Application of wheat TaSmD3 gene in improving resistance to lodging of wheat

By knocking out the TaSmD3 gene in wheat using CRISPR/Cas9 technology, the problem of insufficient lodging resistance in wheat under existing technologies has been solved. This allows for reducing plant height and improving lodging resistance without affecting yield, and provides a new dwarfing gene for wheat breeding.

CN118931947BActive Publication Date: 2026-05-01SHANDONG AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411192228.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-28
Publication Date
2026-05-01
Estimated Expiration
2044-08-28

AI Technical Summary

Technical Problem

While existing technologies have dwarfing genes that can enhance lodging resistance in wheat, they are still insufficient to meet production needs. More wheat dwarfing genes need to be discovered to improve lodging resistance without affecting yield.

Method used

The wheat TaSmD3 gene was knocked out using CRISPR/Cas9 technology. A CRISPR/Cas9 editing vector was constructed and wheat was transformed using Agrobacterium-mediated transformation to obtain a wheat mutant with reduced plant height and improved lodging resistance.

Benefits of technology

Without affecting yield traits, it significantly reduces wheat plant height, enhances lodging resistance, promotes high and stable yield, and provides new dwarf genes for wheat breeding.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118931947B_ABST
    Figure CN118931947B_ABST
Patent Text Reader

Abstract

The application discloses application of a wheat TaSmD3 gene in improving lodging resistance of wheat and belongs to the technical field of plant genetic engineering.The application clones a wheat TaSmD3 gene from wheat, and finds through research on the gene that a mutant obtained by knocking out the TaSmD3 gene through CRISPR / Cas9 technology can reduce the plant height of the wheat and improve the lodging resistance of the wheat, and the ear length, the number of spikelets per ear, the number of fertile florets per ear, the number of grains per ear and the hundred-grain weight and other yield characters of the mutant have no significant difference from those of a wild type.Therefore, the wheat TaSmD3 gene can be used as a new dwarf gene, and under the premise that the yield characters of the wheat are not affected, the lodging resistance of the wheat is improved, which has important significance for improving the harvest index of the wheat and promoting high yield and stable yield.
Need to check novelty before this filing date? Find Prior Art

Description

Application of wheat TaSmD3 gene in improving wheat lodging resistance Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, specifically to the application of the wheat TaSmD3 gene in improving the lodging resistance of wheat. Background Technology

[0002] Wheat is one of the world's most important food crops, widely distributed globally, feeding approximately 40% of the world's population and serving as a primary source of energy for humankind. With the increasing global population, the demand for food is also rising. To meet the food needs of this vast population, improving wheat's superior agronomic traits has become a crucial way to increase wheat yield. Many factors influence wheat yield, among which plant height is a vital trait affecting plant type and yield potential. Excessive plant height can lead to lodging. Scientists have introduced semi-dwarfing alleles such as Rht-B1 and Rht-D1 to reduce plant height, thereby enhancing lodging resistance and increasing yield. Furthermore, if plant height can be appropriately reduced without affecting the final yield, lodging resistance can be enhanced, the harvest index increased, and high and stable yields promoted.

[0003] In wheat breeding practice, dwarfing genes that reduce plant height can be broadly classified into three categories: D-grass-type dwarfing genes, Us-single-stem dwarfing genes, and Rht (Reduced height)-major dwarfing genes that reduce plant height (Mcitnosh RA et al., 1998). The dwarfing genes we commonly refer to specifically are Rht genes. Using genetic analysis methods, 25 Rht-type dwarfing genes have been identified in wheat. These Rht genes have the function of reducing plant height, and most are located on the fourth homologous chromosome group of wheat (Ye Yaqiong et al., 2015).

