Methods and primer pairs for identifying intergeneric hybrids between Chinese cabbage and arugula based on KASP technology.
By using KASP-InDel technology and real-time quantitative PCR detection, the uncertainty and complexity of identifying allotetraploid hybrids between Chinese cabbage and Arugula genera were resolved, achieving a simple and accurate identification result.
Patent Information
- Application Number
- CN202410950270.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-16
- Publication Date
- 2026-03-10
- Estimated Expiration
- 2044-07-16
AI Technical Summary
Existing technologies for identifying allotetraploid hybrids between Chinese cabbage and Arugula are hampered by the fact that morphological identification is easily affected by environmental and human factors and is not reliable enough, while molecular marker identification is complex and difficult to design, and there is a lack of efficient and accurate identification methods.
KASP-InDel technology was used to perform real-time quantitative PCR detection with specific primer pairs. By using KASP-InDel primer pairs with a shared forward primer and two reverse primers carrying different fluorescent tags, the heterotetraploid hybrids between Chinese cabbage and Arugula were detected, and the authenticity was determined by combining fluorescence signal analysis.
It enables simple and accurate identification of allotetraploids, overcomes the uncertainties of traditional methods and the complexity of molecular markers, and provides an efficient and low-cost identification method.
Smart Images

Figure CN118755863B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the identification of distantly related new germplasm, in particular to the development of a kit for identifying alien tetraploids of Brassica rapa and Sonchus hybridization based on KASP technology. BACKGROUND
[0002] With the continuous growth of population and rapid economic development, the demand for agricultural production is also increasingly diversified. These demands include, for example, better taste, higher yield, better disease resistance, pest resistance, stress resistance, etc. In order to meet the growing demand, breeding hybrid new germplasm has become a crucial technology in the field of agriculture. How to accurately identify the authenticity of hybrid offspring is another important problem faced after creation.
[0003] Brassica rapa and Sonchus are common crops with important economic value. For the identification of Brassica rapa and Sonchus distant hybrid species, morphological and cytological identification is usually used. Morphological identification has the advantages of simple operation, but is easily affected by environmental and human factors, and the identification results are not reliable. Although molecular markers are also used for identification, they are difficult to design and sometimes require two or more pairs of primers for identification, which is relatively complex.
[0004] Competitive allele specific PCR (KASP) is a method for genotyping SNPs or InDels based on the specific matching of primer end bases, which contains one forward primer and two reverse primers, and the two reverse primers carry different sequence fluorescent linker sequences FAM or HEX at their 5' ends, respectively. Therefore, the specificity of SNPs or InDels can be detected according to the different fluorescence signals. KASP has the advantages of high accuracy, low cost, high throughput, etc., and is one of the mainstream methods for genotyping SNPs and InDels at present. At present, KASP-InDel genotyping technology has been widely used in plant genetic map construction, gene positioning, germplasm resource analysis, molecular marker assisted breeding, seed purity identification, etc. (Seo, Jeong-Hyun, Sanjeev Kumar Dhungana, Beom-Kyu Kang, In-Youl Baek, Jung-Sook Sung, Jee-Yeon Ko, Chan-Sik Jung, Ki-Seung Kim, and Tae-Hwan Jun. 2022. "Development and Validation of SNP and InDel Markers for Pod-Shattering Tolerance in Soybean." International Journal of Molecular Sciences 23, no. 4: 2382.).
[0005] Therefore, in the field of distant hybrid new germplasm, there is a strong need to provide a convenient and accurate method for identifying new germplasm. SUMMARY
[0006] Therefore, in the first aspect, the present application provides a method for identifying Brassica rapa and Diplotaxis intergeneric hybrid allo-tetraploid based on KASP-InDel technology, comprising:
[0007] Obtaining the sample to be identified, which is obtained by embryo rescue and chromosome doubling after intergeneric hybridization of Brassica rapa '72049' as the female parent and Diplotaxis 'ASTRO' as the male parent;
[0008] Using the genomic DNA of the material as a template, the following KASP-InDel primer pairs are used for amplification:
[0009] The common forward primer BE-KASP1F (5'-3'): CACCCAAAAGTGCGACTTTGCGG (SEQ ID NO: 1);
[0010] Reverse primer BE-KASP1Ra (5'-3'): GAAGGTGACCAAGTTCATGCTTGCCTGGTCCCTCATGCAAC (SEQ ID NO:2);
[0011] Reverse primer BE-KASP1Rb (5'-3'): GAAGGTCGGAGTCAACGGATTTGCCTGGTCCCTCATGCAAG (SEQ ID NO:3);
[0012] The fluorescence of the amplified product was detected by a real-time PCR instrument, and the fluorescence color was observed to determine the authenticity of the allotetraploid.
