Uses of circular RNA circRere

By preparing an injectable dosage form using circular RNA circRere, the side effect of neuropathic pain caused by vincristine was resolved, achieving a safe and effective analgesic effect.

CN118806785BActive Publication Date: 2025-12-02SUN YAT SEN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410786914.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-06-18
Publication Date
2025-12-02
Estimated Expiration
2044-06-18

AI Technical Summary

Technical Problem

Existing medications for treating vincristine-induced neuropathic pain have numerous side effects, tolerability and dependence issues, and lack safe and effective treatment options.

Method used

Using circular RNA circRere as a therapeutic agent, its expression level was screened and found to be significantly downregulated in rats with vincristine-induced neuropathic pain. Intervention significantly relieved pain and was prepared into an injectable dosage form.

Benefits of technology

It provides a safe and effective analgesic that significantly relieves neuropathic pain caused by vincristine and reduces the side effects of traditional drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118806785B_ABST
    Figure CN118806785B_ABST
Patent Text Reader

Abstract

This invention discloses the uses of the circular RNA circRere. Whole transcriptome sequencing was performed, and data on the circular RNA were selected. Through expression level screening, it was found that the circular RNA circRere was significantly downregulated in rats with vincristine-induced neuropathic pain. Furthermore, in vivo rat experiments demonstrated that intervention with circular RNA circRere as a supplement significantly alleviated vincristine-induced neuropathic pain. This invention provides a new drug treatment option for treating or alleviating neuropathic pain, especially neuropathic pain caused by the neurotoxic effects of vincristine, overcoming the shortcomings of traditional drug treatments or alleviators of neuropathic pain due to side effects, and providing a safer analgesic drug for clinical use.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of circular RNA circRere. Background Technology

[0002] Vincristine is an antitumor drug, primarily extracted from the periwinkle (Catharanthus roseus), a plant in the Apocynaceae family. Clinically, it is mainly used to treat various malignant tumors, such as acute leukemia, malignant lymphoma, breast cancer, and gastrointestinal cancer, and is a commonly used chemotherapy drug. However, vincristine has neurotoxicity, and its use may cause side effects such as neuropathic pain. This neurotoxic reaction is relatively common; almost all patients may experience some degree of neuropathy after use, including numbness and pain in the fingertips or toes, which may be accompanied by muscle contractions. This pain may appear within a few weeks of treatment or after the first use, and gradually improves after discontinuation of the drug, but may take up to several months.

[0003] Neuropathic pain (NPP) is pain triggered or caused by primary damage and dysfunction of the nervous system. It is a chronic pain characterized by spontaneous pain, hyperalgesia, atypical pain, and paresthesia. Neuropathic pain caused by vincristine may be due to the drug's effects on the nervous system. Currently, drugs used clinically to treat neuropathic pain induced by the chemotherapy drug vincristine mainly include calcium channel maintainers such as gabapentin and pregabalin, serotonin inhibitors such as duloxetine and norepinephrine reuptake inhibitors, opioids such as morphine, ketamine, and analgesic peptides newly registered by the FDA in recent years. However, these drugs have drawbacks such as tolerance to analgesia, dependence, respiratory depression, increased gastrointestinal reactions, and hypersensitivity reactions, making them unsuitable for long-term use. Some drugs can even cause mental illnesses or symptoms such as depression and self-harm. Despite their significant analgesic effects, these drugs have many contraindications due to their side effects. Therefore, developing new drugs to treat neuropathic pain caused by the chemotherapy drug vincristine is an important research direction.