[0004] While some dwarfing genes have been identified that can enhance wheat lodging resistance, this is far from sufficient for practical application. Therefore, it is necessary to use techniques such as forward genetics or reverse genetics to discover more wheat dwarfing genes to further enhance wheat lodging resistance. Summary of the Invention

[0005] The purpose of this invention is to address the aforementioned limitations of the prior art and to provide the application of the wheat TaSmD3 gene in improving wheat lodging resistance. This invention has found that the wheat TaSmD3 gene can regulate wheat plant height, improving lodging resistance without affecting yield, and can serve as a novel wheat dwarfing gene.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A first aspect of the present invention provides the use of the wheat TaSmD3 gene in any one of the following (1)-(3):

[0008] (1) Regulating wheat plant height;

[0009] (2) Regulating lodging resistance in wheat;

[0010] (3) Develop dwarf wheat varieties;

[0011] The wheat TaSmD3 gene is any of the DNA molecules shown in i)-v) below:

[0012] i) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 1;

[0013] ii) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 2;

[0014] iii) The nucleotide sequence is the DNA molecule shown in SEQ ID No. 3;

[0015] iv) DNA molecules encoding the amino acid sequence shown in SEQ ID No. 4, excluding i)-iii);

[0016] v) A DNA molecule that has 75% or more identity with the DNA fragment defined in i), ii), or iii), and that encodes a protein that is functionally equivalent to the protein shown in SEQ ID No. 4.

[0017] The term "identity" used here refers to sequence similarity to natural nucleic acid sequences. Homology can be evaluated using computer software, such as the BLAST algorithm (Altschul et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).

[0018] In the aforementioned nucleic acid molecules, the 75% or more homology can be at least 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% homology.

[0019] A second aspect of the invention provides the use of the protein encoded by the wheat TaSmD3 gene in either (1) or (2) below:

[0020] (1) Regulating wheat plant height;

[0021] (2) Regulate the lodging resistance trait of wheat.

[0022] In the above applications, the amino acid sequence of the protein encoded by the wheat TaSmD3 gene is shown in SEQ ID No. 4.

[0023] In a third aspect, the invention provides the use of a recombinant expression vector or genetically engineered bacteria containing the wheat TaSmD3 gene in any of the following (1)-(3):

[0024] (1) Regulating wheat plant height;

[0025] (2) Regulating lodging resistance in wheat;

[0026] (3) Cultivate dwarf wheat varieties.

[0027] In the above applications, the recombinant expression vector is preferably a CRISPR / Cas9 editing vector carrying the wheat TaSmD3 gene.

[0028] A fourth aspect of the present invention provides a method for improving the lodging resistance of wheat, comprising the following steps:

[0029] Mutating the TaSmD3 gene in the wheat genome yielded wheat mutant lines with reduced plant height and increased lodging resistance.

[0030] Preferably, the method for mutating the TaSmD3 gene in the wheat genome is as follows: select two fragments on the TaSmD3 genome as target sequences to construct a CRISPR / Cas9 knockout vector, then introduce it into Agrobacterium, and transform wheat embryos using Agrobacterium-mediated transformation.

[0031] A fifth aspect of the present invention provides a method for breeding dwarf wheat varieties, comprising the following steps:

[0032] The gene editing vector TaSmD3-pBUE413-2gR was exogenously transferred into wheat to mutate the wheat TaSmD3 gene, resulting in transgenic wheat knockout plants with reduced plant height.

[0033] By using transgenic wheat knockout plants with reduced plant height as parents for self-pollination, or by hybridizing them with other dwarf wheat plants, dwarf wheat varieties with strong lodging resistance can be obtained.

[0034] In a sixth aspect, the present invention provides a wheat dwarfing gene TaSmD3-aaBBuu, comprising: a TaSmD3-a gene, a TaSmD3-B gene, and a TaSmD3-u gene;

[0035] The TaSmD3-a gene is obtained by deleting nucleotides 232-236 of the DNA molecule shown in SEQ ID No. 1, and its nucleotide sequence is shown in SEQ ID No. 5.

[0036] The nucleotide sequence of the TaSmD3-B gene is shown in SEQ ID No. 2;

[0037] The TaSmD3-u gene is obtained by deleting nucleotides 233-234 of the DNA molecule shown in SEQ ID No. 3, and its nucleotide sequence is shown in SEQ ID No. 6.

