A 6K liquid-phase breeding chip for the whole genome of broccoli and its specific single nucleotide polymorphism variation sites and applications

Abstract

This invention discloses a 6K liquid-phase breeding chip for broccoli, its dedicated single nucleotide polymorphism (SNP) variant sites, and its applications. The 6K liquid-phase breeding chip provided by this invention includes a probe combination for detecting 5971 SNP variant sites in the broccoli genome. The location information of the probe corresponding to each SNP variant site in the broccoli reference genome is shown in Table 3 of the specification. The SNP variant sites involved in the liquid-phase breeding chip provided by this invention have advantages such as high polymorphism, good repeatability, stable and reliable labeling, and ease of statistical analysis. This invention can also establish a DNA fingerprint database based on the liquid-phase breeding chip for identifying the authenticity of broccoli varieties. It can be used for identifying the authenticity of broccoli varieties, early breeding and identification of broccoli varieties, identification of broccoli seed resources, and provides technical support for enriching broccoli germplasm resources, breeding new varieties, and protecting new varieties, with broad application prospects.

Description

Technical Field

[0001] This invention relates to the field of broccoli variety identification technology, specifically to the broccoli whole genome 6K liquid phase breeding chip and its dedicated single nucleotide polymorphism variation sites and applications. Background Technology

[0002] Broccoli (Brassica oleracea L. var. italica), also known as Chinese broccoli, is an important variety of Brassica oleracea in the Brassicaceae family. Broccoli is hailed as the "crown of vegetables" due to its rich nutritional content and unique anti-cancer active ingredient, sulforaphane, which can significantly enhance human immunity. Broccoli is also an internationally popular vegetable, favored by consumers in Europe, America, Japan, South Korea, South Asia, and Southeast Asia. my country cultivates 1.3 million mu (approximately 86,667 hectares) of broccoli annually, producing 3.3 million tons, accounting for about 30% of the world's total production. In recent years, with urban and rural residents placing greater emphasis on healthy diets and gaining a comprehensive understanding of the health benefits of broccoli, this nutritious and delicious vegetable has gradually become an important vegetable crop in China. However, due to the relatively short history of broccoli cultivation and breeding in China, and the relatively low level of breeding technology, there is an urgent need to develop molecular breeding techniques for broccoli to comprehensively improve the efficiency of broccoli variety selection, which is of great significance for accelerating the development of the broccoli industry.

[0003] With advancements in broccoli genomics and functional gene analysis, a relatively complete broccoli genome has been assembled, and whole-genome resequencing data from nearly a thousand broccoli germplasm resources have been obtained, identifying several functional genes influencing important traits. Liquid-phase breeding chips or targeted sequencing genotyping technology is a technique based on high-throughput sequencing and liquid-phase hybridization for the efficient and accurate detection of thousands of pre-designed breeding-related markers. It can analyze large numbers of samples at once, and is also suitable for small batches, particularly for materials with high genomic diversity such as germplasm resources and breeding segregating populations. Currently, liquid-phase chip technology is widely used in seed resource evaluation, backcross selection breeding, gene mapping, variety DNA fingerprinting, and purity detection. However, there are few reports on liquid-phase chips related to broccoli variety selection, precise gene aggregation, and variety identification. Therefore, the development of liquid-phase chips for broccoli breeding has significant practical implications. Summary of the Invention

[0004] To address the shortcomings of existing technologies, the present invention aims to provide a 6K liquid-phase breeding chip for the whole genome of broccoli, along with its specific single nucleotide polymorphism (SNP) variation sites and applications. This liquid-phase breeding chip can accurately obtain the genotypes of 5971 SNP variation sites in the whole genome of broccoli.

[0005] To achieve the above objectives, the present invention adopts the following technical solution: The first aspect of this invention provides a probe array for detecting combinations of single nucleotide polymorphism (SNP) sites in the whole genome of broccoli. Each SNP site corresponds to one probe, and the SNP site array includes 5971 SNP sites. The locations and base types of the 5971 SNP sites in the broccoli genome are shown in Table 1 of this specification. The locations of the 5971 SNP sites in the genome are determined based on the broccoli 06-9-28 reference genome. In Table 1, the numbers on the left of each SNP site indicate the chromosome number where the SNP site is located, the values ​​in the middle indicate the physical location of the chromosome where the SNP site is located, and the letters on the right indicate the two base types of the SNP site.