[0013] BE-KASP1F is a common forward primer. BE-KASP1Ra and BE-KASP1Rb are two allele-specific reverse primers. BE-KASP1Ra is a specific primer for homozygous Chinese cabbage and BE-KASP1Rb is a specific primer for homozygous arugula. FAM and HEX fluorescent sequence tags (underlined parts) are added to the 5' end, respectively.
[0014] In some embodiments, the method of the present invention further includes amplifying the maternal and paternal parents using the KASP-InDel primer pair.
[0015] In some implementations, observing bands includes the presence of both maternal and paternal bands in the sample, confirming the acquisition of an allotetraploid.
[0016] In a specific implementation, the KASP primer BE-KASP1 was used to test the parental Chinese cabbage 72049, arugula ASTRO, and their F1 offspring hybrids. The KASP-PCR reaction was performed on a 96-well PCR instrument. The reaction system consisted of 8 μL: 1.5 μL DNA (80 ng·μL⁻¹), 4 μL KASP Master mix (2×), 0.14 μL primer mixture (obtained by mixing BE-KASP1F, BE-KASP1Ra, BE-KASP1Rb with ddH₂O at a volume ratio of 12:12:30:46 at a concentration of 100 μmol·L⁻¹), with the remainder made up with ddH₂O.
[0017] The KASP-PCR amplification program is as follows: Stage 1: denaturation at 94℃ for 15 min; Stage 2: denaturation at 94℃ for 20 s, followed by annealing at 61℃ for 60 s, for a total of 10 cycles (starting from the second cycle, the temperature is reduced by 0.6℃ for each cycle); Stage 3: denaturation at 94℃ for 20 s, followed by annealing at 55℃ for 60 s, for a total of 26 cycles; Stage 4: denaturation at 37℃ for 1 min.
[0018] KASP-PCR amplification products were read using the endpoint method with a Roche LightCycler 480II (LC480II) real-time PCR instrument. SNP genotyping results were analyzed using LC480 software v1.5.1: The signal points of the homozygous Chinese cabbage 72049 maternal parent were blue, indicating competitive amplification by primers linking the 5' end to the FAM fluorescent tag sequence, clustering near the X-axis; the signal points of the homozygous Arugula ASTRO paternal parent were green, indicating competitive amplification by primers linking the 5' end to the HEX fluorescent tag sequence, clustering near the Y-axis; the signal points of distant hybridization progeny materials were red, clustering near the diagonal line. Figure 4 The BE-KASP1 marker can significantly distinguish between two homozygous genotypes and can also identify heterozygous genotypes. It has the characteristics of a codominant marker and has been successfully developed.
[0019] In a specific implementation, the KASP-InDel primer pair amplifies a target located on chromosome A05 of the Chinese cabbage hybrid, specifically on the exon of the BraA05g042250.3.5C gene. The authenticity of InDel has been verified by polypropylene gel electrophoresis (PAGE).