[0004] circRNAs, or circular RNAs, are a special class of non-coding RNA molecules with a closed circular structure. They are not easily degraded by enzymes, are stable in expression, and have a long half-life. This gives circRNAs many advantages as novel therapeutic agents, such as their ability to remain stable in the body for extended periods and exert a sustained therapeutic effect. Therefore, the idea of ​​using circRNAs as a novel therapeutic agent has broad application prospects. Current research has shown that circRNAs play important regulatory roles in various diseases, including cancer, neurological disorders, and cardiovascular diseases. Existing research has demonstrated the application of circRNA vaccines against COVID-19. References [Qu,L.,Yi,Z.,Shen,Y.,Lin,L.,Chen,F.,Xu,Y.,Wu,Z.,Tang,H.,Zhang,X.,Tian,F.,Wang,C.,Xiao,X.,Dong,X.,Guo,L.,Lu,S.,Yang,C.,Tang,C.,Yang,Y.,Yu,W.,Wang,J.,Zhou,Y.,Huang,Q.,Yisimayi,A.,Liu,S.,Huang,W.,Cao,Y.,Wang,Y.,Zhou,Z.,Peng,X.,Wang,J.,Xie,XS,and Wei,W.,Circular RNA vaccines against SARS-CoV-2 and emerging variants.Cell,2022.185(10):p.1728-1744.e16.DOI:10.1016 / j.cell.2022.03.044]; Meanwhile, circRNA as a treatment method has been gradually validated in other animal models, see reference [Lu,D.,Chatterjee,S.,Xiao,K.,Riedel,I.,Huang,C.-K.,Costa,A.,Cushman,S.,Neufeldt,D.,Rode,L.,Schmidt,A.,Juchem,M.,Leonardy,J.,Büchler,G.,Blume,J.,Gern,O.-L.,Kalinke,U.,Wen Tan,WL,Foo,R.,Vink,A.,vanLaake,LW,van der Meer,P., C., and Thum, T., Acircular RNAderived from theinsulin receptor locus protects against doxorubicin-inducedcardiotoxicity. European Heart Journal, 2022.43(42):p.4496-4511.DOI:10.1093 / eurheartj / ehac337], etc.

[0005] The genomic location of the circular RNA circRere is chr5:167547693-167581074, and the corresponding linear gene is Rere (NM_053885.2). The circular sequence has 373 bases and includes exons 8-11 of Rere. No other functions of this circular RNA circRere have been publicly reported, and there are no reports of using circular RNA circRere as a new drug to treat vincristine-induced neuropathic pain. Summary of the Invention

[0006] In view of the shortcomings of the prior art, the present invention aims to provide the use of circular RNA circRere, and provides a new scheme for preparing drugs for treating or relieving neuropathic pain using circular RNA circRere, overcoming the defects of traditional drugs for treating or relieving neuropathic pain with side effects, and providing safer analgesics for clinical use.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] The first object of the present invention is to provide the use of circular RNA circRere in the preparation of medicaments for treating or relieving neuropathic pain, the cDNA sequence of which is shown in SEQ ID NO.6.

[0009] Preferably, the neuropathic pain is neuropathic pain caused by the toxic effects of vincristine on the nervous system.

[0010] Preferably, the single application dose of the circular RNA circRere is 5–15 mg / kg.

[0011] Preferably, the single application dose of the circular RNA circRere is 8–12 mg / kg.

[0012] Preferably, the single application dose of the circular RNA circRere is 10 mg / kg.

[0013] Preferably, the drug is an injectable dosage form.

[0014] Preferably, the drug is a circRere supplement containing circular RNA.

[0015] A second object of the present invention is to provide a medicament for treating or relieving neuropathic pain, said medicament comprising a circular RNA circRere with a cDNA sequence as shown in SEQ ID NO. 6.

[0016] Another object of the present invention is to provide a diagnostic kit for neuropathic pain, the kit comprising primers capable of amplifying circular RNA circRere cDNA sequences as shown in SEQ ID NO. 6.

[0017] Preferably, the amplification primer sequence information is shown in SEQ ID NO.1 and SEQ ID NO.2.

[0018] Upstream primer: 5'-GAGGATGAAGTGGAGGCTGAATA-3' (SEQ ID NO.1)

[0019] Downstream primer: 5'-AAGTTTGGCCTGATGGCTAGG-3' (SEQ ID NO.2)

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] This invention discloses for the first time the potential of circular RNA circRere as a novel therapeutic agent for treating or alleviating neuropathic pain, particularly neuropathic pain caused by the neurotoxic effects of vincristine. Through expression screening, this invention found that circRere is significantly downregulated in rats with vincristine-induced neuropathic pain. Furthermore, in vivo rat experiments demonstrated that intervention with circRere as a supplement significantly alleviates vincristine-induced neuropathic pain. This invention provides a new drug treatment option for treating or alleviating neuropathic pain, especially neuropathic pain caused by the neurotoxic effects of vincristine, overcoming the side effects of traditional drugs for treating or alleviating neuropathic pain, and providing a safer analgesic for clinical use. Attached Figure Description

[0022] Figure 1 This is a graph showing the first-generation sequencing results of circRere;

[0023] Figure 2 Figure 1 shows the results of circRere qPCR detection in the dorsal horn of the spinal cord of rats in each group;

[0024] Figure 3 A schematic diagram of a cloning vector containing the circRere sequence;

[0025] Figure 4 Tolerance testing of the prepared circRere RNase R;

[0026] Figure 5 The splicing sites in the first-generation sequencing results of the prepared circRere are shown;

[0027] Figure 6 The circRere sequencing results were prepared.

