Application of a rose salt tolerance gene RrSPL13 and its miRNA resistance target rRrSPL13
By cloning and modifying the rose salt tolerance gene RrSPL13 and its miRNA resistance target rRrSPL13, an overexpression vector was constructed, which solved the problem of insufficient salt tolerance in rose varieties, improved the salt tolerance of roses under salt stress, and promoted the development of the rose industry.
Patent Information
- Application Number
- CN202410629626.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-21
- Publication Date
- 2026-03-06
- Estimated Expiration
- 2044-05-21
AI Technical Summary
Existing rose varieties have relatively weak salt tolerance, which limits the development of the rose industry, especially in areas rich in saline soil resources where they cannot be fully utilized.
The rose salt tolerance gene RrSPL13 was cloned, and the miRNA resistance target rRrSPL13 was obtained through synonymous mutation of miRNA response element. An overexpression vector was constructed to achieve overexpression of RrSPL13 and rRrSPL13 for salt tolerance cultivation and breeding of roses.
It significantly improved the salt tolerance of roses, promoted the growth and development of roses under salt stress, provided the foundation for salt tolerance breeding, and promoted the development of the rose industry.
Smart Images

Figure CN118726375B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to the application of a rose salt tolerance gene RrSPL13 and its miRNA resistance target rRrSPL13. Background Technology
[0002] Wild rose (Rosa rugosa Thunb.), a deciduous shrub belonging to the genus Rosa in the family Rosaceae, is a Class II endangered protected plant in China, naturally distributed in the coastal areas of Northeast China, the Russian Far East, the Korean Peninsula, and Japan. It adapts to high-salinity habitats and possesses strong salt tolerance, making it a valuable parent material for breeding salt-tolerant varieties of Rosa. Cultivated roses have excellent ornamental and quality traits, are rich in rose essential oil and other aromatic substances, and are widely used in the fragrance industry. However, long-term artificial selection has resulted in cultivated rose varieties having weaker salt tolerance. Furthermore, my country's main rose-producing areas possess abundant saline soil resources that cannot be fully utilized, thus limiting the promotion and development of the rose industry.
[0003] SPL transcription factors are a family of transcription factors unique to green plants, widely found in green algae, gymnosperms, angiosperms, and bryophytes. The earliest SPL genes, AmSBP1 and AmSBP2, were discovered in snapdragons. They can bind to the promoter of snapdragon SQUAMOSA (SQUA) and thus regulate the early development of snapdragon flowers. Arabidopsis thaliana AtSPL genes are divided into nine branches. All SPL transcription factors contain a highly conserved DNA-binding domain, the SBP domain, composed of 79 amino acid residues and containing two zinc ion binding sites composed of Cys-Cys-His-Cys and Cys-Cys-Cys-His, respectively, representing a novel zinc finger structure. A nuclear localization signal sequence is located at the C-terminus of the SBP domain, which partially overlaps with the second zinc ion binding site, allowing SPL protein to enter the nucleus for expression. EDTA chelation confirms that the zinc finger structure of the SBP domain is essential for the binding of SPL protein to DNA molecules. Studies of the SPL family have revealed that, in addition to its involvement in plant floral organ development and leaf morphogenesis, it is also related to fruit development, spore development, gibberellin signaling, fungal resistance, and copper ion stress. Research indicates that miR156-SPL controls plant physiological age, thus influencing various stages of organ development and morphogenesis. In Arabidopsis, miR156 is significantly induced by salt stress. Overexpression of miR156 increases plant tolerance to salt and drought while delaying flowering. However, overexpression of the target gene mimic or the resistance target SPL9 (which eliminates MRE) results in the opposite phenotype: increased sensitivity to salt and drought and earlier flowering. Rice miR156 is also induced by salt stress. Rice overexpressing miR156 or the resistance target exhibits a phenotype similar to Arabidopsis. It is speculated that SPL9 affects anthocyanin metabolism by regulating dihydroflavonol-4-reductase (DFR). Anthocyanin accumulation enhances plant stress resistance, and the miR156-SPL9-DFR pathway dynamically links stress and developmental regulation. A similar phenomenon occurred under heat stress. Heat stress induced downregulation of miR156 and SPL, which improved plant adaptability but slowed growth. However, under low-temperature conditions, plants overexpressing miR156 more efficiently inhibited SPL3 translation, preventing the FT promoter from initiating transcription and significantly delaying flowering. The miR156-SPL9-FT model allowed plants to balance environmental temperature and developmental processes. This demonstrates that miR156-SPL links abiotic stress to plant growth and development, enabling plants to flexibly control stress responses and growth.