[0020] Details are as follows:
[0021] Chr Start End Ref Alt location Gene A05 27756034 27756036 TTG - exonic BraA05g042250.3.5C
[0022] >Brara_Chiifu_V3.5_A05_27755534_27756536_+
[0023] AAAGCAACAACATCTCCTCACGAGTGGCGAGCGCAATGTCCATGGAACG
[0024] ATGGTGTTCAAGGCAGTACATTATTTTCTCTGTACCAGATTATTTAACTCA
[0025] CTCACTGCATTCAGATCACCTTCCGAGAAAGTTCCTAGAGCTGCCCTAGCT
[0026] TGAGCACGGGCTGTTTTCGGACCTTGGTGAATATTGTTTTCAAACAACTCG
[0027] GACAAGATACCAGCTGCAACAAGTTGTTTCCTAGATCTTGGATGCTTCGA
[0028] CAGCATTTGAAGAATCTCGAGACATTGAGTGACAAATGTAGTGGCACAAC
[0029] CGTAACAATTGTTTGGGGTCTTTGAAACCACACATCTTGAAGCACCAGAT
[0030] GAAAAGTTCGAATTTTTCTGATGGAGGTAATTCATCAGAACTCTGCGAAG
[0031] TCCCTGCAGTGTTTGTACACTTTTGCTGACAGAATCAAAAGCAGCTTTGCACTTCTCACCATACAGTACACCCAAAAGTGCGACTTTGCGGTTTATC[TTG / ]TTGCATGAGGGACCAGCAGGCAAAGATGCCATCATTGCTGGACAGTGTCCTT GTGCTGTGAATCCATTTCAGTTTCACCAATGCTTGATACAATCTTCAGAAGCGGCTTCTTGAAGCCTAAGAGTTGCTGATATCTCCTGTGAGCGTTTTCAGACTCGGACTCTATAGCAGCCAATCCCCTCTTCATATCTTCGTCATTTTCCATATTATCAAATATGAAGCTCGGTTTTGCCATGAAGTTGAACTCAAACCTCCCATACTTGCTATAACCACACTCGTTGCACAGGAAAGAATCCAAATTTTCGTAGTTGATGTTGCGGCATTGCCTGCACTGATAAGCATTCTCATGACAGTTGCTGCAGATACCATGCTTATCAGTAACCGGTCGACTGCATCGAGGGCATTGCAATGGTTCAAGAGATAACGCCTGAAGATTCTCATAGAAGGAATCCAACTCGATCATGAAGTTACAAGCCGTAATGGGAATGGGAAACTCCACCTT(SEQ ID NO:4)
[0032] In a preferred embodiment, the acquisition steps include: using Chinese cabbage '72049' as the female parent and arugula inbred line 'ASTRO' as the male parent, performing hybridization and pollination during the bud stage, harvesting the ovary 7 days after pollination, performing embryo rescue under aseptic conditions, and undergoing doubling treatment. For example, during the bud stage, the stigma is sprayed with a 62.3 mg / L MgCl2·6H2O solution, and after 15-20 minutes, hybridization and pollination are performed by smearing.
[0033] In a second aspect, the present invention provides a KASP-InDel primer pair for identifying intergeneric hybrids of maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', wherein the primer pair consists of a common forward primer BE-KASP1F (5'-3'): CACCCAAAAGTGCGACTTTGCGG (SEQ ID NO:1);
[0034] Reverse primer BE-KASP1Ra(5'-3'):
[0035] GAAGGTGACCAAGTTCATGCTTGCCTGGTCCCTCATGCAAC (SEQ ID NO: 2);
[0036] Reverse primer BE-KASP1Rb(5'-3'):
[0037] Composed of GAAGGTCGGAGTCAACGGATTTGCCTGGTCCCTCATGCAAG (SEQ ID NO: 3).
[0038] In a third aspect, the present invention provides a kit for identifying allotetraploid hybrids of maternal Chinese cabbage '72049' and paternal arugula 'ASTRO', the kit comprising the KASP-InDel primer pair defined in the second aspect.
[0039] In some embodiments, the kit of the present invention further comprises genomic DNA of Chinese cabbage '72049' and genomic DNA of arugula 'ASTRO'.
[0040] In a fourth aspect, the present invention provides the use of the KASP-InDel primer pair as defined in the second aspect for identifying allotetraploids resulting from intergeneric hybridization between the maternal Chinese cabbage '72049' and the paternal arugula 'ASTRO'.
[0041] In a fifth aspect, the present invention provides the use of the kit defined in the third aspect for identifying allotetraploids resulting from intergeneric hybridization between maternal Chinese cabbage '72049' and paternal arugula 'ASTRO'.