[0028] Figure 7 HPLC analysis of the integrity of the prepared circRer;

[0029] Figure 8 Pain behavior assessment on day 10 after vincristine treatment;

[0030] Figure 9 The experimental results of cold pain withdrawal reaction time after intrathecal injection of circRere are shown in the figure. In the VCR+circRere group, n=12, and in the VCR+NC group, n=12.

[0031] Figure 10 The results of the latency period of heat pain withdrawal after intrathecal injection of circRere are shown in the figure. In the VCR+circRere group, n=12, and in the VCR+NC group, n=12.

[0032] Figure 11 The threshold for mechanical pain withdrawal after intrathecal injection of circRere was defined, with n=12 in the VCR+XXW-001 group and n=12 in the VCR+NC group. Detailed Implementation

[0033] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments.

[0034] The technologies involved in this invention are all conventional molecular cloning techniques. The designed enzymes, primers, reagents, and reaction conditions can be reasonably selected based on the experience of those skilled in the art, unless otherwise specified. The designed reagents and consumables are common commercially available products, and the detection methods and instruments involved are also well known and skillfully mastered by those skilled in the art.

[0035] 1. Reagents

[0036] The RNA reverse transcription premix was purchased from Hunan Akery Biotechnology Co., Ltd., abbreviated as Akery, model AG11706;

[0037] The endonuclease EcoRI was purchased from Thermo Fisher Scientific, model FD0275;

[0038] The RNase R was purchased from Geneseed, model R0301;

[0039] The vincristine was purchased from GLPBIO, model GC38410.

[0040] 2. Equipment and Instruments

[0041] The micro nucleic acid detector was purchased from Thermo Fisher Scientific, model NanoDrop One.

[0042] 3. Biological Materials

[0043] The SD male rats were purchased from Sun Yat-sen University (East Campus of the Experimental Animal Center) (SCXK(Yue)2021-0029).

[0044] 4. Discovery and R & D Process of the Present Invention:

[0045] First, the inventor of the present invention performed whole transcriptome sequencing, selected the data of circular RNA, and through the screening of expression levels, it was found that the circular RNA circRere was significantly down-regulated in rats with vincristine-induced neuropathic pain; secondly, through in-vivo experiments on rats, it was proved that after intervention with circular RNA circRere as a supplement, the neuropathic pain caused by vincristine could be significantly relieved. Thus, the present invention provides a new therapeutic drug prospect for treating or relieving neuropathic pain, especially the neuropathic pain caused by the toxic effect of vincristine on the nervous system.

[0046] Example 1 Detection of the Expression of Circular RNA circRere in the Dorsal Horn Tissue of Rats

[0047] Specifically, it includes the following steps:

[0048] (1) RNA Extraction

[0049] a. Rat spinal cord dorsal horn tissue was placed in a 2 mL grinding tube treated with RNase-free enzymes. 1 mL of TRIzol (Thermo Fisher Scientific, catalog number 15596-026) and two 3 mm enzyme-free zirconia beads were added. The tube was placed in a low-temperature high-throughput homogenizer and homogenized at 60 Hz, homogenization time of 30 s, pause time of 15 s, and 2 cycles. After homogenization, the tissue was allowed to stand at 26°C for 5 min to allow for complete cell lysis.

[0050] b. Add 200 μL of enzyme-free chloroform (Guangzhou brand, GSSA02-TD-0.5L 67-66-3) to the centrifuge tube, vortex thoroughly for 30 seconds, mix well, and let stand at 26℃ for 5 minutes.

[0051] c. Pre-cool the centrifuge to 4°C, centrifuge the centrifuge tubes at 12000 rpm for 15 minutes at 4°C, and transfer the uppermost aqueous phase liquid to a new 1.5 mL enzyme-free centrifuge tube, with approximately 500 μL of liquid per tube.

[0052] d. Add 500 μL of isopropanol (Guangdong Guanghua Technology Co., Ltd., 1.17029.023) to each centrifuge tube, vortex thoroughly for 30 seconds, mix well, and let stand for 10 minutes at 26°C.

[0053] e. Centrifuge the centrifuge tube at 12,000 rpm for 10 minutes at 4°C, retain the precipitate attached to the bottom of the tube, and remove the liquid inside the centrifuge tube.

[0054] f. Add 75% enzyme-free ethanol to the centrifuge tube and gently shake the tube until the white precipitate at the bottom floats up, thoroughly washing the RNA.