[0038] Alternatively, nucleotides 26-238 of the DNA molecule shown in SEQ ID No. 3 can be deleted, and its nucleotide sequence is shown in SEQ ID No. 7.

[0039] In a seventh aspect, the present invention provides the application of the aforementioned wheat dwarfing gene TaSmD3-aaBBuu in wheat molecular breeding.

[0040] Preferably, the wheat molecular breeding is the breeding of dwarf wheat varieties.

[0041] The beneficial effects of this invention are:

[0042] This invention cloned a wheat TaSmD3 gene from wheat. Research on this gene revealed that the mutant obtained by knocking out the TaSmD3 gene using CRISPR / Cas9 technology can reduce wheat plant height and improve lodging resistance; while yield traits such as spike length, number of spikelets per spike, number of fertile florets per spike, number of grains per spike, and 100-grain weight showed no significant difference from the wild type. Therefore, the wheat TaSmD3 gene can serve as a novel dwarfing gene, improving lodging resistance in wheat without affecting yield traits, which is of great significance for improving the wheat harvest index and promoting high and stable yields. Attached Figure Description

[0043] Figure 1: Schematic diagram of the editing vector pBUE413-2gR used to edit wheat genes.

[0044] Figure 2: Schematic diagram of the editing vector TaSmD3-pBUE413-2gR used to edit the wheat TaSmD3 gene.

[0045] Figure 3: Field traits of TaSmD3-T3 gene-edited plants and wild-type plants.

[0046] Figure 4: Schematic diagram of the editing results of TaSmD3-T1 transgenic plants; where A is a schematic diagram of the gene structure and target sequence location of TaSmD3, and a nucleotide comparison diagram of the homozygous mutant and wild-type gene of TaSmD3 with two copies knocked out in the wheat A and U genomes; B is a deduced amino acid sequence comparison diagram of the homozygous mutant and wild-type gene of TaSmD3 with two copies knocked out in the wheat A and U genomes.

[0047] Figure 5: Schematic diagram of detection of potential off-target sites of TaSmD3; A is target 1, B is target 2.

[0048] Figure 6: Schematic diagram of plant height observation of wild-type Fielder and TaSmD3-aaBBuu mutant in the TaSmD3-T3 generation transgenic plants.

[0049] Figure 7: Statistical results of field phenotypes of TaSmD3-T3 generation transgenic plants. Detailed Implementation

[0050] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0051] As mentioned earlier, discovering genes that can improve wheat lodging resistance is of great significance for breeding wheat varieties with strong lodging resistance and high and stable yield.

[0052] In view of this, the present invention has conducted in-depth research on wheat lodging resistance genes.

[0053] TraesCS5A01G554700 is a gene with unknown function located on wheat chromosome 5; TraesCS4B02G392700 is a gene with unknown function located on wheat chromosome 4; TraesCSU02G033900 is a gene with unknown function located on wheat chromosome 7.

[0054] To study the functions of the three genes mentioned above, this invention first cloned three genes from wheat. The cloned TraesCS5A01G554700 gene was named TaSmD3-A gene, and its CDS region nucleotide sequence is shown in SEQ ID No. 1; the cloned TraesCS4B02G392700 gene was named TaSmD3-B gene, and its CDS region nucleotide sequence is shown in SEQ ID No. 2; the cloned TraesCSU02G033900 gene was named TaSmD3-U gene, and its CDS region nucleotide sequence is shown in SEQ ID No. 3.

[0055] Further analysis of the TaSmD3-A, TaSmD3-B, and TaSmD3-U genes revealed that the amino acid sequences of their encoded proteins are identical, all being the amino acid sequence shown in SEQ ID No. 4.