[0042] After obtaining the intermediate material of 'Chinese cabbage 72049 × Arugula ASTRO', another challenge was how to accurately and conveniently identify the hybrid. The inventors overcame the shortcomings of traditional morphological identification, which is easily affected by environmental and human factors and whose identification results are not reliable enough. At the same time, they overcame the current situation that there are few studies on the identification of distant hybrids using KASP molecular markers and that the design is difficult. They successfully developed a primer pair for identification. This primer pair is simple to operate and produces accurate results when used to identify the allotetraploid of Chinese cabbage 72049 × Arugula ASTRO. Attached Figure Description
[0043] Figure 1 The morphology of the parent and doubled material plants is shown in Figure a, which is Chinese cabbage; Figure b is arugula; and Figures c1-c7 are F1 to F7. The scale bar is 10 cm.
[0044] Figure 2 The number of chromosomes in the root tip of the doubled material; d1-d7 represent F1 to F7.
[0045] Figure 3 The results are obtained by polyacrylamide gel electrophoresis after amplification of maternal, paternal, and distant hybrid progeny populations using BraA05g042250.3.5C_InDel primers.
[0046] Figure 4 The results are shown in the KASP genotyping results after amplification of seven progeny populations from the maternal, paternal, and allotetraploid lines using the BraA05g042250.3.5C_KASP-InDel primers. Detailed Implementation
[0047] Material
[0048] Maternal parent: Chinese cabbage '72049' (Brassica rapa; 2n=20; AA), paternal parent: arugula (Eruca sativa, EE, 2n=22); '72049 × arugula' distant hybrid (AE) and allotetraploid (AAEE) after chromosome doubling.
[0049] These materials were provided by the Leafy Vegetable Research Group of the Vegetable Research Institute of the Henan Academy of Agricultural Sciences, and were planted and managed routinely at the Henan Modern Agricultural Research and Development Base.
[0050] Equipment and reagents
[0051] The main experimental instruments include: CyFlow Cube 8 flow cytometer, microscope, fluorescence microscope, centrifuge, autoclave, etc.
[0052] Main experimental tools: centrifuge tubes, tweezers, dissecting needles, coverslips, glass slides, pipettes, absorbent paper, scissors, blades, etc.
[0053] Main experimental reagents: Carnoy's fixative, distilled water, glacial acetic acid, anhydrous ethanol, 8-hydroxyquinoline, carbofuran stain, DAPI stain, 2% enzyme digestion solution, propidium iodide (PI), B5 medium, MS medium, etc.
[0054] Preparation of enzymatic hydrolysate: Weigh 200-400 mg of cellulase and 100-200 mg of pectinase (cellulase:pectinase = 2:1), dissolve in 0.01 mol citrate buffer, and store at -20°C. The 0.01 mol citrate buffer is prepared by weighing 0.30 g of trisodium citrate and 0.21 g of citric acid, and adding sterile water (double-distilled H2O, dd H2O) to a final volume of 100 mL.
[0055] Example 1: Distant hybridization and embryo rescue
[0056] A hybrid cross was constructed using Chinese cabbage '72049' (provided by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the female parent and arugula inbred line 'ASTRO' (collected and preserved by the Vegetable Research Institute of Henan Academy of Agricultural Sciences) as the male parent. The cross was constructed using bagging at the bud stage and artificial pollination. Two to three days before hybridization, the opened flowers on the male parent inflorescence were removed, and the plant was isolated by bagging. On the day the bagged male parent opened, the anthers were collected and used to pollinate the appropriately sized buds on the female parent plant. During the bud stage, the stigmas of the Chinese cabbage were sprayed with a 62.3 mg / L MgCl2·6H2O solution. After the solution dried (approximately 15 to 20 minutes), pollination and hybridization were performed by smearing the stigmas on the stigmas, as well as in the untreated group. After pollination, the plants were isolated by bagging to strictly control contamination by pollen from sources other than the male parent. Seven days after pollination, the ovaries were harvested, and embryo rescue was performed under aseptic conditions.
[0057] The test materials were kept fresh at 4℃ to reduce moisture evaporation; solid inoculation medium (MS + 6-BA 1.0mg / L + NAA 0.1mg / L + hydrolyzed casein 0.5% + activated carbon 0.5% + agar 7.2g / L + sucrose 20g / L + activated carbon 0.5%), distilled water, petri dishes with filter paper, and inoculation petri dishes were autoclaved at 121℃ for 25 minutes and then sterilized with ultraviolet light in a clean bench for 20 minutes. Gloves, masks, laboratory gowns, 75% alcohol, 0.1% mercuric chloride, waste liquid container, tweezers, scalpels and blades, alcohol lamp, marker pen, and sealing film were also prepared.
