Endonuclease Gs12-7MAX Variant and Gene Editing System Mediated Thereby

Abstract

The present invention discloses a Gs12-7 endonuclease variant and a gene editing system mediated thereby. Specifically, by means of a rational mutation strategy, two Gs12-7 mutants were constructed and compared, and it was found that after the 157th amino acid of the Gs12-7 endonuclease was mutated from Glu to Arg, the activity of this gene editing enzyme could be significantly improved, and this variant was designated as Gs12-7MAX. The present invention provides an efficient gene editing technology mediated by the CRISPR-Gs12-7MAX system, which has broad application prospects in the field of genome site-directed modification.

Description

Technical Field

[0001] The present invention belongs to the technical field of genome editing, and particularly relates to a variant of the endonuclease Gs12-7MAX and a gene editing system mediated thereby. Background Art

[0002] The CRISPR / Cas system is widely used for site-directed modification of genomes, epigenetics, base, and prime editing in human cells, animals, and plants. The commonly used editing system is CRISPR / Cas9 from Streptococcus pyogenes. In addition, Cas12a endonucleases, including AsCas12a from Acidaminococcus sp. and LbCas12a from Lachnospiraceae bacterium ND2006, etc., are also often used for genome editing. The advantages of Cas12a endonucleases are as follows: First, it recognizes PAM target sites rich in T, expanding the genome editing targeting space; only a single short ~40-nucleotide (nt) CRISPR RNA (crRNA) is required to specifically edit the target; it has RNase activity and can achieve multiplex targeting editing through poly-crRNA transcript processing; in addition, studies have shown that Cas12a is more specific than SpCas9 and has a lower off-target effect.

[0003] Although Cas12a nucleases have shown various advantages, they are currently still limited by low editing efficiency. Therefore, there is an urgent need to develop efficient technologies for site-directed genome modification based on Cas12a. Based on this, on the basis of the Gs12-7 endonuclease (CN116144631A) identified by bioinformatics and experiments in the early stage of the present invention, its mutants were further modified, and the Gs12-7MAX variant and the technology for site-directed genome modification mediated thereby were developed. Summary of the Invention

[0004] The present invention for the first time developed a Gs12-7MAX variant, which has higher gene editing activity compared with the wild-type Gs12-7 after mutating the 157th amino acid of the Gs12-7 endonuclease from Glu to Arg. The present invention also established an efficient technology for site-directed genome modification mediated by the CRISPR-Gs12-7MAX system.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A variant of the endonuclease Gs12-7MAX, comprising the following protein:

[0007] I. The Gs12-7MAX protein with the amino acid sequence shown in SEQ ID NO.1 has a mutation at the 157th amino acid from Glu to Arg compared to the wild-type Gs12-7 endonuclease.

[0008] II. A protein having one or more amino acid substitutions, deletions or additions compared to the amino acid sequence shown in SEQ ID NO.1, and substantially retaining the biological function of its derived sequence.

[0009] A fusion protein comprising the above endonuclease and a polypeptide linked to the N-terminus or C-terminus of the protein.

[0010] A polynucleotide which is a polynucleotide encoding the above endonuclease or a polynucleotide encoding the above fusion protein. A vector or host cell containing the polynucleotide.

[0011] The application of the above endonuclease in gene editing, including modifying genes, knocking out genes, altering the expression of gene products, repairing mutations or inserting polynucleotides in prokaryotic genomes, eukaryotic genomes or in vitro genes.

[0012] The CRISPR / Gs12-7MAX gene editing system, including the above endonuclease, or fusion protein, or polynucleotide, or vector, or host cell. Further, it also includes a direct repeat sequence capable of binding to the above endonuclease and a guide sequence crRNA capable of targeting a target sequence.

[0013] The technical solution of the present invention has the following main beneficial effects:

[0014] 1. The present invention provides for the first time a Gs12-7MAX variant with high gene editing activity, having a mutation at the 157th amino acid from Glu to Arg compared to wild-type Gs12-7.

[0015] 2. The present invention has developed an efficient gene editing technology mediated by the CRISPR / Gs12-7MAX system, which has broad application prospects in the field of genome site-directed modification. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 . Comparing the genome editing activities of Gs12-7 and enAsCas12a-HF1 based on a high-throughput sequencing strategy; A. Comparing the gene editing activities of Gs12-7 and enAsCas12a-HF1 for a single site through an RNP delivery strategy; B. Analyzing and statistically comparing the gene editing activities of Gs12-7 and enAsCas12a-HF1 based on a plasmid delivery strategy.