[0055] g. Centrifuge the centrifuge tube at 8000 rpm for 5 minutes at 4°C, retain the precipitate attached to the bottom of the tube, and remove the liquid inside the centrifuge tube.

[0056] h. Add enzyme-free anhydrous ethanol (CELLJC, 117113023) to the centrifuge tube, and gently shake the centrifuge tube until the white precipitate at the bottom of the tube floats up, thoroughly washing the RNA.

[0057] i. Centrifuge the centrifuge tube at 8000 rpm for 5 minutes at 4°C, retain the precipitate attached to the bottom of the tube, and remove the liquid inside the centrifuge tube.

[0058] j. After the RNA precipitate has dried, add 15-30 μL of enzyme-free water (White Shark, BL510B) to dissolve it before using it for subsequent experiments.

[0059] (2) RNA reverse transcription: Add 500 μg RNA to each sample, add 2 μL of reverse transcription premixed system (Aikerui, AG11706), bring the volume to 10 μL with enzyme-free water, react at 37℃ for 15 min, react at 85℃ for 5 sec, cool to 4℃ and take out, add 40 μL of enzyme-free water to dilute, and store at -20℃ for later use.

[0060] Reverse transcription primers: a mixture of Random 6mers Primer and Oligo dT(18T) Primer

[0061] (3) First-generation sequencing of circular RNA circRere

[0062] Based on the above experimental procedures and methods, cDNA products from rat spinal cord dorsal horn tissue were obtained. These cDNA products were then subjected to high-cycle, high-extension-time PCR amplification. The PCR amplification program was as follows: pre-denaturation at 98℃ for 45 s, denaturation at 98℃ for 10 s, annealing at 60℃ for 30 s, extension at 72℃ for 1 min, denaturation → extension cycles for 45, final extension at 72℃ for 5 min, and cooling to 4℃. The PCR amplification system is shown in Table 1 below.

[0063] Table 1 PCR amplification system

[0064] reagents volume Reaction premix 25μL Upstream primer (10 μM) 2μL Downstream primer (10 μM) 2μL cDNA template 5μL Enzyme-free water Adjust the volume to 50 μL

[0065] The amplification primers for circular RNA circRere are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0066] Upstream primer: 5'-GAGGATGAAGTGGAGGCTGAATA-3' (SEQ ID NO.1);

[0067] Downstream primer: 5'-AAGTTTGGCCTGATGGCTAGG-3' (SEQ ID NO.2).

[0068] The PCR product was sent to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing. The results are as follows: a 445bp band was recovered, cloned into the T3 vector, and sequenced using universal primers M13(-21). Circulation sites were clearly detected. Figure 1 As shown, the bolded sequence is the primer sequence, and there are two circularization splicing sites (marked by red and green spaces). The sequence between the two splicing sites is the full-length circRere sequence (373 bp), confirming that circRere is circularized. Therefore, the circular RNA circRere is expressed in the dorsal horn tissue of the rat spinal cord.

[0069] Example 2: Detection of the expression of circular RNA circRere in the dorsal horn of the spinal cord of rats treated with vincristine.

[0070] The expression level of circular RNA circRere in vincristine-induced neuropathic pain rats was detected by real-time quantitative qPCR, specifically including the following steps:

[0071] 1) Experimental groups: Solvent group (Veh group), Vincristine treatment group (VCR group).

[0072] 2) Drugs and reagents: vincristine, physiological saline, SYBR Green qPCR premix (Aikerui, AG11701).

[0073] 3) Experimental steps

[0074] (1) RNA extraction: Same as in Example 1.

[0075] (2) RNA reverse transcription: Same as in Example 1.

[0076] (3) qPCR reaction: Prepare the amplification system (per well) according to Table 2 below.

[0077] Table 2 qPCR reaction amplification system

[0078]

[0079] The amplification primers for the circular RNA circRere are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0080] Perform real-time quantitative PCR reactions according to the following procedure:

[0081] Step 1: 95℃ for 30 seconds (pre-deformation of the template)

[0082] Step 2: PCR reaction

[0083] GOTO: 39 (i.e., 40 cycles)

[0084] 95℃ 5s

[0085] 60℃ 30s

[0086] Step3: Melt Curve (65℃to 95℃, increment 0.5℃, for 5s+Plate Read)

[0087] Data uses 2 -△△CT The law will be used to handle this.

[0088] qPCR detection results are as follows Figure 2As shown in Table 3, where Veh is the solvent group and VCR is the vincristine treatment group, the results showed that the circular RNA circRere was significantly downregulated in the dorsal horn of the spinal cord of rats in the vincristine treatment group.