[0056] TaSmD3 was knocked out using CRISPR / Cas9 technology, resulting in four mutant types: TaSmD3-aaBBUU single mutant, TaSmD3-AAbbUU single mutant, TaSmD3-AABBuu single mutant, and TaSmD3-aaBBuu double mutant. Field phenotype analysis of the four mutants revealed reduced plant height in both single and double mutants, but the reduction was more pronounced in the TaSmD3-aaBBuu double mutant. This indicates that the TaSmD3-aaBBuu double mutant is a dwarf mutant, which may be important for wheat lodging resistance. Therefore, subsequent experiments mainly focused on the two homozygous TaSmD3-aaBBuu double mutants. Compared to the wild type, nucleotides 232-236 of the TaSmD3-A gene CDS region were deleted in mutant aaBBuu-1, and its nucleotide sequence is shown in SEQ ID No. 5, as follows:

[0057]

[0058] Note: The shaded areas in the sequence represent deleted nucleotides.

[0059] Nucleotides 233-234 of the TaSmD3-U gene CDS region in mutant aaBBuu-1 are deleted, and its nucleotide sequence is shown in SEQ ID No. 6, as follows:

[0060]

[0061] Note: The shaded areas in the sequence represent deleted nucleotides.

[0062] Compared with the wild type, the TaSmD3-A gene of mutant aaBBuu-2 is the same as that of mutant aaBBuu-1, with nucleotide deletions at positions 232-236 of the CDS region, and its nucleotide sequence is shown in SEQ ID No. 5.

[0063] Nucleotides 26-238 of the TaSmD3-U gene CDS region in mutant aaBBuu-2 are deleted, and its nucleotide sequence is shown in SEQ ID No. 7; specifically as follows:

[0064]

[0065] TTCAAGCGCCTCGAGGCCAGGATAAGGGGCAAGGGGTCGGCCATCGGCGTCGGGCGTGGCCGT

[0066] GCTGTCGCGATGCGTGCCCGGGCTGCTGGTGGTCGTGGTGGTGGCCCCCCTGTTGGAGGAGGACGAGGTGGCGCGCCTCCGGTGAGGAGGTAG.

[0067] Note: The shaded areas in the sequence represent deleted nucleotides.

[0068] Studies on plant height and yield traits of mutants aaBBuu-1 and aaBBuu-2 revealed that the mutants could reduce wheat plant height and improve lodging resistance; while yield traits such as spike length, number of spikelets per spike, number of fertile florets per spike, number of grains per spike, and 100-grain weight were not significantly different from those of the wild type.

[0069] To enable those skilled in the art to better understand the technical solution of this application, the technical solution of this application will be described in detail below with reference to specific embodiments.

[0070] The experimental materials used in the embodiments of this invention, unless otherwise specified, are all conventional experimental materials in the art and can be purchased through commercial channels. Where specific experimental conditions and methods are not specified in the embodiments of this invention, they are generally performed under conventional conditions, such as those described in J. Sambrook et al., eds., *Molecular Cloning: A Laboratory Manual (3rd Edition)*, Science Press, 2002; D.L. Spector et al., eds., *Cellular Laboratory Manual*, Science Press, 2001; or according to the conditions recommended by the manufacturer.

[0071] The plant CRISPR / Cas9 gene editing vector is pBUE413-2gR, which contains the wheat U6 promoter TaU6 to initiate sgRNA. The primers used in this invention were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0072] Wheat variety Fielder (referred to as “Fielder” in the literature): Bai X, Zhan G, Tian S, et al. Transcription factor BZR2 activates chitinase Cht20.2 ranscription to confer resistance to wheat stripe rust[J]. Plant Physiology, 2021, 187(4): 2749-2762.