[0017] Figure 2.Evaluating the gene editing activities of two Gs12-7 variants at a single site based on high-throughput sequencing strategies. They are: Gs12-7E157R (the 157th amino acid is mutated from Glu to Arg), Gs12-7EGK (the 157th amino acid is mutated from Glu to Arg, the 516th amino acid is mutated from Gly to Arg, and the 522nd amino acid is mutated from Lys to Val); A. Schematic diagram of the amino acid mutation sites of the two Gs12-7 variants; B. Comparing the gene editing activities of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF1 at a single site; C. Statistical analysis and comparison of the gene editing activities of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF1.

[0018] Figure 3 .Comparing the gene editing activities of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF1 for simultaneous editing of multiple different sites based on high-throughput sequencing strategies; A. Comparing the gene editing activities of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF1 for simultaneous editing of multiple different sites; B. Statistical analysis and comparison of the gene editing activities of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF1 for simultaneous editing of multiple sites.

[0019] Figure 4 .Detecting the distribution of gene editing Indels of Gs12-7E157R, Gs12-7EGK and enAsCas12a-HF11 based on high-throughput sequencing strategies; A. Distribution of gene editing Indels of Gs12-7E157R in HEK293T cells; B. Distribution of gene editing Indels of Gs12-7EGK in HEK293T cells; C. Distribution of gene editing Indels of enAsCas12a-HF1 in HEK293T cells.

[0020] Figure 5 .Evaluating the specificity of Gs12-7E157R and enAsCas12a-HF1 based on high-throughput sequencing strategies; A. Experimentally detecting the predicted off-target sites of Gs12-7E157R and enAsCas12a-HF1; B. Statistical analysis and comparison of the actual occurrence of Gs12-7E157R and enAsCas12a-HF1 at the predicted off-target sites. Detailed implementation methods

[0021] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer.

[0022] Example 1. Evaluation of the genomic editing activities of the endonuclease Gs12-7 and enAsCas12a-HF1

[0023] In this example, the endonuclease Gs12-7 (CN116144631A) developed by the inventors in the early stage was compared and evaluated for its activity with the currently known enAsCas12a-HF1 endonuclease with relatively high activity. The expression vectors of these two endonucleases were co-transfected into HEK 293T cells with the corresponding crRNA expression vectors, respectively. The crRNA paired with the target nucleic acid was used to guide the Gs12-7 or enAsCas12a nuclease to recognize and bind to the target gene, thereby activating the genomic cleavage activity. First, the cells were collected and genomic DNA was extracted, and then high-throughput sequencing was performed. Subsequently, the CRISPResso2 software (https: / / github.com / pinellolab / CRISPResso2 / releases) was used to analyze the genomic editing activity of the target site.

[0024] The target genes selected in this example were the human DNMT1, EMX1, FANCF, and RUNX1 genes. The PAM recognized by the crRNA was TTTV, and the corresponding crRNA sequences are shown in Table 1. The underlined regions are the target pairing regions. They were respectively constructed into the eukaryotic expression vector of crRNA.

[0025] Table 1. Names and corresponding sequences of crRNAs

[0026] crRNA Sequence (5’-3’) DNMT1-1 AAUUUCUACUAUUGUAGAUUCUGAUGGUCCAUGUCUGUUA EMX1-1 AAUUUCUACUAUUGUAGAUUGGGAGGCCUGGAGUCAUGGC EMX1-2 AAUUUCUACUAUUGUAGAUUUUAUUCCCAUAGGGAAGGGG FANCF-1 AAUUUCUACUAUUGUAGAUUAGUUGCCCAGAGUCAAGGAA RUNX1-1 AAUUUCUACUAUUGUAGAUUGCUCCGAAGGUAAAAGAAAU

