056] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below in conjunction with the embodiments.

[0057] 1. Definition: KASP (Kompetitive Allele-Specific PCR) refers to competitive allele-specific PCR. It is based on touch-down PCR technology and uses universal fluorescent probes to accurately perform biallelic typing of target SNPs and InDels for a wide range of genomic DNA samples, including complex genomic DNA samples. Ideal typing results are as follows: Figure 3 shown.

[0058] 2. Reagents and consumables

[0059] HiGeno 2×Probe Mix A, Beijing Jiacheng Biotechnology Co., Ltd.;

[0060] PCR reaction plate (no skirt), Sewell, PCR-9601-NS;

[0061] 1.5mL centrifuge tube, F601620-9001;

[0062] Gun tip, Axygen, USA,

[0063] Sealing film, Shanghai Sangon Biotechnology Co., Ltd., F600418-0001;

[0064] Paraffin oil, Shanghai Sangon Biotechnology Co., Ltd., B500301-0500.

[0065] 3. Main experimental instruments

[0066] CFX ConnectTM Real-Time System, Bio-Rad, USA;

[0067] Pipette, Eppendorf, Germany.

[0068] Example 1

[0069] .A set of SNP molecular markers for pumpkin typing:

[0070] The SNP molecular markers include SNP markers as shown in SNP1 to 25:

[0071] The SNP1 differential base G / C is located at position 8067852 of the pumpkin chromosome 1 genome sequence;

[0072] The SNP2 differential base T / C is located at position 1125559 of the pumpkin chromosome 2 genome sequence;

[0073] The SNP3 difference base G / A is located at position 2407491 of the pumpkin chromosome 3 genome sequence;

[0074] The SNP4 differential base C / T is located at position 7694202 of the pumpkin chromosome 3 genome sequence;

[0075] The SNP5 differential base G / A is located at position 11847205 of the pumpkin chromosome 4 genome sequence;

[0076] The SNP6 differential base T / G is located at position 12078770 in the genome sequence of pumpkin chromosome 4;

[0077] The SNP7 differential base TA is located at position 17601626 of the pumpkin chromosome 4 genome sequence;

[0078] The SNP8 differential base T / G is located at position 6361531 of the pumpkin chromosome 5 genome sequence;

[0079] The SNP9 differential base C / T is located at position 9963691 of the pumpkin chromosome 6 genome sequence;

[0080] The SNP10 differential base C / T is located at position 7662052 of the pumpkin chromosome 7 genome sequence;

[0081] The SNP11 differential base A / C is located at position 7244778 of the pumpkin chromosome 11 genome sequence;

[0082] The SNP12 differential base T / G is located at position 7323225 of the pumpkin chromosome 11 genome sequence;

[0083] The SNP13 difference base C / A is located at position 5932910 of the pumpkin chromosome 12 genome sequence;

[0084] The SNP14 differential base T / C is located at position 6638035 of the pumpkin chromosome 12 genome sequence;

[0085] The SNP15 differential base A / G is located at position 3199364 of the pumpkin chromosome 13 genome sequence;

[0086] The SNP16 differential base G / C is located at position 7306064 of the pumpkin chromosome 14 genome sequence;

[0087] The SNP17 differential base G / A is located at position 499307 of the pumpkin chromosome 15 genome sequence;

[0088] The SNP18 differential base C / G is located at position 6577835 of the pumpkin chromosome 16 genome sequence;

[0089] The SNP19 differential base T / G is located at position 4382782 of the pumpkin chromosome 17 genome sequence;

[0090] The SNP20 differential base C / G is located at position 4985309 of the pumpkin chromosome 17 genome sequence;

[0091] The SNP21 differential base G / A is located at position 499985 of the pumpkin chromosome 17 genome sequence;

[0092] The SNP22 differential base G / C is located at position 5648033 of the pumpkin chromosome 18 genome sequence;

[0093] The SNP23 differential base A / G is located at position 3516127 of the pumpkin chromosome 19 genome sequence;

[0094] The SNP24 differential base A / C is located at position 3604243 of the pumpkin chromosome 19 genome sequence;

[0095] The SNP25 differential base C / T is located at position 5918093 of the pumpkin chromosome 12 genome sequence.

[0096] Further, the KASP primers used in the embodiment of the present invention are shown in Table 1 below, from top to bottom are SEQ ID NOs, 1-75

[0097] Table 1: KASP primers

[0098]

[0099]

[0100]

[0101] Add a universal fluorescent tag to the 5' end of the primer as follows: F1 (FAM):

[0102] GAAGGTGACCAAGTTCATGCT=SEQ ID No.76; F2(VIC):

[0103] GAAGGTCGGAGTCAACGGATT=SEQ ID No. 77.

[0104] Example 2

[0105] A kit for identifying Chinese pumpkin germplasm resources uses the KASP primers shown in Example 1.

[0106] The method for using the above kit comprises the following steps:

[0107] 1) Primers were diluted to 10 μM with TE (pH 8.0), and then mixed in a ratio of 1:1:3 for upstream typing primer 1:upstream typing primer 2:downstream universal primer. 1.25 uL of primer mixture was added to every 5 μL reaction system.

[0108] 2) Extracting DNA samples from experimental materials, diluting the entire batch of samples according to the ratio of the lowest concentration sample to single digits, and each 5ul reaction system contains 1.25ul of the diluted DNA sample;

[0109] 3) Constructing a PCR reaction system in a 96-well plate;

[0110] 4) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed;

[0111] 5) PCR reaction.