[0089] Table 3. Results of circRere qPCR detection in the dorsal horn of the rat spinal cord in each group (mean and standard error)

[0090] Group circRere content (change factor) Veh 1±0.27 VCR 0.24±0.04

[0091] In summary, the circular RNA circRere was significantly downregulated in rats with vincristine-induced neuropathic pain, suggesting that circRere could be used as a supplement to address vincristine-induced neuropathic pain. Furthermore, circRere is a circular RNA present in normal rats, offering the advantage of low toxicity to individuals and holds promise as a next-generation analgesic.

[0092] Example 3: Construction and preparation of circular RNA circRere cloning vector

[0093] (1) Construction of circular RNA circRere expression vector

[0094] Guangzhou Gisele Biotechnology Co., Ltd. was commissioned to construct the circular RNA circRere cloning vector and prepare the circular RNA circRere. Figure 3 The diagram shows a cloning vector with the target sequence. Based on the circRere sequence information, a circularized frame sequence is designed. The designed circRere sequence is obtained through whole-genome chemical synthesis. The fragment is ligated to the multiple cloning site of the pUC19 plasmid using the specified restriction enzyme sites to obtain a cloning vector with the target sequence, as shown in SEQ ID NO.3.

[0095] Sequence information of the circular RNA circRere expression vector:

[0096] (SEQ ID NO.3).

[0097] (2) Preparation of transcription template:

[0098] 1) Plasmid linearization: The plasmid was digested with the restriction enzyme EcoRI to obtain a linearized plasmid;

[0099] 2) Purification and quality control of linearized plasmids:

[0100] The product after enzyme digestion was purified using the phenol / chloroform method, the steps of which are as follows:

[0101] ① Add 200 μL of a phenol / chloroform mixture (1:1) with pH 7-8 to a 200 μL sample, vortex thoroughly, centrifuge at 13000×g for 5 min, and transfer the upper layer (aqueous phase) to a new RNase-free EP tube.

[0102] ② Add chloroform of equal volume to water and extract twice, then collect the upper aqueous phase.

[0103] ③ Add 0.1 times the volume of sodium acetate (3M, RNase free) and 2 times the volume of anhydrous ethanol, mix well, incubate at -20℃ for more than 30 min, centrifuge at 13000×g for 10 min at 4℃, and discard the supernatant.

[0104] ④ Add 500 μL of pre-cooled DEPC-H2O-prepared 70% ethanol, vortex to mix, centrifuge at 13000×g for 10 min at 4℃, and discard the supernatant.

[0105] ⑤ Open the lid and dry for 2 minutes, then add an appropriate amount of DEPC-H2O to dissolve.

[0106] ⑥ The concentration of linearized plasmids was measured using a micro-volume nucleic acid analyzer, with a concentration of 1 μg / μl. The products were stored at -80℃.

[0107] (4) Preparation of circular RNA circRere:

[0108] 1) In vitro transcription circularization: Prepare the reaction system for in vitro transcription according to Table 4 below. After gently mixing with a pipette, react at 37°C for 1 hour and at 42°C for 6 hours.

[0109] Table 4. Reaction system for in vitro transcription

[0110] Components Dosage 10× reaction system 3μL 25mM NTP 4.5μL T7 RNA Polymerase Mix 1.2μL DNA template 1μg Enzyme-free water Adjust the volume to 30 μL

[0111] 2) RNA purification

[0112] RNA was purified using lithium chloride precipitation. Unless otherwise specified, the centrifugation conditions described below are 13000×g, 4℃.

[0113] ① Add 15 μL of 8M LiCl to 30 μL of sample, mix by inversion, and let stand at -20℃ for 30 min;

[0114] ② Centrifuge at 13000×g for 15 min at 4℃, then discard the supernatant.

[0115] ③ Add 1 mL of 70%–75% ethanol to resuspend the precipitate, centrifuge at 13000×g for 10 min at 4℃, and discard the supernatant;

[0116] ④ Briefly centrifuge and carefully absorb the water with a pipette tip (do not remove the precipitate);

[0117] ⑤ Add an appropriate amount of DEPC-H2O, vortex / invert to dissolve completely;

[0118] ⑥ Use a micro-volume nucleic acid analyzer to detect RNA concentration;

[0119] ⑦ Continue downstream experiments with the product, or store it at -80℃.

[0120] 3) RNA size and quality detection: The concentration and quality of RNA were measured using a micro-nucleic acid analyzer; the size and integrity of RNA were determined by agarose electrophoresis.