[0058] Using scissors, remove plump, healthy, and pest-free ovaries from the selected test material and place them in the corresponding beakers, clearly labeling them with the material name or corresponding code. Place the selected test material in a clean bench, first surface disinfecting with 75% alcohol for 30 seconds, then sterilizing with 0.1% mercuric chloride for 8 minutes. Afterward, rinse 3-5 times with sterile distilled water, pouring the waste liquid into a prepared waste liquid container. After rinsing clean, use tweezers to remove the ovaries and place them in sterile petri dishes with filter paper. Use a scalpel to slowly cut along the midline of the ovary with moderate force, removing the ovules from the ovary with a blade and placing them evenly on sterile solid inoculation medium, with 30-50 ovules per dish depending on their size. Finally, seal the petri dishes tightly with sealing film, label the petri dish lid with the material name and operation date, and then place them in an incubator for dark incubation at room temperature (25℃). After about a week of cultivation, check for any contaminated culture dishes. Remove any contaminated culture dishes promptly and check them every 5 days to prevent contamination of other normally growing culture dishes.
[0059] After about 20 days of cultivation, observe whether new embryos have grown. Place the culture dishes with grown embryos on a light-lit culture rack for further cultivation. Once the embryos have recovered and turned green, they can be transferred to a solid subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%) for subculture propagation.
[0060] The germination rate of ovules was statistically analyzed by observing whether new embryonic buds grew. The germination rates of ovules treated with MgCl2·6H2O solution at a concentration of 62.3 mg / L were 6.67%, 5.83%, and 9.17%, respectively, with an average germination rate of 7.22%, which was significantly higher than the 0.83% germination rate of the untreated control.
[0061] Example 2: Colchicine Double Treatment
[0062] Weigh out the required amounts of agar, sucrose, and B5 medium to prepare the subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%). Weigh 0.21 g of colchicine (concentration 0.02%) per liter of the liquid subculture medium and add it to the medium. Stir until completely dissolved. Adjust the pH to 5.8-5.9 to obtain the colchicine-doubled medium, which is then dispensed into culture flasks. Autoclave at 121℃ for 25 min. After sterilization, allow it to solidify to obtain the doubled medium for later use.
[0063] Prepare all necessary experimental tools and doubled culture medium. Select robust seedlings with normal green leaves from the regenerated seedlings that need to be doubled and double-treat them for 7 days.
[0064] After the treatment period, the seedlings were transferred to normal subculture medium (B5 + 6-BA 1.0 mg / L + NAA 0.1 mg / L + agar 7.2 g / L + sucrose 20 g / L + activated carbon 0.5%) to allow for acclimatization. The culture bottles were clearly labeled with the material name and the number of days of double treatment. If a culture bottle contained both strong and weak seedlings, the strong seedlings were transferred to double-treated medium, while the weak seedlings were transferred to subculture medium without colchicine to continue growth. During the double treatment and subsequent acclimatization phases, close observation of plant growth, plant shape, and leaf changes was necessary. Timely adjustments and records were made based on these observations.
[0065] After embryo rescue and colchicine treatment, seven ovules formed doubled tissue culture seedlings. Then, through in vitro propagation, seven progeny populations were obtained, designated F1, F2, ... F7. The plants were transplanted into the field and managed using standard methods. The plant phenotype is as follows: Figure 1 As shown.
[0066] Example 3: Confirmation of Distant Hybrids
[0067] 1. Chromosome observation in root tips
[0068] Rinse the root tips of the parent plants and hybrid offspring multiple times with tap water until clean. Use scissors to cut fresh lateral roots with a diameter of 0.8-1.2 mm and a length of 10-15 mm, and rinse the collected lateral root samples with distilled water to further remove impurities. Place the clean lateral root samples into centrifuge tubes, fill them with 8-hydroxyquinoline, and incubate them in a 25°C incubator in the dark for 3.5 hours.
[0069] After incubation in the dark, remove the lateral roots from the centrifuge tubes, blot the residual liquid at the root tips with filter paper, fix them in centrifuge tubes containing Carnot fixative (alcohol: glacial acetic acid = 3:1), and store them in a -20°C freezer.