[0006] In the probe combination of the first aspect of the present invention, as a preferred embodiment, the corresponding positions of the nucleotide sequences of each probe in the genome are shown in Table 3 of the specification of the present invention. The information of each probe position includes three data points. From left to right, the first data point represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data point represents the start position on the chromosome where the probe is located, and the third data point represents the end position on the chromosome where the probe is located. The corresponding position of each probe is determined based on the reference genome of broccoli 06-9-28.

[0007] The second aspect of the present invention provides a 6K liquid phase breeding chip for the whole genome of broccoli, which includes the probe combination described in the first aspect of the present invention for detecting combinations of single nucleotide polymorphism variation sites in the whole genome of broccoli.

[0008] The 6K liquid-phase breeding chip for the whole genome of broccoli targets the sites described in the first aspect for detecting single nucleotide polymorphisms in the whole genome of broccoli, in order to obtain base information or genotyping of the polymorphic sites.

[0009] Liquid-phase breeding chips can also contain other commonly used reagents or equipment.

[0010] A third aspect of the present invention provides the use of the probe combination of the first aspect described above for detecting combinations of single nucleotide polymorphism variant sites in the whole genome of broccoli, said use including any one of (1) to (8) below: (1) A kit for preparing a broccoli variety identification kit; (2) A kit for preparing a method to identify the authenticity of broccoli varieties; (3) A kit for preparing and analyzing the genetic relationships of broccoli varieties; (4) Used for identifying broccoli varieties; (5) Used to identify the authenticity of broccoli varieties; (6) Used to analyze the genetic relationships of broccoli varieties; (7) Used to identify whether the broccoli variety to be tested contains any of the nine superior broccoli genes shown in Table 2 or which of the nine superior broccoli genes shown in Table 2 it contains; (8) Used to construct a fingerprint database of the broccoli varieties to be tested.

[0011] The fourth aspect of the present invention provides the use of the broccoli whole genome 6K liquid phase breeding chip of the second aspect above, the use including any one of the following (A) to (E); (A) Used to identify broccoli varieties; (B) Used to identify the authenticity of broccoli varieties; (C) Used to analyze the genetic relationships of broccoli varieties; (D) Used to identify whether the broccoli variety to be tested contains any of the nine superior broccoli genes shown in Table 2 of this application specification, or which of the nine superior broccoli genes shown in Table 2 are included. (E) Used to construct a fingerprint database of the broccoli varieties to be tested.

[0012] The fifth aspect of this invention provides a method for constructing a fingerprint database of tested broccoli varieties, comprising the following steps: S1-1: Obtain genomic DNA from the tested broccoli variety; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: Combine the DNA library with the probes from the first aspect above to form a hybridization system and perform hybridization capture, then purify to obtain a sequencing library; S1-4: Sequencing and data analysis were performed on the sequencing library to obtain the genotyping information of the 5971 single nucleotide polymorphism (SNP) variant sites shown in Table 1 of this specification. Based on the genotyping information of the 5971 SNP variant sites, a fingerprint database of the tested broccoli varieties was constructed.

[0013] The sixth aspect of this invention provides a method for identifying a variety of broccoli to be tested, comprising the following steps: S2-1: Obtain the genomic DNA of the broccoli variety to be tested and the standard broccoli variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: Combine the DNA libraries of each variety with the probes in the first aspect above to form a hybridization system and perform hybridization capture. After purification, obtain the sequencing libraries of each variety. S2-4: Sequencing and data analysis were performed on the sequencing libraries of each variety to obtain the genotyping information of the 5971 single nucleotide polymorphism variant sites shown in Table 1 of this specification in each variety. S2-5: The genotyping results of 5971 single nucleotide polymorphism (SNP) variants in the tested broccoli variety were compared with those of the 5971 SNP variants in the standard broccoli variety. The similarity (LS) of the SNP variants between the two broccoli varieties was calculated using the formula: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made: If the locus similarity between the tested broccoli variety and a standard broccoli variety is ≥97.0%, then the tested broccoli variety and the standard broccoli variety are the same variety or are suspected to be the same variety; the fewer the number of different loci, the higher the variety similarity. If the site similarity between the tested broccoli variety and a standard broccoli variety is between 95.0% and 97.0% but does not include 97%, then the tested broccoli variety and the standard broccoli variety are similar varieties. If the site similarity between the broccoli variety to be tested and a certain standard broccoli variety is <95.0%, then the broccoli variety to be tested and the standard broccoli variety are different varieties.