[0004] SPL plays an important role in plant salt stress response and is influenced by post-transcriptional regulation by miR156. Currently, the regulation of salt tolerance by the rose SPL gene family and its members has not been studied. Cloning and developing SPL members that regulate salt tolerance in roses will provide guidance for resistance breeding in the genus Rosa, lay the foundation for cultivating superior new rose varieties with high salt tolerance and economic value, and promote the development of the rose industry. Summary of the Invention
[0005] Objective of the Invention: To address the problems in existing technologies, the objective of this invention is to provide a rose salt-tolerance gene, RrSPL13, that meets the application requirements of rose salt-tolerance breeding. Another objective of this invention is to provide a miRNA resistance target, rRrSPL13, derived from the aforementioned rose salt stress response gene RrSPL13. A further objective of this invention is to provide an application for the aforementioned rose salt stress response gene RrSPL13 or the miRNA resistance target rRrSPL13.
[0006] Technical solution: A rose salt tolerance gene RrSPL13, the nucleotide sequence of which is shown in SEQ ID No. 1. The amino acid sequence of the expressed protein of the salt tolerance gene RrSPL13 is shown in SEQ ID No. 2. A miRNA resistance target rRrSPL13, obtained by synonymous mutation of the salt tolerance gene RrSPL13 through miRNA response element, the nucleotide sequence of which is shown in SEQ ID No. 3.
[0007] An overexpression vector containing the salt tolerance gene RrSPL13, wherein the overexpression vector is pNC-Cam1304-MCS35S:RrSPL13. An overexpression vector containing the miRNA resistance target rRrSPL13, wherein the overexpression vector is pNC-Cam1304-MCS35S:rRrSPL13.
[0008] Application of the salt-tolerant gene RrSPL13, the expressed protein of the salt-tolerant gene RrSPL13, the overexpression vector of the salt-tolerant gene RrSPL13, the miRNA resistance target rRrSPL13, and the overexpression vector containing the miRNA resistance target rRrSPL13 in salt-tolerant rose cultivation.
[0009] Compared with the prior art, the present invention has the following beneficial effects:
[0010] 1) This invention uses wild rose as material to clone the RrSPL13 gene;
[0011] 2) This invention uses real-time quantitative PCR to detect the spatiotemporal expression pattern of the RrSPL13 gene under salt stress; and obtains the miRNA resistance target rRrSPL13 by synonymously mutating the miRNA response element using large primer mutagenesis technology.
[0012] 3) Under salt stress, the miRNA response element of RrSPL13 is regulated by miRNA. RrSPL13 is rapidly upregulated in rose roots. The rRrSPL13 with mutation of this element is not subject to post-transcriptional regulation by miRNA, which proves that the rose salt stress response gene RrSPL13 and its miRNA resistance target rRrSPL13 provided by this invention have important application value in salt tolerance.
[0013] 4) Through the analysis of the salt tolerance phenotype of 'Purple Branch' rose overexpressing rRrSPL13 and the salt tolerance phenotype of Arabidopsis thaliana overexpressing RrSPL13 and rRrSPL13, the RrSPL13 gene, the miRNA resistance target rRrSPL13, the RrSPL13 gene expression protein, and the overexpression vector of RrSPL13 gene and miRNA resistance target rRrSPL13 of the present invention can be used for salt-tolerant rose cultivation and breeding. Attached Figure Description
[0014] Figure 1 This is a diagram illustrating the expression pattern of the RrSPL13 gene under salt stress.