[0073] Example 1: Construction of the editing vector TaSmD3-pBUE413-2gR

[0074] The genomic and coding regions of the TaSmD3 gene on chromosomes A, B, and U were amplified from the DNA and cDNA of the wheat variety Fielder. The nucleotide sequence of TaSmD3 in chromosome A was denoted as TaSmD3-A, in chromosome B as TaSmD3-B, and in chromosome U as TaSmD3-U. The amplification results showed that the full-length coding sequence of the TaSmD3-A, TaSmD3-B, and TaSmD3-D genes was 408 bases. The nucleotide sequence of TaSmD3-A is shown in SEQ ID No. 1 of the sequence listing, and it has 100% similarity to the wheat gene sequence in the Ensembl Plants database (http: / / plants.ensembl.org / index.html); the nucleotide sequence of the TaSmD3 gene in the B genome (corresponding to chromosome B) is shown in SEQ ID No. 2 of the sequence listing, and it has 100% similarity to the wheat gene sequence in the Ensembl Plants database; the nucleotide sequence of the TaSmD3 gene in the U genome (corresponding to an unknown chromosome) is shown in SEQ ID No. 3 of the sequence listing, and it has 100% similarity to the wheat gene sequence in the Ensembl Plants database.

[0075] Targets were designed on the TaSmD3 gene A, B, and U genomes using the E-CRISPR website (http: / / www.e-crisp.org / ):

[0076] MT1-BsF:AATAATGGTCTCAAGCGCCTCGTGCAGCAGCTTCAC;

[0077] MT1-F0:GCCTCGTGCAGCAGCTTCACGTTTTAGAGCTAGAAATAGC;

[0078] MT2-R0:ACATGCTCAAGAACGCCCCCGCTTCTTGGTGCC;

[0079] MT2-BsR:ATTATTGGTCTCTAAACACATGCTCAAGAACGCCCC.

[0080] Four-primer PCR amplification was performed using pCBC-MT1T2 diluted 100-fold as a template. -BsF / -BsR were the normal primer concentrations; -F0 / -R0 were diluted 20-fold. The PCR products were purified and recovered, and the following enzyme digestion-ligation system was established:

[0081]

[0082] Reaction conditions: 37℃, 5h; 50℃, 5min; 80℃, 10min.

[0083] The ligation product was transformed into *E. coli*, and then cultured on LB (Kan) plates until clones emerged. Single clones were then selected for sequencing. Sequencing results detected the target sequences gRNA1 and gRNA2 of the sgRNA, indicating successful construction of the sgRNA expression cassette and successful assembly into the pBUE413-2gR binary expression vector (Figure 1), demonstrating the successful construction of the CRISPR / Cas9 gene editing vector for TaSmD3. A schematic diagram of the TaSmD3-pBUE413-2gR vector used for editing the wheat TaSmD3 gene is shown in Figure 2.

[0084] Example 2: Obtaining gene-edited wheat using Agrobacterium-mediated genetic transformation with gRNA1 and gRNA2. (Agrobacterium-mediated wheat genetic transformation)

[0085] The gene-editing plasmid TaSmD3-pBUE413-2gR constructed in Example 1 was transformed into immature embryos of the wheat variety Fielder via Agrobacterium-mediated genetic transformation. Following differentiation, selection, regeneration, and rooting, regenerated plants were obtained. The wheat genetic transformation was performed by the Genetic Transformation Platform of the State Key Laboratory of Wheat at Shandong Agricultural University. Commercial transformation procedures can be completed by contacting this platform.

[0086] II. Detection of gene editing

[0087] 1. Identification of T0 generation regenerated plants

[0088] The test plants consisted of 14 T0 generation regenerated plants obtained in step one, and a Fielder plant (used as a reference plant for the regenerated plants). Genomic DNA was extracted from the leaves of the test plants, and PCR amplification was performed using primer pairs for amplifying the Cas9 and Bar genes, respectively, to further determine whether the plants contained the target vector.

[0089] The primer sequences are:

[0090] Cas9-F: ACGACGATGACCTGGATAACCTCC;

[0091] Cas9-R:ATGCCCTCGGTCACATACTTCAC.

[0092] Bar-F:AAGCACGGTCAACTTCCGTA;

[0093] Bar-R:GAAGTCCAGCTGCCAGAAAC.