[0014] The standard broccoli varieties mentioned in this invention refer to known broccoli varieties, such as the 72 broccoli varieties recorded in Table 4 of this invention.

[0015] In the method for constructing the fingerprint database of tested broccoli varieties in the fifth aspect above or the method for identifying the broccoli varieties to be tested in the sixth aspect above, as one possible implementation, in step S1-2 or S2-2, the fragmentation and end repair are carried out by a system containing fragmentation and end repair enzymes. The system is: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to make up to 20 μL.

[0016] In the method for constructing the fingerprint database of the tested broccoli varieties in the fifth aspect above or the method for identifying the broccoli varieties to be tested in the sixth aspect above, as one possible implementation, in step S1-2 or S2-2, the reaction system for the adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

[0017] In the method for constructing the fingerprint database of the tested broccoli varieties in the fifth aspect above or the method for identifying the broccoli varieties to be tested in the sixth aspect above, as one possible implementation method, in step S1-3 or S2-3, the hybridization system is 2.5 μg of the concentrated DNA library obtained in step S1-2 or step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.

[0018] The beneficial effects of this invention are: (1) The single nucleotide polymorphism variation site combination provided by the present invention has the advantages of high polymorphism, good repeatability, uniform distribution on chromosomes, stable and reliable markers and easy statistics, which can reflect the genetic kinship of the tested broccoli varieties to the greatest extent.

[0019] (2) The material background of the single nucleotide polymorphism variation site combination involved in the liquid phase breeding chip of the present invention covers a wider range of broccoli varieties, with high representativeness and rich diversity information.

[0020] (3) The 6K liquid phase breeding chip provided by the present invention can be applied to the identification of broccoli varieties, identification of kinship, hybridization and selection and fingerprint pattern construction, which is conducive to accelerating the research and breeding process of broccoli.

[0021] (4) This invention provides for the first time a method for constructing a DNA fingerprint database for identifying the authenticity of broccoli varieties based on high-throughput sequencing. This method can be used to identify broccoli varieties at an early stage of seed or seedling stage, ensuring the authenticity of varieties, effectively protecting the rights and interests of producers and breeders, and providing technical support for the protection of broccoli germplasm resources and new varieties.

[0022] (5) The method for identifying broccoli varieties provided by the present invention can identify unknown broccoli varieties as well as verify the authenticity of known varieties.

[0023] (6) The broccoli variety identification method provided by the present invention has the advantages of high throughput, accuracy, low cost, simple operation, and saving manpower and material resources, and has a very broad application prospect. Attached Figure Description

[0024] Figure 1This is a distribution map of single nucleotide polymorphism variant sites on the broccoli genome in the 6K liquid-phase breeding chip of the present invention.

[0025] Figure 2 The genotype deletion rate of the 6K liquid phase breeding chip of this invention in 72 representative broccoli varieties.

[0026] Figure 3 The MAF values ​​of the 6K liquid phase breeding chip of this invention are used in 72 representative broccoli varieties.

[0027] Figure 4 The results of the analysis of the superior gene carrying status of 72 broccoli varieties using the 6K liquid phase breeding chip of the present invention are shown.

[0028] Figure 5 The results of clustering fingerprint profiles of 72 broccoli varieties using the 6K liquid-phase breeding chip of this invention are shown.

[0029] Figure 6 This is a distribution of the background recovery rate of 100 individual plants in the BC2F1 population using the 6K liquid-phase breeding chip of the present invention. Detailed Implementation

[0030] The following embodiments and accompanying drawings are provided to facilitate a better understanding of the present invention. They are intended to explain in detail one aspect or certain features of the present invention, but do not constitute a limitation on the present invention.