[0112] The PCR reaction system in step 3) is shown in Table 2 below:

[0113] Table 2: PCR reaction system

[0114] Plate format 96well plate 2*KASP master mix 2.5ul primer mix 1.25ul DNA samples 1.25ul <![CDATA[H2O]]> 0ul Total 5ul 1reaction

[0115] The PCR reaction conditions in step 5) are shown in Table 3 below:

[0116] Table 3: PCR reaction conditions

[0117]

[0118] If the typing result is not ideal, that is, the typing result is not as Figure 3 In the case shown in the figure, the PCR reaction is optimized by adding the PCR reaction conditions, and the added PCR reaction conditions are shown in Table 4 below:

[0119] Table 4: Additional PCR reaction conditions

[0120] Step Tem Time NO.of cycle 1 95℃ 20sec 3 55℃ 60sec

[0121] Test Case

[0122] Using the kit of Example 2, 43 kinds of experimental materials as shown in Table 5 below were typed.

[0123] Table 5: Experimental materials

[0124] Serial number Collection number Variety name Serial number Collection number Variety name 5 V05C0426 Pig's mouth cloud melon 115 ZJ01997 No variety name 7 V05C0551 Vegetable Pumpkin 119 ZJ02001 No variety name 17 V05C0521 Twin Pumpkins 129 ZJ02011 No variety name 22 V05C1027 Round Pumpkin 131 ZJ02013 No variety name 27 V05C1026 Clear Lake Pumpkin 138 P330726011 Gourd Gourd 37 V05C0680 Taiwan's first-class pumpkin 140 P330783015 Dongyang old variety pumpkin 39 V05C0644 Pumpkin 143 P330624009 Hard Pumpkin 43 V05C0833 Round Pumpkin 148 P331022019 Round melon 44 V05C0777 Small grinding disc 155 P330329009 Mastic melon 46 V05C0914 Vineless Pumpkin 157 P330111054 Stone pier pumpkin 57 ZJ00887 No variety name 159 P331021017 Yuhuan Ganjiang Pumpkin 63 ZJ00894 No variety name 168 P330326022 Pingyang Meixi 1 Golden Gourd 67 ZJ00898 No variety name 170 P330825016 Pockmarked Pumpkin 68 ZJ00899 No variety name 193 2018333240 Qujiang Huiping Pumpkin 79 ZJ00184 No variety name 198 2017334054 Fenghua Dayan Pumpkin 86 ZJ00902 No variety name 201 2018334436 Earth Pumpkin 89 ZJ01095 No variety name 223 2018335284 Ruian Fangzhuang Pumpkin 97 ZJ01344 No variety name 233 P331003005 Long Pumpkin 102 ZJ01984 No variety name 235 P331003006 Round Pumpkin 103 ZJ01985 No variety name 242 2017333055 Round Pumpkin 106 ZJ01988 No variety name 249 2019335068 Jintang Old Pumpkin 109 ZJ01991 No variety name

[0125] The classification results are as follows Figure 1 As shown in Figure 2, based on the results, 43 pumpkin planting resource clusters based on 25 SNP loci were obtained. Figure 2 After the test, the typing was verified and 25 SNP sites could distinguish 43 samples.

[0126] It can be seen from the above embodiments that the present invention utilizes the genome resequencing information of pumpkin germplasm resources, selects representative and polymorphic sites from millions of SNP sites based on specific parameters and conditions, screens out 25 core SNP sites for developing SNP molecular markers, and then obtains 25 core SNP molecular markers with high polymorphism and uniform distribution on each chromosome and converts them into KASP primers; it can lay an important technical support for the identification of pumpkin germplasm resources, the construction of pumpkin DNA fingerprint map, the analysis of pumpkin kinship, the protection of pumpkin variety rights, etc.

[0127] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Therefore, based on the innovative concept of the present invention, changes and modifications to the embodiments described herein, or equivalent structural or equivalent process transformations made using the contents of the specification and drawings of the present invention, directly or indirectly applying the above technical solutions to other related technical fields are all included in the protection scope of the patent of the present invention.

Claims

1. KASP primers for detecting SNP molecular markers of Chinese pumpkin germplasm resources, characterized in that: The sequences of the primers are shown in SEQ ID NO.1-75.

2. The KASP primer according to claim 1, characterized in that For each SNP site, an F1 upstream typing primer 1, an F2 upstream typing primer 2 and a downstream universal primer are provided; the 5' end of the F1 upstream typing primer 1 is provided with a fluorescent marker FAM, and the 5' end of the F2 upstream typing primer 2 is provided with a fluorescent marker VIC.

3. Use of the KASP primer as claimed in claim 1 or 2 in identifying Chinese pumpkin germplasm resources.

4. A kit for identifying Chinese pumpkin germplasm resources, characterized in that: Comprising the KASP primer according to claim 1 or 2.

5. The method for using the kit according to claim 4, characterized in that: The following steps are involved: 1) Primers were diluted to 10 μM with TE, and then mixed in a ratio of upstream typing primer 1: upstream typing primer 2: downstream universal primer = 1:1:3 and loaded onto the machine. 1.25 uL of primer mixture was added to every 5 μL reaction system; 2) Extracting DNA samples from experimental materials, diluting the entire batch of samples according to the ratio of the lowest concentration sample to single digits, and each 5ul reaction system contains 1.25ul of the diluted DNA sample; 3) Constructing a PCR reaction system in a 96-well plate; 4) Seal the 96-well PCR reaction plate, shake, and centrifuge to ensure that the reaction system is evenly mixed; 5) PCR reaction.

6. The method of use according to claim 5, characterized in that: The PCR reaction system in step 3) is as follows:

7. The method of use according to claim 5, characterized in that: The PCR reaction conditions in step 5) are as follows:

8. The method of use according to claim 7, characterized in that: If the typing result is not ideal, the PCR reaction is optimized by adding the following conditions:

Images