[0015] Figure 2 This is a map of the plant overexpression vector pNC-Cam1304-MCS35S plasmid;
[0016] Figure 3 This is a diagram showing the observation results of salt tolerance phenotypes in Arabidopsis thaliana overexpressing RrSPL13 and rRrSPL13;
[0017] Figure 4 This is a diagram showing the results of salt tolerance phenotype observation in 'Purple Branch' rose overexpressed with rRrSPL13. Detailed Implementation
[0018] The technical solution of the present invention will be described in detail below with reference to the accompanying drawings, but the scope of protection of the present invention is not limited to the embodiments described.
[0019] Example 1
[0020] RrSPL13 gene cloning: Using cDNA from wild rose leaves as a template, the gene coding region fragment was amplified, ligated into a cloning vector, and sequenced to obtain the gene nucleotide sequence; the specific steps are as follows:
[0021] Step 1: Extract total RNA from wild rose roots using the FastPure Plant Total RNA Isolation Kit (Vazyme). The specific steps are as follows:
[0022] Step 1) Spray RNase and nucleic acid remover in the clean bench to eliminate the interference of RNase on subsequent experiments;
[0023] Step 2) Preheat Buffer PRL to 65 °C in a water bath and add 5% β-mercaptoethanol to it;
[0024] Step 3) Take about 0.3 g of sample (sample refers to wild rose leaves) in a mortar, add liquid nitrogen and quickly freeze-grind, then add 500 μL of preheated Buffer PRL (obtained in step 2) at 65 ℃ and immediately vortex vigorously for 60 sec to fully lyse it;
[0025] Step 4) Place the pyrolysis mixture in a 65 °C water bath for 5 min, inverting it 1-2 times during the process to aid pyrolysis, followed by centrifugation at 12000 rpm for 10 min;
[0026] Step 5) Transfer the supernatant to a new 1.5 ml RNase-free centrifuge tube and add 0.5 times the volume of the supernatant in Ethanol absolute. Immediately mix by pipetting.
[0027] Step 6) Place FastPure gDNA-Fiter Column II into a collection tube, transfer the above mixture into it, centrifuge at 12000 rpm for 2 min, and discard the filtrate;
[0028] Step 7) Place the FastPure gDNA-Fiter Column II obtained in Step 6) into a new CollectionTubes (2 ml), add 500 μL Buffer PRL (obtained in Step 2), and centrifuge at 12000 rpm for 30 sec.
[0029] Step 8) Add 0.5 times the volume of Ethanol absolute to the supernatant obtained by centrifugation in Step 7), and immediately mix by pipetting.
[0030] Step 9) Transfer the mixture to FastPure RNA Column IV, centrifuge at 12000 rpm for 2 min, and discard the filtrate;
[0031] Step 10) Add 500 μL of Buffer PRW2 to the FastPure RNA Column IV obtained in Step 9), centrifuge at 12000 rpm for 30 sec, and discard the filtrate;
[0032] Step 11) Repeat step 10).
[0033] Step 12) Place the FastPure RNA Column IV adsorption column obtained in Step 11) back into the collection tube and centrifuge at 12000 rpm for 2 min;
[0034] Step 13) Transfer the FastPure RNA Column IV obtained in Step 12) to a new RNase-free Collection Tube (1.5 ml), add 30 μL of RNase-free ddH2O dropwise to the center of the adsorption column membrane, incubate at room temperature for 2 min, and centrifuge at 12000 rpm for 1 min.
[0035] Step 14) Aliquot the collected RNA into 1 μg portions and store them in a -80°C freezer.
[0036] Step 2: Reverse transcribe the RNA obtained in Step 1 into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme). The specific steps are as follows:
[0037] Step 1) RNA template denaturation: Add RNase-free ddH2O to 8 μL of 5 μg Total RNA, incubate at 65℃ for 5 min, and then stand on ice for 2 min;
[0038] Step 2) Removal of genomic DNA: Add 2 μL of 5×g DNA wiper Mix to the product from the previous step, mix well by pipetting, and react at 42℃ for 2 min;
[0039] Step 3) First-strand cDNA acquisition: Add 2 μL of 10×RT Mix, 2 μL of HiScript III Enzyme Mix, and 1 μL of Oligo (dT) to the product from the previous step. 20 VN and 5 μL RNase-Free ddH2O were mixed by pipetting. The reaction was carried out in three steps: 25℃ for 5 min; 37℃ for 45 min; 85℃ for 5 sec, to obtain cDNA.