[0027] First, through the RNP delivery strategy, the activities of Gs12-7 and the known enAsCas12a-HF1 endonuclease were compared. When the confluence of HEK 293T cells reached 70-80%, the cells were plated. The number of cells seeded in each well of a 12-well plate was 8×10 4 cells / well. After plating for 6-8 h, transfection was carried out. After incubating 1.25 μg of Gs12-7-NLS-tagged or enAsCas12a-HF1 protein with 625 ng of crRNA, the RNP complexes of Gs12-7 or enAsCas12a-HF1 were formed, and they were respectively mixed with 50 μL of opti-MEM and 2.6 μL of Cas9 plus TMMix the reagents to form Solution 1; add 3 μL of CRISPR to 50 μL of opti-MEM and mix well to form Solution 2. Add Solution 2 to Solution 1 and mix thoroughly, then incubate at room temperature for 10 min. Add the incubated mixture to the cell-containing medium for transfection. After culturing at 37 °C for 72 h, discard the medium, resuspend the cells with 100 μL of PBS, and extract the genomic DNA of the cells. Perform PCR amplification on the target sites of the transfected positive cells. Observe the changes in the cleavage target bands through T7EN1 digestion reaction and agarose gel electrophoresis to judge the genomic editing activities of Gs12-7 and enAsCas12a-HF1 endonuclease. Further calculate its gene editing efficiency through Image J. The template for the negative control is the genomic DNA of wild-type HEK 293T cells without any treatment. TM Mix the reagents to form Solution 2. Add Solution 2 to Solution 1 and mix thoroughly, then incubate at room temperature for 10 min. Add the incubated mixture to the cell-containing medium for transfection. After culturing at 37 °C for 72 h, discard the medium, resuspend the cells with 100 μL of PBS, and extract the genomic DNA of the cells. Perform PCR amplification on the target sites of the transfected positive cells. Observe the changes in the cleavage target bands through T7EN1 digestion reaction and agarose gel electrophoresis to judge the genomic editing activities of Gs12-7 and enAsCas12a-HF1 endonuclease. Further calculate its gene editing efficiency through Image J. The template for the negative control is the genomic DNA of wild-type HEK 293T cells without any treatment.

[0028] Secondly, plate the cells when the confluence of HEK 293T cells reaches 70 - 80%, and inoculate 8×10 4 cells / well in a 12-well plate. Transfect the cells 6 - 8 h after plating. Add 1 μg of the eukaryotic expression vector plenti-Gs12-7-puro of Gs12-7 or the eukaryotic expression vector plenti-enAsCas12a-HF1-puro of enAsCas12a-HF1, 500 ng of different crRNA expression vectors plenti-U6-crRNA-zsGreen, and 10 μL of Jetprime regent to 200 μL of Jetprime Buffer in sequence, pipette and mix well, and incubate at room temperature for 10 min. Add the incubated mixture to the cell-containing medium for transfection. After culturing at 37 °C for 72 h, discard the medium, resuspend the cells with 100 μL of PBS, and extract the genomic DNA of the cells. Perform PCR amplification on the sequences near the edited target sites of the transfected positive cells. Recover the PCR products and perform amplicon sequencing through Illumina Novaseq PE150, and analyze the editing activity through CRISPResso2.

[0029] The results are as Figure 1As shown in A, in the experiment of delivering cell genome editing using RNP, it was found that both Gs12-7 and enAsCas12a-HF1 nucleases had relatively high editing activities. Without enriching positive gene-edited cells, the gene editing activity of Gs12-7 was about 30%. However, relatively speaking, the editing activity of Gs12-7 nuclease was lower than that of enAsCas12a-HF1. In the experiment of delivering cell genome editing using plasmids, it was found by comparison that the average gene editing efficiency of Gs12-7 was 17.83%, while that of enAsCas12a-HF1 was 21.32%. It was found that the average gene editing efficiency of wild-type Gs12-7 at multiple sites was still significantly lower than that of enAsCas12a-HF1 nuclease( Figure 1 B). In view of this, the present invention further carried out mutagenesis modification on the amino acid sequence of Gs12-7 endonuclease in order to improve its genome editing activity.

[0030] Example 2. Comparison of genome editing activities of different variants of Gs12-7 and enAsCas12a-HF1 in HEK293T cells

[0031] In this example, two variants of Gs12-7 were prepared( Figure 2 A): (1) Variant Gs12-7E157R, in which the 157th amino acid was mutated from Glu to Arg, and the amino acid sequence was as shown in SEQ ID NO: 1; (2) Gs12-7EGK, in which the 157th amino acid was mutated from Glu to Arg, the 516th amino acid was mutated from Gly to Arg, and the 522nd amino acid was mutated from Lys to Val, and the amino acid sequence was as shown in SEQ ID NO: 3. Their genome editing abilities at the cell level were respectively evaluated with the known enAsCas12a-HF1 endonuclease.