[0121] 4) RNase R digestion removes linear RNA

[0122] Linear RNA in the circularized product was digested using RNase R (Geneseed, Cat. No: R0301). Generally, an RNase R / RNA ratio of 2 U / μg and a reaction temperature of 37℃ for 15 min are sufficient for complete digestion of linear RNA. However, RNase R has low or no digestion efficiency for linear RNAs with specific structures (such as dsRNA, snRNAs, and Y RNAs). Therefore, a small-scale test was first performed to determine the amount of RNase R needed for complete digestion of linear RNA (the circularization efficiency could be calculated simultaneously), followed by large-scale linear RNA digestion (reaction conditions are shown in Table 5 below). The digestion product was recovered using lithium chloride precipitation. 20 μg of purified RNA product was diluted to 80 μL, then denatured at 70℃ for 5 min, and immediately placed on ice. The digestion reaction system was prepared according to Table 5 below, and the digested product was purified using LiCl precipitation.

[0123] Table 5 Digestion reaction system

[0124]

[0125] 5) HPLC purification of circular RNA

[0126] HPLC purification was performed using an SRT SEC-2000 column (model SRT SEC-2000, manufactured by SRT Technology Co., Ltd.), specifically including the following procedures:

[0127] ① Equilibration: Set 2 to 4 times (target value: 2 times) column volume of TE solution to equilibrate the chromatography column, and ensure that the A260 absorbance value is stable at a flow rate of 6 mL / min.

[0128] ② Sample loading: After desulfurization, all the sample is loaded into the chromatography column at a flow rate of 6 mL / min.

[0129] ③ Elution: Elute with TE solution at a flow rate of 6 mL / min. Collect the elution buffer 1 when A260 > 10 mAU. The target product is in the elution buffer 1.

[0130] 6) Isopropanol precipitation method for RNA purification

[0131] ① Add 0.5 times the volume of 3M NaAc (pH 5.2) and an equal volume of isopropanol to the sample, mix by inversion, and let stand at -20℃ for >2h;

[0132] ② Centrifuge at 13000×g for 15 min at 4℃, then discard the supernatant;

[0133] ③ Add 1 mL of 70%–75% ethanol to resuspend the precipitate, centrifuge at 13000×g for 10 min at 4℃, and discard the supernatant;

[0134] ④ Briefly centrifuge (if the precipitate is loose, you can choose high-speed refrigerated centrifugation), and carefully absorb the water with a pipette tip (do not remove the precipitate);

[0135] ⑤ Add an appropriate amount of DEPC-H2O, vortex / invert to dissolve completely (when completely dissolved, there should be no transparent gel-like substance present);

[0136] ⑥ The RNA concentration was detected using a micro-volume nucleic acid analyzer to be 1 μg / μl;

[0137] ⑦ Store the product at -80℃.

[0138] (5) Quality detection of circular RNA prepared in vitro

[0139] RNase R tolerance assay: Equal amounts of linear precursor RNA and circular RNA were digested with RNase R (RNase R / RNA = 2 U / μg) at 37℃ for 15 min, then recovered by lithium chloride precipitation, and detected by 1.5% agarose gel electrophoresis (150V, 15 min). The results of the circRere RNase R tolerance assay are shown below. Figure 4 As shown: Circular RNA is resistant to RNase R cleavage, while linear RNA is completely digested.

[0140] Circular RNA circularization interface verification: The purified circular RNA was further reverse transcribed into cDNA using an N6 random primer, and PCR primers were designed for sequencing to detect the correctness of the circularization interface. The PCR product was cloned into pMD via TA. TM Using the 18-T vector, five single colonies were randomly selected from a plate for sequencing. The relevant primers are listed below:

[0141] Detection of the upstream primer of the circularized interface: TGGACAGAGGATGAAGTGGAG (SEQ ID NO.4);

[0142] Detection of the downstream primer of the circularized interface: GCATTGAGAGTGGTGTCATCC (SEQ ID NO.5).

[0143] The splice sites in the first-generation sequencing results of circRere are shown as follows: Figure 5 As shown: the prepared circular RNA was circularized in the specified circularization region, and the sequence of the obtained circular RNA circRere is shown in SEQ ID NO.6 below.