[0040] Step 3: Isolate the rose RrSPL13 gene;
[0041] Design upstream and downstream primers containing the complete open reading frame for the RrSPL13 gene:
[0042] Upstream primer: 5'-ATGGACTGGAACTTGAAAGCA -3';
[0043] Downstream primer: 5'-CTACTCCCAATGAAAGGGAAG-3'.
[0044] Add 25 μL PrimeSTAR Max Premix (2X), 2 μL Primer F and Primer R, 1 μL cDNA and 20 μL RNase-Free ddH2O to a PCR tube and mix thoroughly by pipetting. Perform the amplification reaction according to the following program: 95 °C, 3 min; 95 °C, 10 sec, 55 °C, 5 sec (35 cycles); 72 °C, 5 sec; 72 °C, 3 min. Obtain the purified PCR product using the FastPure Gel DNAExtraction Mini Kit.
[0045] The RrSPL13 gene was cloned into a vector using the pEASY-Blunt Cloning Kit, as follows:
[0046] Step 1) Ligation vector: Add 1 μL of pEASY-Blunt Zero CloningVector to 50 ng of PCR product, add RNase-Free ddH2O to 5 μL, and incubate at 25 ℃ for 10 min to obtain the ligation product.
[0047] Step 2) E. coli transformation: Thaw freshly prepared or -70 ℃ frozen Trans1-T1 competent cells on ice; take 5 μL of ligation product, add it to 100 μL of competent cells, mix gently, and incubate on ice for about 30 min; heat shock in a 42 ℃ water bath for 90 sec, then quickly place on ice for 3-5 min; add 800 μL of LB liquid medium, shake at 37 ℃ & 100 rpm for 1 h; centrifuge at 4000 rpm for 3 min, aspirate the upper 800 μL of medium, and mix the remaining bacterial solution; spread the bacterial solution onto LB selection solid medium containing Kans, and incubate upside down at 37 ℃ overnight.
[0048] Step 3) Positive clone screening and sequencing analysis: Single colonies were selected from the screening culture plate and inoculated into LB liquid medium, and cultured at 37 ℃ & 250 rpm for 6 h. After using the 6-h cultured bacterial solution as a template for PCR detection, positive bacterial solutions were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing verification to confirm the correct sequence, and the RrSPL13 gene was successfully isolated. The nucleotide sequence of RrSPL13 is shown in SEQ ID No. 1. The corresponding amino acid sequence of RrSPL13 is shown in SEQ ID No. 2.
[0049] Example 2
[0050] Analysis of RrSPL13 gene expression pattern by quantitative real-time PCR:
[0051] Two pairs of primers were designed based on the RrSPL13 gene, spanning the miRNA recognition element (MRE) region and the 3' end, to perform a real-time quantitative PCR reaction:
[0052] The upstream primer across the MRE region is 5'-CCAGCCCCTTCTGAATAGCAT-3' and the downstream primer is 5'-GCTGCATCATGTGTCTCAAACCC-3'.
[0053] The upstream primer at the 3' end is 5'-GACGCAGCAGCAGACATC-3' and the downstream primer is 5'-CCAGAACTGAATCCATTGGCTCT-3';
[0054] Based on the internal reference gene (5.8S), the upstream primer 5'-CGGCAACGGATATCTCGG-3' and the downstream primer 5'-TGTGACGCCCAGGCAGACG-3' were designed.
[0055] Real-time quantitative PCR was performed using SYBR Premix Ex Taq (Takara) and a CFX96TM (Bio-RAD) quantitative PCR instrument. The results are as follows: Figure 1As shown, the horizontal axis represents the time interval of 0.5h-2h of salt stress on roses (0h is the control), and the vertical axis represents the relative expression level of RrSPL13. RrSPL13 was significantly induced by salt stress. Cross-MRE region detection revealed that the abundance of the full-length transcript of RrSPL13 increased weakly at 1h of salt stress, while the abundance of the 3' end fragment of RrSPL13 increased significantly at 1h of salt stress, indicating a strong mRNA cleavage effect under stress. This suggests that RrSPL13, as a target gene of miRNA, was significantly silenced. Although RrSPL13 responded significantly to salt stress, if RrSPL13 genetic transformation is carried out directly, RrSPL13 in transgenic plants will also be silenced by miRNA, weakening its salt stress response. It is necessary to construct a resistance target rRrSPL13 that is not regulated by miRNA to ensure that the full-length transcript of RrSPL13 can be expressed at a high abundance in rRrSPL13 transgenic plants in response to salt stress.