[0094] The results showed that 9 positive mutant plants were obtained from the 14 resistant plants. T0 generation plants were self-pollinated, and T1 generation seeds were harvested. T1 generation plants were then cultivated from these seeds. Each T1 generation plant was identified according to the method described in step 1.

[0095] 2. Identification of T1 generation regenerated plants

[0096] (1) The test plants were: 33 T1 generation regenerated plants and Fielder (as a reference plant for the regenerated plants). Genomic DNA was extracted from the leaves of the test plants and PCR amplification was performed using three specific primer pairs. The three specific primer pairs were: a primer pair consisting of TaSmD3-AF and TaSmD3-AR (the target sequence of the primer pair in wheat genomic DNA is shown in SEQ ID No. 1, where gRNA1 and gRNA2 of the TaSmD3 gene in wheat A genome are located), a primer pair consisting of TaSmD3-BF and TaSmD3-BR (the target sequence of the primer pair in wheat genomic DNA is shown in SEQ ID No. 2, where gRNA1 and gRNA2 of the TaSmD3 gene in wheat B genome are located), and a primer pair consisting of TaSmD3-UF and TaSmD3-UR (the target sequence of the primer pair in wheat genomic DNA is shown in SEQ ID No. 3, where gRNA1 and gRNA2 of the TaSmD3 gene in wheat U genome are located). The sequences of the three specific primer pairs are as follows:

[0097] TaSmD3-AF:TCGTCCTCCTCCCTCTTGTA;

[0098] TaSmD3-AR: CCGCAATATATGAATTGACCT.

[0099] TaSmD3-BF:GTCCCTCCCTCCCTCTTGTAT;

[0100] TaSmD3-BR:GAGCCCGAAGACTACTAGTTGC.

[0101] TaSmD3-UF: CCTCCCTCCCTCTTGTTCTAT;

[0102] TaSmD3-UR: CCGCAATATATGAATTGACCT.

[0103] (2) After completing step 1, the PCR amplification product is recovered and subjected to first-generation sequencing (Sanger sequencing). The sequencing results are compared with the A, B, and U genomic sequences of the TaSmD3 gene in Fielder. A double peak at the target site indicates a heterozygous or biallelic mutation, while a base deletion or insertion at the target site indicates a homozygous mutation. If the nucleotide sequence at the target site is identical to that of the Fielder PCR amplification product, the regenerated plant is wild-type. The PCR product showing the mutation is ligated into a cloning vector and transformed into *E. coli*. The resulting positive clone is subjected to colony PCR amplification and sequencing using universal primers to determine the mutation mode of TaSmD3. If the regenerated plant has only one PCR amplification product, and its nucleotide sequence is identical to that of the Fielder PCR amplification product, the regenerated plant is wild-type. If the regenerated plant has two PCR amplification products, one identical to the nucleotide sequence of the Fielder PCR amplification product, and the other showing a mutation (including deletion, insertion, or substitution of one or more nucleotides), the regenerated plant is heterozygous. If the regenerated plant produces two PCR amplification products, both of which have mutated nucleotide sequences compared to Fielder's PCR amplification product (mutations include deletions, insertions, or substitutions of one or more nucleotides), the regenerated plant is a biallelic mutant. If the regenerated plant produces only one PCR amplification product, and its nucleotide sequence has mutated compared to Fielder's PCR amplification product (mutations include deletions, insertions, or substitutions of one or more nucleotides), the regenerated plant is a homozygous mutant. Heterozygous, biallelic, and homozygous mutants are collectively referred to as edited plants. Of the 33 T1 plants, 19 were edited plants (57.8%), and 14 were wild-type (42.2%).

[0104] Field traits of edited plants and wild-type plants were observed, and the results are shown in Figure 3. The plant height of both single mutants and double mutants was reduced, but the plant height of the TaSmD3-aaBBuu double mutant was reduced more significantly.

[0105] Therefore, we selected homozygous mutant lines (aaBBuu-1 and aaBBuu-2) with two copies of the A and U genomes simultaneously knocked out, which had relatively ideal base types and clear editing status, for subsequent experiments.