[0032] In this example, the expression vectors with human codon-optimized Gs12-7E157R (nucleotide sequence shown in SEQ ID NO: 2), plenti-Gs12-7E157R-puro, the expression vector with human codon-optimized Gs12-7EGK, plenti-Gs12-7EGK-puro (nucleotide sequence shown in SEQ ID NO: 4), and the enAsCas12a-HF1 expression vector were co-transfected into HEK 293T cells respectively with the corresponding different crRNA expression vectors, plenti-U6-crRNA-zsGreen. The crRNAs paired with the target nucleic acids were used to guide the Gs12-7E157R, Gs12-7EGK, and enAsCas12a-HF1 proteins to recognize and bind to the target nucleic acids respectively, thereby activating the genomic cleavage activity. Finally, the cells were collected and genomic DNA was extracted, and the editing activity at the target site was analyzed by high-throughput sequencing and using CRISPResso2.

[0033] In this example, the target nucleic acids were selected as the human EMX1, FANCF, and RUNX1 genes, the PAM was TTTV, and the design of the corresponding crRNAs is shown in Table 2. The underlined region is the targeting region.

[0034] Table 2. Names and corresponding sequences of crRNAs

[0035] crRNA Sequence (5’-3’) EMX1-3 AAUUUCUACUAUUGUAGAUUUCAUCUGUGCCCCUCCCUCC EMX1-4 AAUUUCUACUAUUGUAGAUUUGGUUGCCCACCCUAGUCAU FANCF-2 AAUUUCUACUAUUGUAGAUUGGCGGGGUCCAGUUCCGGGA RUNX1-2 AAUUUCUACUAUUGUAGAUUAGCCUCACCCCUCUAGCCCU

[0036] When the confluence of HEK 293T cells reached 70 - 80%, they were plated, and the number of cells seeded in each well of a 12-well plate was 8×10 4 cells / well. Transfection was carried out 6 - 8 h after plating. To 200 μL of Jetprime Buffer, 1 μg of Gs12-7E157R, Gs12-7EGK, or the known eukaryotic expression vector enhancing enAsCas12a-HF1, 500 ng of a single crRNA expression vector, and 10 μL of Jetprime reagent were added and pipetted and mixed well, and then incubated at room temperature for 10 min. The incubated mixture was added to the medium with the plated cells for transfection. After culturing at 37°C for 72 h, the medium was discarded, and the cells were resuspended with 100 μL of PBS and the genomic DNA of the cells was extracted. The sequences near the editing of the target sites of the transfected positive cells were amplified by PCR. The PCR products were recovered and amplified by Illumina Novaseq PE150 for amplicon sequencing, and the editing activity was analyzed by CRISPResso2.

[0037] The results are as Figure 2As shown, both Gs12-7E157R and Gs12-7EGK have genome editing activities. Without enrichment of positive gene-edited cells, the editing activity of Gs12-7E157R can reach up to about 42%, while the gene editing activity of Gs12-7EGK is relatively low, only about 28%( Figure 2 B). Further detection found that for different editing sites, the gene editing activity of Gs12-7E157R is higher than that of enAsCas12a-HF1( Figure 2 B). Statistical analysis found that the average editing efficiency of the Gs12-7E157R variant can reach about 30%, which is significantly higher than that of the currently known enhanced enAsCas12a-HF1( Figure 2 C). Comparatively, it was found that the genome editing activity of the Gs12-7E157R variant is relatively the highest, so it was named Gs12-7MAX.

[0038] Example 3. Comparing the gene editing activities of Gs12-7MAX, Gs12-7EGK, and enAsCas12a-HF1 for simultaneous cleavage of multiple sites

[0039] In this example, the activities of Gs12-7MAX, Gs12-7EGK, and enAsCas12a-HF1 for simultaneous editing of multiple different genomic sites in cells were evaluated. Gs12-7MAX, Gs12-7EGK, and enAsCas12a-HF1 were co-transfected with eukaryotic expression vectors of crRNAs that can simultaneously target 3 or 2 genes, respectively. The crRNAs paired with the target nucleic acids were used to guide the Gs12-7MAX, Gs12-7EGK, and enAsCas12a-HF1 proteins to recognize and bind to the target nucleic acids, thereby activating the genome cleavage activity. Finally, HEK 293T cells were collected and genomic DNA was extracted, and the editing activities at the target positions were analyzed by high-throughput sequencing and using CRISPResso2.

[0040] In this example, the target nucleic acids were selected as human DNMT1, FANCF, RUNX1 genes, and EMX1, and the PAM of the target recognition sites was selected as TTTV. crRNA expression vectors that can simultaneously target three genes were designed: DNMT1-DFR-D, FANCF-DFR-F2, RUNX1-DFR-R2, and crRNA expression vectors that can simultaneously target two genes: EMX1-EE-E1 and EMX1-EE-E2. The corresponding crRNA sequences are shown in Table 3, and the underlined regions are the targeting regions. They were respectively constructed into eukaryotic expression vectors of crRNAs.