[0070] Remove the root tip, rinse it with distilled water, and then place it in 2 ml of 1 mol / L hydrochloric acid solution. Dissociate it in a water bath at 55-60℃ for 15 minutes.
[0071] After dissociation, the stem tip was removed, rinsed, placed on a glass slide, crushed, and then stained with Carbofuran stain for 5 minutes.
[0072] Cover with a coverslip, press the slide, and observe and photograph it under a microscope.
[0073] Chromosome number determination using root tip chromosome counting in seven groups of doubled chromosome materials can accurately determine whether a hybrid is a true hybrid. The expected true hybrid (AAEE) should have 42 chromosomes (AA+EE=42). Figure 2As shown, the number of chromosomes in the root tips of all 7 groups of doubled materials was 42.
[0074] Therefore, through observation of root tip chromosomes, the doubled material can be basically identified as a distant hybrid, and the allodiploid was successfully doubled into an allotetraploid.
[0075] Example 4 Morphological Analysis
[0076] After several subcultures, the embryos obtained through experiments gradually grow from new embryos into regenerated seedlings, eventually forming robust regenerated plants. At this point, robust seedlings can be selected for rooting culture. After about 10-15 days, robust seedlings with strong root systems are selected for transplanting.
[0077] Prepare appropriately sized seedling trays, trays, protective covers, sterile substrate, a fungicide solution to prevent pests and diseases, a rooting agent of a certain concentration, and tweezers. Fill the seedling trays with the prepared moist sterile substrate. Carefully remove strong seedlings and their well-developed roots using tweezers. Dip the roots in the fungicide solution and rooting agent before planting them into the corresponding holes on the label. Transplant each subsequent tissue culture seedling into the seedling trays using this method. After each tray is full, water it, cover it with a protective cover, and place it in a pre-set light incubator to allow the seedlings to recover and grow. Once the seedlings have recovered and reached a certain size, they can be transplanted to the experimental field for normal growth in a natural environment.
[0078] In addition, whether transplanting tissue culture seedlings into plug trays or from light-incubated incubators to experimental fields, they should be transplanted and planted in a reasonable manner according to the type, quantity, and size of the materials, so as to facilitate the investigation and recording of plant characteristics in later experiments.
[0079] Observe and record the morphological characteristics of Chinese cabbage (mother parent), arugula (father parent), and F1 generation plants at different growth and development stages, such as plant trunk, lateral branches, flower shape, number of petals, flower bud morphology, inflorescence, stamens, and flower color.
[0080] The morphological data of the allotetraploid and the parent are shown in Table 1.
[0081] Table 1. Statistical data on allotetraploid and parental phenotypes
[0082]
[0083]
[0084] Example 5: Development and Identification of KASP-InDel Molecular Markers
[0085] Leaves were taken from the parents and F1 generation plants, RNA was extracted using the Trizol method, libraries were constructed, and high-throughput sequencing of the parents and their hybrid offspring was performed using the Illumina platform.
[0086] After obtaining clean reads from high-throughput sequencing, the data was filtered to obtain clean data, which was then assembled and analyzed with parameters. Sequence alignment was performed with the Chinese cabbage reference gene (http: / / www.brassicadb.cn / # / Download / Brara_Chiifu_V3.5 / ) to obtain mapped data. Based on the positional information of the aligned genome reads, StringTie (Pertea M,Pertea GM,Antonescu CM, et a,StringTie enables improved reconstruction of a transcriptome from RNA-seq reads,Nature biotechnology,2015,33(3):290-295) was used to assemble the reads into transcripts. The assembled transcripts were then compared with the genome annotation information using GffCompare. After detecting InDel using GATK (McKenna A, Hanna M, Banks E, et al., The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data, Genome Research, 2010, 20(9): 1297-1303), the variant sites were annotated using ANNOVAR (Wang K, Li M, Hakonarson H., ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data, Nucleic acids Research, 2010, 38(16): e164-e164) to obtain the analysis results and annotation information of InDel. The obtained InDel were first classified and analyzed. For sites where the maternal parent was the same as the reference genome Ref, the paternal parent had a variant base, and the same site showed heterozygosity in the hybrid, subsequent analysis was performed. InDel primers were first designed and their authenticity was verified by polyacrylamide gel electrophoresis (PAGE). KASP-InDel primers were then designed for detection.