[0106] Figure 4 shows the genotypes and mutation types of the two gene-edited lines based on the target sequences A and U.

[0107] The TaSmD3 gene in the A genome of aaBBuu-1 is a mutant gene obtained by deleting 5 bases at the second target site; the TaSmD3 gene in the U genome is a mutant gene obtained by deleting 2 bases at the second target site. Both of these gene mutations cause the TaSmD3 protein to not terminate, ultimately leading to the loss of TaSmD3 protein function.

[0108] The TaSmD3 gene in the A genome of aaBBuu-2 is a mutant gene obtained by deleting 5 bases at the second target site; the TaSmD3 gene in the U genome is a mutant gene obtained by deleting 299 bases at the first and second target sites (including 213 bases deleted in the CDS region and 86 bases deleted in the intron region). The A gene mutation causes TaSmD3 protein to not terminate, while the U gene mutation causes TaSmD3 protein to terminate prematurely, both ultimately resulting in loss of TaSmD3 protein function.

[0109] III. Off-target analysis of CRISPR / Cas9

[0110] Based on the website WheatOmics (http: / / wheatomics.sdau.edu.cn / blast / blast.html), potential off-target sites for the sgRNA1 and sgRNA2 targets of the TaSmD3 gene were predicted, and primers were designed based on the flanking sequences of potential off-target sites: primer pairs consisting of off1-F and off1-R.

[0111] off1-F: TTCGGACAGACAGAGTCGAGAAA;

[0112] off1-R: CAAACTGAAAGGAAGAGGATGGAT.

[0113] Genomic DNA was extracted from leaves of TaSmD3 T2 generation gene-edited lines (aaBBUU-1, aaBBUU-2, AAbbUU, AABBuu-1, AABBuu-2, aaBBuu-1, aaBBuu-2). Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using primers consisting of off1-F and off1-R. The obtained PCR amplification products were sequenced, and information on off-target sites is shown in Figure 5.

[0114] The results showed that no off-target effects were detected in the TaSmD3 T2 generation gene-edited lines (aaBBUU-1, aaBBUU-2, AAbbUU, AABBuu-1, AABBuu-2, aaBBuu-1, aaBBuu-2) for the predicted potential off-target sites, meaning that no off-target effects were detected for gRNA1 and gRNA2 at the potential off-target sites.

[0115] Example 3: Analysis of wheat agronomic traits

[0116] Homozygous mutant lines (aaBBuu-1 and aaBBuu-2) from the wild-type recipient varieties Fielder and TaSmD3, which simultaneously knock out two copies of the A and U genomes of wheat, were planted together in the artificial climate chamber of the National Key Laboratory of Wheat Breeding at Shandong Agricultural University. The growing conditions were 25℃, 16 hours of light, and 8 hours of darkness.

[0117] The main agronomic traits of the tested edited plants and wild-type plants were statistically analyzed. Plant height was expressed as the height of the main stem, measured from the ground or dividing node to the top of the ear (excluding the awn), and the average value was taken, in cm. Stem diameter of the second-to-last node was measured as the diameter of the middle portion of the second-to-last node of the wheat stem, in cm. Ear length was measured as the length of the ear from the bottom to the top of the main stem, in cm. Number of spikelets per ear was measured as the number of ears produced on the main stem ear. Number of fertile florets per spikelet was measured as the number of florets that produce grains on each spikelet. The number of grains per ear was counted after threshing. The 100-grain weight was based on dried and winnowed grains; after mixing the samples, 100 grains were randomly selected and weighed, and three samples were made, with a difference not exceeding 5%.

[0118] Figure 6 shows a comparison of plant height between the wild-type Fielder and the mutant aaBBuu lines, and Figure 7 shows the statistical results of agronomic traits. The observations showed that, compared with the wild-type Fielder, the homozygous mutant lines (aaBBuu-1 and aaBBuu-2) with simultaneous knockout of two copies of TaSmD3 in the wheat A and U genomes had reduced plant height, increased stem diameter at the second-to-last internode, unchanged spike length, and no significant changes in the number of spikelets per spike and the number of fertile florets per spikelet. The number of grains per spike and the 100-grain weight of the mutant plants also showed no significant changes.