[0041] Table 3. Names and corresponding sequences of crRNAs

[0042] crRNA Sequence (5’-3’) DFR-D AAUUUCUACUAUUGUAGAUUCUGAUGGUCCAUGUCUGUUA DFR-F2 AAUUUCUACUAUUGUAGAUUGGCGGGGUCCAGUUCCGGGA DFR-R2 AAUUUCUACUAUUGUAGAUUGCUCCGAAGGUAAAAGAAAU EE-E1 AAUUUCUACUAUUGUAGAUUUCAUCUGUGCCCCUCCCUCC EE-E2 AAUUUCUACUAUUGUAGAUUUACUUUGUCCUCCGGUUCUG

[0043] Plate when the confluence of HEK 293T cells reaches 70 - 80%, and the number of cells seeded in a 12-well plate is 8×10 4 cells / well. Transfect 6 - 8 h after plating. Add 1 μg of the Gs12-7MAX expression plasmid plenti-Gs12-7MAX-puro, the Gs12-7EGK expression plasmid plenti-Gs12-7EGK-puro eukaryotic expression vector, or the known enhanced enAsCas12a-HF1 expression plasmid plenti-enAsCas12a-HF1-puro to 200 μL of Jetprime Buffer in sequence, and 500 ng of the crRNA tandem expression vector plenti-U6-DFR-D-DFR-F2-DFR-R2-zsGreen or plenti-U6-EE-E1-EE-E2-zsGreen that can target two or three genes simultaneously, as Figure 3 shown in A. Pipette and mix well with 10 μL of Jetprime regent, and incubate at room temperature for 10 min. Add the incubated mixture to the medium with plated cells for transfection. After culturing at 37 °C for 72 h, discard the medium, resuspend the cells with 100 μL of PBS, and extract the genomic DNA of the cells. Perform PCR amplification on the sequences near the target sites of transfected positive cells. Recover the PCR products and perform amplicon sequencing through Illumina Novaseq PE150, and analyze the editing activity through CRISPResso2.

[0044] The results are as Figure 3 shown, and it is found that both the Gs12-7MAX and Gs12-7EGK nucleases have genomic editing activity whether editing two or three sites simultaneously. Without enrichment of gene-edited positive cells, the gene editing activity of Gs12-7MAX reaches up to about 35%, while that of Gs12-7EGK is only 28% ( Figure 3 A). For the average gene editing activity, the activity of Gs12-7MAX is significantly higher than that of enAsCas12a-HF1 and Gs12-7EGK, and the activity for simultaneously editing multiple genes can reach about 20% ( Figure 3 B). Therefore, the CRISPR-Gs12-7MAX system has significantly high gene editing activity.

[0045] Example 4. Detect the Indel distribution characteristics after site-directed cleavage of Gs12-7MAX at the target site

[0046] In this example, high-throughput sequencing and CRISPResso2 software were used to detect the Indel distribution characteristics after the targeted cleavage of Gs12-7MAX, Gs12-7EGK, and enAsCas12a-HF1 at the target sites. In this example, the target nucleic acid was selected as the gene locus of Examples 2 and 3, and the corresponding crRNAs are shown in Tables 2 and 3. The PCR products of the above two examples were amplified by Illumina Novaseq PE150 for amplicon sequencing, and the sequencing data was analyzed by CRISPResso2 to further evaluate the distribution and size characteristics of Indels.

[0047] The results are as Figure 4 shown. After statistically analyzing the sequencing results of all target sites obtained in Examples 2 and 3, further evaluation found that the gene editing Indel distribution types of Gs12-7MAX, Gs12-7EGK, and enAsCas12a were basically the same ( Figure 4 left graphs of A, B, C), and most were mainly small fragment deletions (about 96%), and a small number of gene editing sites had small fragment insertions (about 4%). And the results showed that after the CRISPR-Gs12-7MAX technology edited the target sites, it was mainly base deletions within 20 bp in size, and only a small part was base insertions within 10 bp in size ( Figure 4 right graphs of A, B, C).