[0144] GAGGCTGAATAGTACCCAAGGAGAAATTCGAGTTGGCCCTAGCCATCAGGCCAAACTTCCAGATTTGCAGCCATTTCCTTCTCCAGATGGTGACACTGTGACTCAGCATGAGGAACTTGTCTGGATGCCTGGAGTCAGTGACTGTGACCTCCTCATGTACTTGAGGGCAGCAAGGAGCATGGCAGCCT TCGCAGGAATGTGTGACGGAGGTTCCACAGAGGATGGCTGTGTCGCAGCGTCTCGGGATGACACCACTCTCAATGCACTGAACACACTACATGAAAGCAGTTATGATGCCGGCAAAGCCCTGCAGCGCCTGGTGAAGAAGCCTGTGCCCAAGCTGATCGAGAAGTGCTGGACAGAGGATGAAGTG(SEQ ID NO.6).

[0145] 3) Coding region sequencing

[0146] The purified circular RNA was further reverse transcribed into cDNA using an N6 random primer. The reverse transcription conditions are shown in Table 6 below.

[0147] Table 6 Reverse Transcription Conditions

[0148]

[0149] PCR primers were designed for sequencing to detect the correctness of the coding region. High-fidelity enzymes were used to amplify the coding region sequence. PCR conditions are shown in Table 7 below. The PCR products were directly excised and sequenced after electrophoresis.

[0150] Table 7 PCR Reaction System and Procedure

[0151]

[0152] The sequencing results of the coding region are as follows Figure 6 As shown, the sequencing results indicate that the coding region sequence of the circular RNA prepared in vitro is completely correct.

[0153] 4) Angilent 2100 test

[0154] Appropriate circular RNA samples were collected to assess RNA integrity and quality. The results were obtained through Agilent 2100 quality control and are as follows: Figure 7 As shown, the results indicate that the circular RNA prepared in vitro has high integrity, no degradation, and the fragment size is as expected, with no other extraneous bands.

[0155] 5) Detection of circular RNA concentration and purity

[0156] The concentration of circular RNA and the A260 / A280 ratio were determined using a nucleic acid concentration analyzer. The concentration of circular RNA was 1 μg / μl, and the A260 / A280 ratio was 2.0.

[0157] 6) The final product provided by Guangzhou Gise Biotechnology Co., Ltd. is circRere dry powder containing 5 tubes of 100μg each.

[0158] Experiment 1: Effects of circular RNA circRere on mechanical, thermal, and cold pain sensations in vincristine-induced neuropathic pain rats

[0159] I. Experimental Materials

[0160] 1. Animals: 36 healthy male SD rats, weighing (250±10)g.

[0161] 2. Drugs: 0.05 mg / mL vincristine, 0.5 μg / μL circular RNA circRere solution (prepared in Example 2 above).

[0162] II. Test Methods

[0163] 1. Drug preparation:

[0164] (1) 0.05 mg / mL vincristine:

[0165] Add 10 mg of vincristine to 2 mL of physiological saline as a solvent, then aliquot into 160 μL tubes for storage. Wrap in aluminum foil and store at -20°C protected from light. Dilute 150 μL with (15 mL - 150 μL) normal saline before use.

[0166] (2) 1 μg / μL circular RNA (circRere) solution:

[0167] Dissolve 100 μg of circRere powder in 50 μL of enzyme-free water. Depending on the number of rats to be treated, 10 μL of solution is needed per rat. The following preparation method uses 6 rats as an example: Take 15 μL of circRere aqueous solution and add 15 μL of 10% sterile glucose solution to prepare solution 1. Take 15 μL of animal RNA transfection reagent (catalog number: 18668-11-1) and add 15 μL of 10% sterile glucose solution. Mix with solution 1 at room temperature. Prepare and use immediately; do not refrigerate or freeze. For the control group, replace the circRNA aqueous solution with enzyme-free water.

[0168] 2. Grouping and administration:

[0169] Vincristine intervention control group (VCR+NC): 0.05 mg / mL vincristine working solution was injected intraperitoneally for 10 days, followed by intrathecal injection of 10 μL RNA transfection reagent solution and 10 μL physiological saline to flush the tube;

[0170] Vincristine circRere intervention group (VCR+circRere): 10 days after intraperitoneal injection of 0.05 mg / mL vincristine working solution, 10 μL of 0.5 μg / μL circRere injection solution and 10 μL of normal saline were injected intrathecally to flush the tubing.

[0171] 3. Experimental steps:

[0172] (1) Establishment of a rat model of vincristine-induced neuropathic pain: Rats were measured at baseline behavioral levels before injection, followed by intraperitoneal injection of 0.05 mg / mL vincristine solution (dose: 0.05 mg / kg) for 10 consecutive days. On day 11, the rats' paw mechanical pain withdrawal threshold, cold pain withdrawal response time, and heat pain withdrawal latency were measured. Successful modeling was indicated by a decrease in the mechanical pain withdrawal threshold compared to baseline, an increase in the cold pain withdrawal response time compared to baseline, and a decrease in the heat pain withdrawal latency compared to baseline. The experimental results are as follows: Figure 8 As shown in Table 8, behavioral data indicate that after 10 days of drug administration, the rats' foot mechanical pain withdrawal threshold was lower than the baseline value, the cold pain withdrawal response time was higher than the baseline value, and the heat pain withdrawal latency was lower than the baseline value, indicating that the model was successfully established.