[0056] Example 3
[0057] Multipoint mutagenesis was performed using large primer PCR to obtain rRrSPL13, a miRNA response element synonym of RrSPL13, whose nucleotide sequence is shown in SEQ ID No. 3.
[0058] The specific steps are as follows:
[0059] Based on codon degeneracy, design synonymous mutation primers to introduce as many mutation sites as possible, but avoid poly structures with more than 3 bases, while retaining at least 10 nt of complementary bases on the flanks. The RrSPL13 mutation primer is 5'- CCCGATTCGGATTGCGCATTGTCCTTATTGTCCTCGCCGCAGACGCAGCA -3'.
[0060] In a single-round PCR reaction, the PCR product fragment was amplified using the RrSPL13 mutant primer and the RrSPL13 ORF downstream primer from Example 1.
[0061] In the second round of PCR reaction, the product of the first round of reaction was used as the large primer and the upstream primer of RrSPL13 ORF in Example 1 to perform PCR to obtain the resistance target rRrSPL13 fragment with multi-site mutation.
[0062] The first and second rounds of PCR both used the following high-fidelity PCR reaction system: 10×LA PCR Buffer 5.0 μL; 2.5 mM dNTP Mixture 8.0 μL; 25 mM Mg 2+5.0 μL; LA Taq DNA Polymerase (5 U / μL) 0.5 μL; upstream primer (10 μM) 2 μL; downstream primer (10 μM) 2 μL; template (wild rose cDNA) 1 μL; add sterile ddH2O to make up to 50 μL. Reaction program: pre-denaturation 94℃ 3 min - (94℃ 40 s - 55℃ 30 s - 72℃ 30 s) × 35 cycles - 72℃ 10 min.
[0063] The second-round PCR product was ligated into a T-vector, transformed into E. coli, and then cloned and sequenced. The T-vector containing the positive fragment was then recovered.
[0064] Example 4
[0065] Using the plant overexpression vector pNC-Cam1304-MCS35S (plasmid map) Figure 2 (As shown) Construct RrSPL13 and rRrSPL13 overexpression vectors. The construction method is as follows:
[0066] 1) Obtain the RrSPL13 and rRrSPL13 gene fragments fused with the NC adapter: Design primers for RrSPL13 with the NC adapter (the same primer is used for both RrSPL13 and rRrSPL13 genes), with the upstream primer 5'-AGTGGTCTCTGTCCAGTCCTATGGACTGGAACTTGAAAGCA-3' and the downstream primer 5'-GGTCTCAGCAGACCACAAGTCTACTCCCAATGAAAGGGAAG-3'.
[0067] The target fragments of the RrSPL13 gene obtained in Example 1 and the rRrSPL13 gene obtained in Example 3 were used as templates for PCR amplification. The PCR amplification and product recovery process was the same as in Example 1.
[0068] 2) Recombinant vectors were obtained using the Nimble Cloning kit (NC Biotech): 50 ng of the recovered fragment and 1 μL of pNC-Cam1304-MCS35S vector were added to 5 μL with RNase-Free ddH2O and incubated at 25 °C for 10 min to obtain the recombinant product. The transformation of E. coli and the screening of positive clones were carried out in the same way as in Example 1. The positive bacterial culture was sent to Sangon Biotech (Nanjing) for sequencing to obtain the recombinant overexpression vectors pNC-Cam1304-MCS35S:RrSPL13 and pNC-Cam1304-MCS35S:rRrSPL13.