[0031] Unless otherwise stated, the technical and scientific terms used in this invention have their common meaning in the art.

[0032] Any improvements or extensions to the embodiments of the present invention without departing from the spirit or scope of the present invention shall fall within the protection scope of the present invention.

[0033] Unless otherwise specified, the experimental methods described in the following examples are conventional methods. For liquid-phase chip application methods not described in detail in the specification, please refer to (Targeted Sequencing Genotyping (GBTS) Technology and Its Application, 2020).

[0034] Unless otherwise specified, all experimental materials used in the following examples were purchased from conventional biochemical reagent stores. All quantitative experiments in the following examples were performed in triplicate, and the results were averaged.

[0035] Example 1: Acquisition of single nucleotide polymorphism variation sites in the whole genome of broccoli using a 6K liquid phase breeding chip. This invention is based on 123 broccoli resequencing data published in the NCBI SRA database (https: / / www.ncbi.nlm.nih.gov / sra / ?term=broccoli) to screen for single nucleotide polymorphism (SNP) variants that can represent the genetic information of the entire broccoli genome and are suitable for liquid-phase microarray analysis. Specifically, the SNP screening criteria are as follows: first, high-quality SNPs are selected based on minimum allele frequency (MAF) > 0.35, genotype heterozygosity (He) <= 15%, and genotype deletion rate (miss) < 0.1. Then, gaps in the genome are filled using relaxed parameters: MAF > 0.05, He <= 30%, and miss < 0.2. The gap calculation formula is: gap = reference genome size / number of sites * 10, meaning the gap threshold is approximately 900 kb. Additionally, it is ensured that the selected SNPs have no other SNPs, SSRs, or Indels within a 50 bp radius, and that each site can be successfully converted into a KASP molecular marker. Ultimately, the inventors of this invention obtained 267,279 high-quality SNP loci and further screened 5,971 single nucleotide polymorphism (SNP) variants based on their uniform distribution across chromosomes. These SNPs were used in a 6K liquid-phase breeding chip for broccoli, exhibiting high polymorphism. The locations and variant bases of these 5,971 SNP variants on the broccoli chromosomes are shown in Table 1, and their distribution across the nine chromosomes of broccoli is shown in [Table 1]. Figure 1 The base types and physical locations on chromosomes of the aforementioned single nucleotide polymorphism (SNP) variant sites were determined based on the broccoli 06-9-28 reference genome (https: / / ngdc.cncb.ac.cn / biosample / browse / SAMC3157532). The SNP variant sites involved in the broccoli 6K breeding liquid microarray were evenly distributed on the chromosome, with an average physical distance of 98.99 kb between each site, and 35.0% of the variant sites were located in gene exons.

[0036] Table 1. Location and base information of 5971 single nucleotide polymorphism variants on chromosomes.

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] Note: In the single nucleotide polymorphism (SNP) variant site information, the leftmost data is the chromosome number where the SNP variant site is located, the middle value is the physical location of the chromosome where the SNP variant site is located, and the rightmost value is the two genotypes of the SNP variant site.

[0069] The important functional genes and variation information of broccoli involved in the broccoli 6K liquid phase breeding chip of this invention are shown in Table 2.

[0070] Table 2. Important functional genes and variation information in the 6K liquid phase breeding chip of broccoli.

[0071] Example 2: Probe preparation for 6K liquid phase breeding chip of broccoli The broccoli 6K liquid-phase breeding chip includes 5971 probe combinations, each probe hybridizing with a single nucleotide polymorphism (SNP) variant region to form a double strand. Based on the base pairing principle, oligonucleotide probes complementary to the target sequence are designed, with the probe combination design principles as follows: (1) The probe length is 180 bp on average, with single nucleotide polymorphisms in the middle of the probe and 100-200 bp on the flanking sequences; (2) The probe is located in a relatively conservative region (with no other variations in the 50bp on both sides), avoiding regions with repetitive sequences, structural variations, etc. (3) The GC content of the probe is 40%-60%, with a stronger capture ability in the 50% region, avoiding high GC and high AT regions.