[0119] The above results indicate that wheat TaSmD3 gene-edited materials can be used as new materials for lodging resistance in wheat without affecting yield. The technical solution of this invention provides a practical method for achieving rapid wheat breeding and improving wheat traits using genetic engineering technology, and has important breeding application value and broad market application prospects.

[0120] The above description is merely a preferred embodiment of this application and is not intended to limit this application. Various modifications and variations can be made to this application by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this application should be included within the protection scope of this application.

Claims

1. The application of knocking out the wheat TaSmD3 gene in any of the following (1)-(3): (1) reducing wheat plant height; (2) regulating the lodging resistance trait of wheat; (3) breeding dwarf wheat varieties; the wheat TaSmD3 gene includes the TaSmD3-A gene, the TaSmD3-B gene and the TaSmD3-U gene, the nucleotide sequence of the TaSmD3-A gene is shown in SEQ ID No.1, the nucleotide sequence of the TaSmD3-B gene is shown in SEQ ID No.2, and the nucleotide sequence of the TaSmD3-U gene is shown in SEQ ID No.3; the knockout of the wheat TaSmD3 gene is a single mutation of the TaSmD3-A gene, the TaSmD3-B gene or the TaSmD3-U gene, or a double mutation of the TaSmD3-A gene and the TaSmD3-U gene.

2. The application of a recombinant expression vector or genetically engineered bacteria containing the knockout wheat TaSmD3 gene in any of the following (1)-(3): (1) reducing wheat plant height; (2) regulating wheat lodging resistance; (3) breeding dwarf wheat varieties; wherein the recombinant expression vector is a CRISPR / Cas9 editing vector carrying the knockout wheat TaSmD3 gene; wherein the wheat TaSmD3 gene includes the TaSmD3-A gene, the TaSmD3-B gene and the TaSmD3-U gene, the nucleotide sequence of the TaSmD3-A gene is shown in SEQ ID No.1, the nucleotide sequence of the TaSmD3-B gene is shown in SEQ ID No.2, and the nucleotide sequence of the TaSmD3-U gene is shown in SEQ ID No.3; knocking out the wheat TaSmD3 gene is by single mutation of the TaSmD3-A gene, the TaSmD3-B gene or the TaSmD3-U gene, or by double mutation of the TaSmD3-A gene and the TaSmD3-U gene.

3. A method for improving the lodging resistance of wheat, characterized in that, Includes the following steps: Mutation of the TaSmD3 gene in the wheat genome yielded wheat mutant lines with reduced plant height and increased lodging resistance. The TaSmD3 gene includes the TaSmD3-A gene, the TaSmD3-B gene, and the TaSmD3-U gene. The nucleotide sequence of the TaSmD3-A gene is shown in SEQ ID No. 1, the nucleotide sequence of the TaSmD3-B gene is shown in SEQ ID No. 2, and the nucleotide sequence of the TaSmD3-U gene is shown in SEQ ID No.

3. Mutation treatment of the TaSmD3 gene in the wheat genome involves a single mutation of the TaSmD3-A gene, the TaSmD3-B gene, or the TaSmD3-U gene, or a double mutation of the TaSmD3-A gene and the TaSmD3-U gene.

4. The method according to claim 3, characterized in that, The method for mutating the TaSmD3 gene in the wheat genome is as follows: two fragments on the TaSmD3 genome are selected as target sequences to construct a CRISPR / Cas9 knockout vector, which is then introduced into Agrobacterium and transformed into wheat embryos using Agrobacterium-mediated transformation.

Citation Information

Patent Citations

  • Nucleic acid molecules and other molecules associated with plants and uses thereof for plant improvement

    US20070044171A1