[0069] 3) Agrobacterium transformation: Thaw competent Agrobacterium K599 cells at room temperature. Add 0.01-1 μg plasmid DNA to each 100 μL of competent cells. Mix well by hand by tapping the bottom of the tube. Incubate on ice for 5 minutes, in liquid nitrogen for 5 minutes, in a 37°C water bath for 5 minutes, and in an ice bath for 5 minutes. Add 700 μL of antibiotic-free YEB liquid medium and incubate at 28°C with shaking for 2-3 hours. Centrifuge at 6000 rpm for 1 minute to collect the bacteria. Spread the bacteria on YEB plates containing kanamycin resistance and incubate upside down at 28°C for 2-3 days until positive colonies grow.
[0070] In this step, the plasmid DNA is plasmid DNA containing pNC-Cam1304-MCS35S:RrSPL13 and pNC-Cam1304-MCS35S:rRrSPL13.
[0071] The overexpression vector is equipped with a nimble cloning frame, which can rapidly assemble gene fragments in one step to obtain an overexpression frame of 35S promoter-RrSPL13-NOS terminator or 35S promoter-rRrSPL13-NOS terminator, which can ensure the stable and continuous high expression of the RrSPL13 gene or rRrSPL13 gene in the host cell.
[0072] Example 5
[0073] Transgenic plants were obtained by infecting Arabidopsis thaliana with inflorescences using the inflorescence dipping method and then screening for hygromycin-resistant transformed seedlings. The main steps and reagents used are described below:
[0074] The abbreviations for the plant hormones used in the culture medium in this invention are as follows: Kan (Kanamycin); Hyg (Hygromycin); Arabidopsis thaliana transformation aid (Silwet L-77).
[0075] (1) Culture of Agrobacterium: Positive colonies from Example 4 were picked and inoculated into liquid LB medium (10 g / L peptone + 5 g / L yeast extract + 10 g / L NaCl + 50 mg / L Kan) and cultured overnight at 28 ℃ and 200 rpm until the bacterial concentration reached OD 600 The value is 1.5-2.0.
[0076] (2) Arabidopsis inflorescence staining: Centrifuge the shaken bacterial solution at 4500 rpm for 10 min, and soak the Arabidopsis inflorescence in a 5% sucrose solution (with 20 μL / 100 ml of surfactant Silwet L-7) for about 30 sec, then cover it with light and keep it moist and place it horizontally for 12-24 h.
[0077] (3) Screening of positive seedlings: Infected Arabidopsis thaliana were placed in an incubator for normal culture. The harvested seeds were disinfected in a clean bench by passing 70% alcohol for 15-30 seconds and 2% sodium hypochlorite for 15 minutes. After being aseptically washed 3-4 times, the seeds were spread on 1 / 2 MS medium containing resistance (1 / 2 MS + 30 g / L sucrose + 7 g / L agar + 20 mg / L Hyg) for screening. The selected T1 generation plants were tested for PCR positivity and transplanted to a light incubator to await seed harvesting. The operation was repeated until T3 generation homozygous plants, i.e., Arabidopsis thaliana overexpressing RrSPL13 and rRrSPL13, were obtained.
[0078] Example 6
[0079] Cut-dip-budding (CBD) method was used to induce hairy roots for homologous transformation of 'Purple Branch' rose: Unlignified lateral branches of 'Purple Branch' rose were cut into 4-5 cm cuttings, and the bottom of each cutting was dipped in the positive K599 Agrobacterium colony obtained in Example 4. The cuttings were then colonized in vermiculite and cultured for 3 weeks under long-day conditions (light:dark = 14 hours:10 hours) at 25 °C to obtain a large number of transgenic hairy roots. The positive roots were verified by GFP marker on the vector, and 'Purple Branch' rose RrSPL13 and rRrSPL13 overexpression plants were obtained.
[0080] Example 7
[0081] Salt tolerance assessment of plants mimicking RrSPL13 overexpression:
[0082] (1) Identification of salt tolerance in Arabidopsis thaliana overexpressing RrSPL13;
[0083] The Arabidopsis thaliana overexpressing RrSPL13 and rRrSPL13 obtained in Example 5 and wild-type Arabidopsis thaliana were sown on 1 / 2 MS medium containing NaCl solutions of 0 mM, 120 mM, and 150 mM concentrations and grown for two weeks, and the root system was observed. The 30-day-old RrSPL13 and rRrSPL13 overexpressing Arabidopsis thaliana and wild-type Arabidopsis thaliana were irrigated with 500 mL, 200 mM NaCl solution and NaCl-free water for 14 days, respectively, and the plant growth was observed.