[0072] The sequence information of 5971 probes in the 6K liquid phase breeding chip for broccoli is shown in Table 3.

[0073] The probe sequences in Table 3 are synthesized from single-stranded nucleotides with an average length of 180 bp. They are polystyrene microspheres with a biotin group modified at the 5' end and covalently coupled to biotin.

[0074] Table 3. Probe location information for the 6K liquid phase breeding chip for broccoli.

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088]

[0089]

[0090]

[0091]

[0092]

[0093]

[0094]

[0095]

[0096]

[0097]

[0098]

[0099]

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] Note: In the probe information, the leftmost data is the chromosome number where the single nucleotide polymorphism variant site or probe sequence is located, the middle data is the start position on the chromosome where the probe is located, and the rightmost value is the end position on the chromosome where the probe is located.

[0107] Example 3: Evaluation of the genotype detection efficiency of 6K liquid phase breeding chip for broccoli A 6K liquid-phase breeding chip for the whole genome of broccoli involves single nucleotide polymorphism (SNP) variants listed in Table 1 of Example 1 above. This liquid-phase breeding chip includes the probe combination from Example 2. Specifically, 5971 SNP variants correspond to 5971 probes, and each probe hybridizes with one SNP variant to form a double strand.

[0108] To evaluate the genotyping efficiency of 5971 single nucleotide polymorphism (SNP) variant sites, the broccoli 6K liquid phase breeding chip of this invention was used to perform SNP variant genotyping on 72 broccoli hybrids collected from China.

[0109] The basic information of the 72 tested broccoli varieties in this embodiment is shown in Table 4. All 72 tested broccoli varieties are common and high-quality varieties in production or some are introduced varieties from abroad.

[0110] Table 4. Information on 72 broccoli varieties

[0111] The detection method of 6K liquid phase breeding chip for broccoli includes specific steps such as obtaining genomic DNA, library construction, hybridization capture, sequencing, and data analysis.

[0112] 1. Obtaining genomic DNA from the tested broccoli varieties Genomic DNA was extracted from the leaves of 72 tested broccoli varieties using SDS and magnetic bead methods, respectively, to obtain the genomic DNA of the tested broccoli varieties.

[0113] The quality and concentration of genomic DNA from the tested broccoli varieties must meet the requirements for PCR. The standards are as follows: 1% agarose gel electrophoresis shows a single DNA band without obvious diffusion; the A260 / A230 ratio is greater than 2.0 and the A260 / A280 ratio is around 1.8, as detected by a Nanodrop2000 (Thermo) UV spectrophotometer; and the concentration of genomic DNA from the tested broccoli varieties is >50 ng / μL.

[0114] 2. Library Construction Take 300 ng of quality-tested DNA, add 2.6 μL of fragmentation and end-repair enzyme, 4 μL of end-repair reaction buffer, and ultrapure water to a final volume of 20 μL. Then, incubate at 37°C for 30 min and 72°C for 30 min. After fragmentation and repair by the end-repair enzyme, an A will be added to the 3' end of the DNA. Using 10 ng of the repaired DNA obtained in the previous step, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of the Illumina TrueSeq universal adapter sequence (AATGATACGGCGACCACCGAGATCTACAC, sequence 1), and ultrapure water to a final volume of 20 μL, the mixture was incubated at 22°C for 60 min. The DNA fragment with added DNA (A) was ligated to the adapter. PCR amplification was used to ligate the index and sequence from the sequencer to both ends of the adapter-containing DNA fragment, forming a complete library structure. The library was purified and fragments were selected by adding purification beads and mixing by pipetting or vortexing. The purified and selected fragments were then mixed in equal volumes to form a mixed library.

[0115] 3. Hybrid capture The mixed library was concentrated to a dry powder state and then added to the hybridization system for hybridization capture. 2.5 μg of the concentrated library was added to 4 μL of 50 ng / μL probe working solution, and ultrapure water was added to bring the total volume to 16 μL. The mixture was then incubated at 95°C for 10 min and then at 65°C for 2–4 h. After hybridization, 16 μL of the hybridization capture solution was transferred to prepared magnetic beads. The enriched product was purified to complete the preparation of the sequencing library.