[0087] The KASP-InDel primer pair amplifies a target located on chromosome A05 of the Chinese cabbage hybrid, specifically on the exon of the BraA05g042250.3.5C gene. The authenticity of InDel has been verified by polypropylene gel electrophoresis (PAGE).
[0088] Details are as follows:
[0089] Chr Start End Ref Alt location Gene A05 27756034 27756036 TTG - exonic BraA05g042250.3.5C
[0090] >Brara_Chiifu_V3.5_A05_27755534_27756536_+
[0091] AAAGCAACAACATCTCCTCACGAGTGGCGAGCGCAATGTCCATGGAACGATGGTGTTCAAGGCAGTACATTATTTTCTTCTGTACCAGATTATTTAACTCACTCACTGCATTCAGATCACCTTCCGAGAAAGTTCCTAGAGCTGCCCTAGCTTGAGCACGGGCTGTTTTCGGACCTTGGTGAATATTGTTTTCAAACAACTCGGACAAGATACCAGCTGCAACAAGTTGTTTCCTAGATCTTGGATGCTTCGACAGCATTTGAAGAATCTCGAGACATTGAGTGACAAATGTAGTGGCACAACCGTAACAATTGTTTGGGGTCTTTGAAACCACACATCTTGAAGCACCAGATGAAAAGTTCGAATTTTTCTGATGGAGGTAATTCATCAGAACTCTGCGAAGTCCCTGCAGTGTTTGTACACTTTTGCTGACAGAATCAAAAGCAGCTTTGCACTTCTCACCATACAGTA CACCCAAAAGTGCGACTTTGCGG TTTAT C[TT G / ]TTGCATGAGGGACCAGG CAAAGATGCCATCATTTGCTGGACAGTGTCC TTGTGCTGTGAATCCATTTCAGTTTCACCAATGCTTGATACAATCTTCAGAAGCGGCTTCTTGAAGCCTAAGAGTTGCTGATATCTCCTGTGAGCGTTTTCAGACTCGGACTCTATAGCAGCCAATCCCCTCTTCATATCTTCGTCATTTTCCATATTATCAAATATGAAGCTCGGTTTTGCCATGAAGTTGAACTCAAACCTCCCATACTTGCTATAACCACACTCG TTGCACAGGAAAGAATCCAAATTTTCGTAGTTGATGTTGCGGCATTGCCTGCACTGATAAGCATTCTCATGACAGTTGCTGCAGATACCATGCTTATCAGTAACCGGTCGACTGCATCGAGGGCATTGCAATGGTTCAAGAGATAACGCCTGAAGATTCTCATAGAAGGAATCCAACTCGATCATGAAGTTACAAGCCGTAATGGGAATGGGAAACTCCACCTT(SEQ ID NO:4).
[0092] Polyacrylamide gel electrophoresis was used to verify the InDel molecular marker. PCR amplification was performed using genomic DNA from the parents and hybrids. The PCR program was set according to the primer melting temperature, base number, base composition, and base sequence: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, and 35 cycles. The PCR products were stored at 4℃ for later use. The 20 μL reaction system included: 2 μL DNA template, 1 μL each of the pre- and post-primer, 10 μL PCR Mix, and 6 μL dd H2O. The electrophoresis was performed at 180V (with ice packs placed on both sides of the electrophoresis tank) for 2 h. After fixation, gel washing, silver staining, gel washing, and development, the bands were observed. Using the BraA05g042250.3.5C_indel primer, PCR amplification was performed simultaneously with parental and F1 hybrid DNA. Suitable primers exhibiting both parent-specific bands in the F1 hybrid were used to verify the authenticity of InDel. The results are as follows: Figure 3 As shown.
[0093] Next, amplification was performed using the following KASP-InDel primer pair:
[0094] Using the shared forward primer BE-KASP1F(5'-3'):
[0095] CACCCAAAAGTGCGACTTTGCGG(SEQ ID NO:1);
[0096] Reverse primer BE-KASP1Ra(5'-3'):
[0097] GAAGGTGACCAAGTTCATGCT TGCCTGGTCCCTCCATGCAAC(SEQ ID NO:2);
[0098] Reverse primer BE-KASP1Rb(5'-3'):
[0099] GAAGGTCGGAGTCAACGGATT TGCCTGGTCCCTCCATGCAAG (SEQ ID NO: 3);
[0100] The fluorescence of the amplified product was detected by a real-time PCR instrument, and the fluorescence color was observed to determine the authenticity of the allotetraploid.