[0173] Table 8

[0174]

[0175]

[0176] (2) A total of 24 rats exhibiting significant pain behavior were randomly divided into a vincristine intervention control group and a vincristine circRere intervention group. The control group received an intrathecal injection of 20 μL of physiological saline, while the intervention group received either 10 μL of 0.5 μg / μL circRere injection or 10 μL of physiological saline flushing solution. Mechanical pain withdrawal threshold, thermal pain withdrawal latency, and cold pain withdrawal response duration were measured starting one hour after intrathecal injection and continued until 48 hours post-administration. The experimental results are shown in Tables 9-11 below.

[0177] Table 9. Results of cold pain withdrawal reaction time in rats of each group (mean and standard error)

[0178]

[0179] Table 10 Results of latency period for heat-induced pain withdrawal in rats of each group (mean & standard error)

[0180]

[0181] Table 11 Results of mechanical pain withdrawal threshold measurement in rats of each group (mean ± standard error)

[0182]

[0183]

[0184] 4. Analysis of experimental results:

[0185] Experimental results are as follows Figures 9-11 As shown in Tables 9 and 10, it can be seen that intrathecal injection of circRere solution can significantly relieve cold pain, heat pain, or mechanical hyperalgesia of the sole of the foot caused by vincristine, and the analgesic effect takes effect after about 4 to 5 hours and can last for at least 48 hours. This indicates that the circRere solution provided by the present invention has a significant analgesic effect and can be used to treat hyperalgesia and hyperalgesia caused by vincristine.

[0186] In summary, this invention uses quantitative real-time PCR to detect the differential expression of circular RNA circRere in rat samples. The results show that circular RNA circRere is significantly downregulated in rats with vincristine-induced neuropathic pain. Therefore, circular RNA circRere can be used as a diagnostic marker for neuropathic pain, and a kit for detecting changes in the expression of this gene can be developed for the diagnosis of neuropathic pain.

[0187] Secondly, this invention demonstrates through rat experiments that the circular RNA circRere is significantly downregulated in rats with vincristine-induced neuropathic pain. Intervention with circular RNA circRere as a supplement can significantly alleviate vincristine-induced neuropathic pain. Therefore, circular RNA circRere can be used in the preparation of drugs for treating vincristine-induced neuropathic pain.

[0188] The above embodiments are merely illustrative of the principles and effects of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or alter the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or alterations made by those skilled in the art without departing from the spirit and technical concept disclosed in the present invention should still be covered by the claims of the present invention.

Claims

1. The application of circular RNA circRere in the preparation of drugs for treating or relieving neuropathic pain, characterized in that, The cDNA sequence of the circular RNA circRere is shown in SEQ ID NO.

6.

2. The application according to claim 1, characterized in that, The neuropathic pain mentioned above is neuropathic pain caused by the toxic effects of vincristine on the nervous system.

3. The application according to claim 1, characterized in that, The single-dose administration of the circular RNA circRere is 5–15 mg / kg.

4. The application according to claim 1, characterized in that, The single-dose administration of the circular RNA circRere is 8–12 mg / kg.

5. The application according to claim 1, characterized in that, The single-dose administration of the circular RNA circRere is 10 mg / kg.

6. The application according to claim 1, characterized in that, The drug is an injectable dosage form.

7. The application according to claim 1, characterized in that, The drug is a circRere supplement containing circular RNA.

8. A medicament for treating or relieving neuropathic pain, characterized in that, The drug for treating or relieving neuropathic pain contains a circular RNA circRere with a cDNA sequence as shown in SEQ ID NO.

6.

9. A diagnostic kit for neuropathic pain, characterized in that, The kit contains primers capable of amplifying circular RNA circRere, as shown in SEQ ID NO.6, with cDNA sequences.

10. The diagnostic kit for neuropathic pain according to claim 9, characterized in that, The amplification primer sequence information is shown in SEQ ID NO.1 and SEQ ID NO.2.

Citation Information

Patent Citations

  • Application of annular RNA circ-FOXP1

    CN107760784A

  • Application of circREE inhibitor in preparation of medicine for treating ischemic heart disease

    CN117398464A