[0116] 4. Sequencing and data analysis The purified products were mixed in equal volumes to obtain a sequencing library, which was then subjected to high-throughput sequencing using a BGI T7 sequencer. The raw sequencing bases were split according to the barcodes of different samples, low-quality sequencing data were filtered out, and the data were compared with the broccoli 06-9-28 reference genome to mine single nucleotide polymorphism (SNP) variation information. Based on the obtained SNP information, the corresponding SNP genotypes were derived, thereby constructing the fingerprint profile of the tested varieties.

[0117] 5. Efficiency Evaluation After testing 72 broccoli samples, the average genotyping data detection rate of the 6K liquid phase breeding chip for broccoli was 99.5%. Figure 2 By analyzing the polymorphism information content (MAF) of 5971 single nucleotide polymorphism (SNP) variants, 97.8% of the SNP variant sites had an MAF value greater than 0.05, with an average MAF of 0.324. Figure 3 This indicates that the 6K liquid phase breeding chip for broccoli developed in this invention has high polymorphism in 72 tested broccoli varieties.

[0118] Example 4: Evaluation of the number of superior alleles carried by 72 broccoli varieties The 6K liquid-phase breeding chip for broccoli developed in this invention can be used to identify whether a tested variety contains any of the nine known superior broccoli genes, or which of the nine known superior broccoli genes it contains. Based on the single nucleotide polymorphism (SNP) information of the 72 tested broccoli varieties obtained in Example 3 and the correspondence between the linkage variations of superior genes listed in Table 2 and the SNP variations in Example 1, the number of superior genes carried by the 72 broccoli varieties can be quickly obtained (see...). Figure 4 This provides data support for precision gene aggregation breeding.

[0119] Example 5: Method for detecting whether the broccoli variety to be tested belongs to one of the 72 tested broccoli varieties. 1. Obtaining genomic DNA from the broccoli variety to be tested The leaves of the broccoli variety “Bilv 258” to be tested were taken from the experimental base of the Vegetable Research Institute of Beijing Academy of Agricultural and Forestry Sciences.

[0120] Following the method in step 1 of Example 3, replace "the leaf of the tested broccoli variety" with "the leaf of the broccoli variety to be tested", and keep all other steps unchanged to obtain the genomic DNA of the broccoli variety to be tested.

[0121] 2. Preparation of sequencing libraries Following the method in step 2 of Example 3, replace "genomic DNA of the tested broccoli variety" with "genomic DNA of the broccoli variety to be tested", with all other steps remaining unchanged, to obtain the sequencing library of the broccoli variety to be tested.

[0122] 3. Hybrid capture Perform the procedure according to step 3 in Example 3.

[0123] 4. Sequencing Sequencing libraries of the broccoli varieties to be tested were obtained and sequenced.

[0124] The sequencing results of 5971 single nucleotide polymorphism (SNP) amplification products of the tested broccoli varieties in the broccoli 6K liquid phase breeding chip were compared with 5971 SNP variant sites of 72 tested broccoli varieties (as shown in Table 4). The site similarity (LS) between the two broccoli varieties was statistically analyzed. The formula for calculating LS is: LS = (1-D / T)×100%, where D is the number of differentially expressed sites between the two samples being compared, and T is the total number of sites being compared.

[0125] Then, the following judgment is made: If the locus similarity between the tested broccoli variety and a standard broccoli variety (the tested broccoli variety) is ≥97.0%, then the tested broccoli variety and the standard broccoli variety are suspected to be the same variety; the fewer the number of different loci, the higher the locus similarity. If the site similarity between the tested broccoli variety and a standard broccoli variety (the tested broccoli variety) is between 95.0% and 97.0% but does not include 97%, then the tested broccoli variety and the standard broccoli variety are similar varieties.

[0126] If the site similarity between the broccoli variety to be tested and a certain standard broccoli variety is <95.0%, then the broccoli variety to be tested and the standard broccoli variety are different varieties.