[0084] Phenotypic observation results are as follows Figure 3 As shown in the figure, WT represents wild-type Arabidopsis thaliana, and RrSPL13-OE represents RrSPL13-overexpressing Arabidopsis thaliana; RrSPL13 mut -OE represents rRrSPL13 overexpression in Arabidopsis thaliana.
[0085] Phenotypic observations revealed that the root length of overexpressing plants was significantly longer than that of wild-type plants (e.g., ...). Figure 3(As shown in a); 30-day-old Arabidopsis thaliana seedlings were irrigated with 200 mM NaCl solution for 14 days. The overexpression lines were healthier and significantly more salt-tolerant than wild-type plants (e.g., ...). Figure 3 (As shown in b in the figure). The above evidence demonstrates that overexpression of RrSPL13 promotes salt tolerance in Arabidopsis plants.
[0086] (2) Identification of salt tolerance in 'Purple Branch' rose overexpressed with RrSPL13:
[0087] The 'Purple Branch' rose plants overexpressing rRrSPL13 obtained in Example 5 and the 'Purple Branch' roses without positive colony treatment were irrigated with 500 mL of 120 mM NaCl solution and water for 7 days.
[0088] Phenotypic observation results are as follows Figure 4 As shown in the figure, RrSPL13 mut -OE represents rRrSPL13 overexpressing plants treated with NaCl for 7 days; Control represents *Rosa purpureus* without positive colony treatment, serving as the control group.
[0089] Compared to the control, the rRrSPL13 overexpressing plants showed only slight leaf wilting (as seen in the control plants, where leaves faded and turned yellow). Figure 4 As shown in a), its chlorophyll fluorescence has a higher actual photosynthetic rate value (e.g., as shown in a). Figure 4 (as shown in a); measurements of root physiological indicators under salt stress revealed that rRrSPL13 The proline content in the roots of overexpressing plants was significantly higher than that in the control group by 2.4 times, indicating stronger resistance to osmotic stress (e.g., ...). Figure 4 (As shown in b); malondialdehyde in the roots of rRrSPL13-overexpressing plants decreased by 1.9 times compared to the control group, and the degree of cell membrane damage was lower (e.g., as shown in b). Figure 4 (as shown in c in the diagram).
[0090] Since rSPL13 does not contain miRNA response elements, its expression level in plants is not regulated by miRNA post-transcriptional regulation. Overexpression of this gene results in a more significant salt stress response, making it an important molecular tool for salt-tolerant rose breeding and possessing strong breeding value.
[0091] As described above, although the invention has been shown and described with reference to specific preferred embodiments, it should not be construed as limiting the invention itself. Various changes in form and detail may be made without departing from the spirit and scope of the invention as defined in the appended claims.
Claims
1. Application of the overexpression vector containing the salt-tolerant gene RrSPL13 of rose in rose salt-tolerant breeding, characterized in that, The nucleotide sequence of the salt-tolerant gene RrSPL13 of the rose is shown as SEQ ID No.
1.
2. Use according to claim 1, characterized in that, The expression protein of the salt-tolerant gene RrSPL13 of the rose, and the amino acid sequence is shown as SEQ ID No.
2.
3. Use according to claim 1, characterized in that, The overexpression vector containing the salt-tolerant gene RrSPL13 of the rose is pNC-Cam1304-MCS35S:RrSPL13.
4. Use of overexpression vectors containing miRNA-resistant target rRrSPL13 in rose salt-tolerant cultivar breeding, characterized in that, The miRNA-resistant target rRrSPL13 is obtained by a miRNA response element synonymous mutation of the salt-tolerant gene RrSPL13 with the nucleotide sequence shown as SEQ ID No. 1, and the nucleotide sequence is shown as SEQ ID No.
3.
5. Use according to claim 4, characterized in that, The overexpression vector containing the miRNA-resistant target rRrSPL13 is pNC-Cam1304-MCS35S:rRrSPL13.