[0101] Using the BraA05g042250.3.5C_KASP-InDel primer pair, real-time quantitative PCR was performed on the DNA of seven populations, and the results are as follows: Figure 4 As shown, all seven allotetraploid populations were found to possess parental variations, confirming the authenticity of the hybrids.
[0102] The above description is merely a preferred embodiment of the present invention and is not intended to limit the scope of protection of the present invention.
Claims
1. A method for identifying Brassica rapa interspecific hybrid allopolyploid based on KASP technology, comprising: obtaining a sample to be identified, which is obtained by embryo rescue and chromosome doubling after interspecific hybridization of Brassica rapa '72049' as the female parent and Eruca vesicaria 'ASTRO' as the male parent; using the genomic DNA of the material as a template, amplifying with the following KASP-InDel primer pairs: a common forward primer BE-KASP1F (5'-3'): CACCCAAAAGTGCGACTTTGCGG (SEQ ID NO: 1); a reverse primer BE-KASP1Ra (5'-3'): GAAGGTGACCAAGTTCATGCTTGCCTGGTCCCTCATGCAAC (SEQ ID NO: 2); a reverse primer BE-KASP1Rb (5'-3'): GAAGGTCGGAGTCAACGGATTTGCCTGGTCCCTCATGCAAG (SEQ ID NO: 3); detecting the fluorescence signal of the amplified product by a fluorescence quantitative PCR instrument; and observing the fluorescence signal to determine the authenticity of the allopolyploid; the method further comprises amplifying the female parent and the male parent with the KASP primer pairs; the step of observing includes that when the sample simultaneously appears the fluorescence of the female parent and the male parent, it is confirmed that the allopolyploid is obtained.
2. The method of claim 1, wherein, The amplification conditions are: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30-40 cycles.
3. The method of claim 1, wherein, The amplification object of the KASP primer pairs is located on the gene shown in SEQ ID NO:
4.
4. The method of any one of claims 1-3, wherein, The step of obtaining includes: using Brassica rapa '72049' as the female parent and Eruca vesicaria inbred line 'ASTRO' as the male parent, cross pollination at the bud stage, taking the ovary 7 days after pollination, embryo rescue under aseptic conditions, and doubling treatment. 5.A KASP-InDel primer pair for identifying the interspecific hybrid allopolyploid of the female parent Brassica rapa '72049' and the male parent Eruca vesicaria 'ASTRO', which consists of a common forward primer BE-KASP1F (5'-3'): CACCCAAAAGTGCGACTTTGCGG (SEQ ID NO: 1); a reverse primer BE-KASP1Ra (5'-3'): GAAGGTGACCAAGTTCATGCTTGCCTGGTCCCTCATGCAAC (SEQ ID NO: 2); a reverse primer BE-KASP1Rb (5'-3'): GAAGGTCGGAGTCAACGGATTTGCCTGGTCCCTCATGCAAG (SEQ ID NO: 3). 6.A kit for identifying the interspecific hybrid allopolyploid of the female parent Brassica rapa '72049' and the male parent Eruca vesicaria 'ASTRO', which comprises the KASP primer pair of claim 5.
7. The kit of claim 6, wherein, The kit further comprises genomic DNA of Brassica rapa ‘72049’ and genomic DNA of Sonchus arvensis ‘ASTRO’.
8. Use of the KASP-InDel primer pair of claim 5 or the kit of claim 6 or 7 for identifying an allogeneic tetraploid of an intergeneric cross of the maternal Brassica rapa ‘72049’ with the paternal Sonchus arvensis ‘ASTRO’.
Citation Information
Patent Citations
Method and primer pair for identifying intergeneric hybridization of Chinese cabbage and sesames based on molecular marker
CN118668002A
Method and primer pair for identifying intergeneric hybridization of Chinese cabbage and sesames based on InDel
CN118879836A