[0127] The results showed that the tested broccoli variety had the highest genetic similarity (87.2%) to the 72 tested broccoli varieties at 5971 single nucleotide polymorphism (SNP) sites. Therefore, the tested broccoli variety does not belong to any of the 72 tested broccoli varieties, meaning that the tested broccoli variety "Bilv 258" is not the same as any of the 72 tested broccoli varieties.

[0128] Example 6: Constructing a DNA fingerprint database of 72 broccoli varieties The 6K liquid-phase breeding chip for broccoli developed in this invention can be used to construct a DNA fingerprint database of 72 broccoli varieties, establishing a unique DNA fingerprint molecular identity card for each variety resource. Figure 5 ).

[0129] Based on the 5971 nucleotide variation information in Example 1 and the 72 tested broccoli varieties in Implementation Case 3, the method in Example 3 can be used to quickly construct a DNA fingerprint database of 72 broccoli varieties, providing data support for whether to introduce newly collected variety resources into the DNA fingerprint database in the future.

[0130] Example 7: Screening for single plants that rapidly restore background in backcross breeding. The 6K liquid phase breeding chip for broccoli developed in this invention can be used to identify and rapidly determine the donor and recipient genome percentages of each individual plant in backcross selection progeny, providing data support for screening backcross progeny with high background recovery rates.

[0131] Based on the 5971 nucleotide variation information in Example 1, seedling genotyping was performed on 100 individual plants from the BC2F1 population constructed from the donor parent XLH2579 and the recurrent parent JYD1211. 3229 SNP variations showing differences between the donor and recurrent parents were screened. The proportion of individual plants with the same genotype as the recurrent parent was calculated. A genotype proportion of 96% from the recurrent parent was used as the selection criterion for restoring the recurrent parent background. Finally, two individual plants were selected (…). Figure 6 Furthermore, its field phenotype is not significantly different from that of the recurrent parent, which significantly improves identification efficiency and saves field planting costs.

Claims

1. A probe combination for detecting a set of Brassica oleracea whole genome single nucleotide polymorphism variant sites, each single nucleotide polymorphism variant site corresponding to a probe, the set of single nucleotide polymorphism variant sites comprising 5971 single nucleotide polymorphism variant sites, the location and base type of the 5971 single nucleotide polymorphism variant sites in the Brassica oleracea genome being as shown in Table 1 of the specification, wherein, In the information for each single nucleotide polymorphism (SNP) variant site, the number on the left indicates the chromosome number where the SNP variant site is located, the value in the middle indicates the physical location of the chromosome where the SNP variant site is located, and the letter on the right indicates the two base types of the SNP variant site. The locations of the 5,971 single nucleotide polymorphism variants in the genome were determined based on the broccoli 06-9-28 reference genome.

2. The probe assembly for detecting combinations of single nucleotide polymorphism (SNP) variant sites across the entire genome of broccoli according to claim 1, characterized in that, The corresponding positions of the nucleotide sequences of each probe in the probe combo in the genome are shown in Table 3 of the specification. The information of each probe position contains three data points. From left to right, the first data point represents the chromosome number where the single nucleotide polymorphism variation site is located, the second data point represents the start position of the probe on the chromosome, and the third data point represents the end position of the probe on the chromosome. The location of each probe was determined based on the broccoli 06-9-28 reference genome.

3. A 6K liquid-phase breeding chip for the whole genome of broccoli, characterized in that, Includes the probe combination for detecting combinations of single nucleotide polymorphism variant sites in the whole genome of broccoli as described in claim 1 or 2.

4. The application of the probe assembly, characterized in that, The probe combination is the probe combination for detecting single nucleotide polymorphism variation sites in the whole genome of broccoli as described in claim 1 or 2, and the use includes any one of the following (1) to (7): (1) A kit for preparing a broccoli variety identification kit; (2) A kit for preparing a method to identify the authenticity of broccoli varieties; (3) A kit for preparing and analyzing the genetic relationships of broccoli varieties; (4) Used for identifying broccoli varieties; (5) Used to identify the authenticity of broccoli varieties; (6) Used to analyze the genetic relationships of broccoli varieties; (7) Used to construct a fingerprint database of the broccoli varieties to be tested.