[0048] Example 5. Evaluation of the gene editing specificity of Gs12-7MAX and enAsCas12a-HF1

[0049] In this example, crRNAs were designed for the site-directed editing of Gs12-7MAX and enAsCas12a-HF1 in Examples 2 and 3 above, such as 6 crRNAs including EMX1-2, EMX1-3, EMX1-4, FANCF-2, RUNX1-2, and DNMT1. Using the CRISPR-offinder software, 3 off-target sites were predicted for each crRNA as shown in Table 4, with a total of 18 off-target sites including Offsite1-EMX1-2, Offsite2-EMX1-2, Offsite2-EMX1-3, Offsite1-EMX1-3, Offsite2-EMX1-3, etc. The lowercase letter bases marked in the sequences of Table 4 were the predicted off-target mismatch sites. After transfection of HEK 293T cells, PCR amplification and library construction sequencing were performed on the predicted off-target sites, and the CRISPResso2 software was used to analyze the cleavage efficiency, thereby evaluating the genome cleavage specificity of Gs12-7MAX and enAsCas12a-HF1.

[0050] In this example, plating was performed when the confluence of HEK 293T cells reached 70 - 80%, and the number of cells seeded in each well of a 12 - well plate was 8×10 4 cells / well. Transfection was carried out 6 - 8 h after plating. To 200 μL of Jetprime Buffer, 1 μg of the Gs12 - 7MAX expression plasmid plenti - Gs12 - 7MAX - puro or the known enhanced enAsCas12a - HF1 expression plasmid plenti - enAsCas12a - HF1 - puro, 500 ng of the above - mentioned different crRNA expression vectors plenti - U6 - crRNA - zsGreen, and 10 μL of Jetprime reagent were added in sequence, and then pipetted and mixed well, followed by incubation at room temperature for 10 min. The incubated mixture was added to the medium with plated cells for transfection. After culturing at 37°C for 72 h, the medium was discarded, and the cells were resuspended with 100 μL of PBS and the genomic DNA of the cells was extracted. PCR amplification primers targeting the predicted off - target sites were designed as shown in Table 4, and the genomic regions of the candidate predicted off - target sites were amplified separately using PCR technology. The PCR products were recovered and amplicon sequencing was performed using Illumina Novaseq PE150, and the cleavage and editing activities were analyzed using CRISPResso2 software.

[0051] Table 4. Predicted candidate off - target sites and corresponding PCR amplification primer sequences

[0052]

[0053]

[0054]

[0055] The results are as Figure 5 shown. Using high - throughput sequencing, it was found that for the predicted candidate off - target sites, almost no off - target activity was detected for Gs12 - 7MAX and enAsCas12a - HF1 ( Figure 5 A). Further comparative analysis showed that no off - target efficiency was detected at multiple predicted off - target sites, and the highest off - target efficiency was less than 1% ( Figure 5 B). Generally speaking, it was found that the Gs12 - 7MAX variant had a low off - target efficiency and was as highly specific as the enhanced and high - fidelity enAsCas12a - HF1 ( Figure 5 B). Therefore, the Gs12 - 7MAX variant can be used as an efficient gene editing tool.

[0056] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments of equivalent changes by using the technical content prompted above within the scope of the technical solution of the present invention. However, as long as it does not depart from the content of the technical solution of the present invention, any simple modification, equivalent change and modification made to the above embodiments according to the technical essence of the present invention still fall within the scope of the present invention's solution.

Claims

1. An endonuclease variant in the CRISPR / Gs12-7 system, characterized in that, The endonuclease variant is the Gs12-7MAX protein with the amino acid sequence shown in SEQ ID NO.

1. Compared with the wild-type Gs12-7 endonuclease, the amino acid at position 157 is mutated from Glu to Arg.

2. A fusion protein, characterized in that, Comprising the protein described in claim 1 and other modified parts.

3. A polynucleotide, characterized in that, The polynucleotide is a polynucleotide encoding the endonuclease variant described in claim 1, or a polynucleotide encoding the fusion protein described in claim 2.

4. Carrier, characterized in that, The vector comprises the polynucleotide described in claim 3.

5. A host cell, characterized in that, The host cell comprises the polynucleotide described in claim 3 or the vector described in claim 4.

6. Use of the endonuclease variant described in claim 1, or the fusion protein described in claim 2, or the polynucleotide described in claim 3, or the vector described in claim 4, or the host cell described in claim 5 in gene editing.

7. A CRISPR / Gs12-7MAX gene editing system, characterized in that, Including the endonuclease described in claim 1, or the fusion protein described in claim 2, or the polynucleotide described in claim 3, or the vector described in claim 4, or the host cell described in claim 5.

Images