5. The application of the 6K liquid-phase breeding chip for the whole genome of broccoli, characterized in that, The broccoli whole genome 6K liquid phase breeding chip is the broccoli whole genome 6K liquid phase breeding chip as described in claim 3, and the use includes any one of the following (A) to (D); (A) Used to identify broccoli varieties; (B) Used to identify the authenticity of broccoli varieties; (C) Used to analyze the genetic relationships of broccoli varieties; (D) Used to construct a fingerprint database of the broccoli varieties to be tested.

6. A method for constructing a fingerprint database of tested broccoli varieties, characterized in that, Includes the following steps: S1-1: Obtain genomic DNA from the tested broccoli variety; S1-2: The genomic DNA obtained in step S1-1 is fragmented, end-repaired, adapter-ligated, and purified to obtain a DNA library; S1-3: The DNA library is combined with the probes described in claim 1 or 2 for detecting single nucleotide polymorphism variation sites in the whole genome of broccoli to form a hybridization system and hybridization capture is performed. The resulting sequencing library is then purified. S1-4: Sequencing and data analysis of the sequencing library to obtain the genotyping information of the 5971 single nucleotide polymorphism variant sites as described in claim 1, and constructing a fingerprint database of the tested broccoli varieties based on the genotyping information of the 5971 single nucleotide polymorphism variant sites.

7. A method for identifying a variety of broccoli to be tested, characterized in that, Includes the following steps: S2-1: Obtain the genomic DNA of the broccoli variety to be tested and the standard broccoli variety, respectively; S2-2: The genomic DNA of each variety obtained in step S2-1 is broken, end-repaired, adapter-ligated, and purified to obtain the DNA library of the corresponding variety; S2-3: The DNA libraries of each variety are combined with the probes described in claim 1 or 2 for detecting single nucleotide polymorphism variation sites in the whole genome of broccoli to form a hybridization system and hybridization capture is performed. The sequencing libraries of each variety are then purified. S2-4: Sequencing and data analysis were performed on the sequencing libraries of each variety to obtain the genotyping information of the 5971 single nucleotide polymorphism variant sites as described in Table 1 of claim 1 in each variety; S2-5: The genotyping results of 5971 single nucleotide polymorphism (SNP) variants in the tested broccoli variety were compared with those of the 5971 SNP variants in the standard broccoli variety. The similarity (LS) of the SNP variants between the two broccoli varieties was calculated using the formula: LS = (1-D / T)×100%, where D is the number of differentially expressed SNP variants between the two varieties, and T is the total number of SNP variants compared. Then, the following judgments were made: If the site similarity between the broccoli variety to be tested and a certain standard broccoli variety is greater than or equal to 97.0%, then the broccoli variety to be tested and the standard broccoli variety are the same variety. If the site similarity between the tested broccoli variety and a standard broccoli variety is between 95.0% and 97.0% but does not include 97%, then the tested broccoli variety and the standard broccoli variety are similar varieties. If the site similarity between the broccoli variety to be tested and a certain standard broccoli variety is less than 95.0%, then the broccoli variety to be tested and the standard broccoli variety are different varieties.

8. The method for identifying the broccoli variety to be tested according to claim 7, characterized in that, In step S2-2, the fragmentation and end repair are performed using a system containing fragmentation and end repair enzymes. The system consists of: 300 ng DNA, 2.6 μL of fragmentation and end repair enzymes, 4 μL of end repair reaction buffer, and ultrapure water to bring the total volume to 20 μL.

9. The method for identifying the broccoli variety to be tested according to claim 7, characterized in that, In step S2-2, the reaction system for adapter ligation consists of 10 ng of end-repaired DNA, 2 μL of DNA ligase, 8 μL of buffer, 4 μL of Illumina TrueSeq universal adapter sequence, and ultrapure water to a final volume of 20 μL.

10. The method for identifying the broccoli variety to be tested according to claim 7, characterized in that, In step S2-3, the hybridization system consists of 2.5 μg of concentrated DNA library obtained in step S2-2, 4 μL of probe working solution with a concentration of 50 ng / μL, and ultrapure water to make up the system to 16 μL.

Images