Agarase agaCA233, mutants thereof and uses thereof

Abstract

The application provides an agarase AgaCA233, a mutant thereof and application. The application mines a beta-agarase of a GH16 family, named AgaCA233, from Catenovulum agarivorans DS-2 genome information through bioinformatics technology, the enzyme has high catalytic activity and thermal stability, and can be efficiently applied to the production of industrialized preparation of agar oligosaccharide. On the other hand, the gene engineering technology is used to the truncation mutation of the above agarase AgaCA233. The thermal stability and catalytic activity of the agarase AgaCA233 mutant of the application are greatly improved compared with the wild type AgaCA233, and the agarase is one of the most stable GH16 family agarases at present, and can be applied to the enzymatic industrial production of agar oligosaccharide, so as to greatly reduce the production cost of agar oligosaccharide.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of microbial enzymes, and particularly relates to agarase AgaCA233, mutants thereof and application. BACKGROUND

[0002] Agar has high gel strength and hydrophilicity, can absorb water and swell, has special stability and compatibility, and is widely used as a thickening agent, emulsifier, gelling agent, stabilizer, excipient, water retention agent and other additives. High-polymerization-degree agar macromolecules can be degraded into low-polymerization-degree agar oligosaccharides under the action of agarase. Agar oligosaccharides are a kind of functional oligosaccharides, can be used as prebiotic substances, increase the relative abundance of probiotics such as Lactobacillus and Bifidobacterium in the intestinal flora of animals, thereby promoting the growth of animals and improving the immunity of animals, in addition, agar oligosaccharides also have various biological activities such as inhibiting the growth of pathogenic bacteria, inhibiting the growth of colon cancer cells, reducing fasting blood glucose level, antioxidant, anti-aging, repairing liver damage and the like. Therefore, it is of great significance and economic value to develop high-value agar oligosaccharides from agar.

[0003] To realize large-scale industrial utilization of agar oligosaccharides, there is an urgent need for a high-efficiency, low-cost and green degradation method. At present, the commonly used degradation methods of agarose include chemical degradation method, physical degradation method and biological degradation method. Chemical degradation method, as a traditional means for the preparation of oligosaccharides industry, covers various methods such as alkaline hydrolysis, acid hydrolysis, oxidative degradation and combined degradation. Among them, although acid hydrolysis has low cost and simple operation, it can only realize the preliminary degradation of agarose under normal pressure, and generates a large amount of by-products, increasing the difficulty of extraction and separation, and easily causing environmental pollution and irreversible damage to the active groups of polysaccharides. Physical degradation methods such as radiation method, ultrasonic method and pyrolysis method are concerned due to their simple operation, fast degradation speed and high preparation rate. However, this kind of method can only change the size of polysaccharide molecules, but not the structure, so the specificity, specificity and stability are poor. Enzymatic hydrolysis is more mild and environmentally friendly, and the use of enzymatic hydrolysis in the industrial production process of oligosaccharides can improve production efficiency, simplify production process, increase product activity and recovery rate, etc. Agarase, as an enzyme that can catalyze the degradation of agarose, belongs to five different glycoside hydrolase families GH16, GH50, GH86, GH117 and GH118, and plays a key role in the green biodegradation of agarose according to the type of glycosidic bond of agarose it cleaves.

[0004] At present, the GH16 family of agarases is one of the most widely studied enzymes, and the members of the family are numerous, but the thermal stability shows significant differences. In the GH16 family, the optimum temperature of most agarases is about 40-50℃. On the other hand, studies have shown that the catalytic efficiency of agarase in liquid agarose solution is significantly better than that in gel state, which may be related to the fact that the molecules move more freely in liquid, and the specific surface area of the gel state is smaller. However, agarose solution needs to be at a high temperature (≥50℃) to present a flow state, which makes the thermal stability of agarase a key factor affecting the degradation efficiency of agarose. Therefore, it is urgent to solve the core problem of mining and modifying high-temperature-resistant agarases, which is the key to high-value utilization of agar and obtaining agar oligosaccharides with high purity and specific polymerization degree. SUMMARY

[0005] In view of the deficiencies of the prior art, the purpose of the present application is to provide an agarase with good thermal stability, mutants thereof and applications.

[0006] In a first aspect of the present application, an agarase AgaCA233 is provided.

[0007] In another preferred embodiment, the amino acid sequence of the agarase is an amino acid sequence having 95% or more homology, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology with the amino acid sequence shown in SEQ ID NO. 1, and has the ability to catalyze agarose decomposition.

[0008] In another preferred embodiment, the amino acid sequence of the agarase is as shown in SEQ ID NO. 1.

[0009] In a second aspect of the present application, a biological material related to the agarase of the first aspect of the present application is provided, which comprises at least one of the following 1)-5):

[0010] 1) the coding gene of the agarase of the first aspect of the present application;

[0011] 2) an expression cassette containing the coding gene of 1);

[0012] 3) a recombinant vector containing the coding gene of 1);

[0013] 4) a recombinant microorganism containing the coding gene of 1);

[0014] 5) a recombinant microorganism containing the recombinant vector of 3).

[0015] Further preferably, in the 1), the nucleotide sequence encoding the gene is a nucleotide sequence having 95% or more homology, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology with the nucleotide sequence shown in SEQ ID NO. 2.

[0016] Further preferably, in the 1), the nucleotide sequence encoding the gene is shown in SEQ ID NO. 2.

[0017] Further preferably, in the 3), the recombinant vector is a pET-28a(+) vector as the expression vector.

[0018] Further preferably, in the 4) or 5), the recombinant microorganism is a recombinant E. coli BL21(DE3).

[0019] In a third aspect of the present application, the agarase of the first aspect of the present application is provided for use in the decomposition of agar or agarose and the production of agaro-oligosaccharides.

[0020] In a fourth aspect of the present application, a mutant of the agarase of the first aspect of the present application is provided, which has higher catalytic activity and higher thermal stability compared with the wild type.

[0021] In another preferred embodiment, the mutant of the agarase has an amino acid sequence having 95% or more homology, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology with the amino acid sequence shown in SEQ ID NO. 3, and has higher catalytic activity and higher thermal stability compared with the wild type.

[0022] In another preferred embodiment, the mutant of the agarase has an amino acid sequence shown in SEQ ID NO. 3.

[0023] In a fifth aspect of the present application, a biological material related to the mutant of the agarase of the fourth aspect of the present application is provided, which comprises at least one of the following 1) to 5):

[0024] 1) a gene encoding the mutant of the agarase of the fourth aspect of the present application;

[0025] 2) an expression cassette containing the gene encoding 1);

[0026] 3) a recombinant vector containing the gene encoding 1);

[0027] 4) a recombinant microorganism containing the gene encoding 1);

[0028] 5) a recombinant microorganism containing the recombinant vector of 3).

[0029] Further preferably, in the 1), the nucleotide sequence encoding the gene is a nucleotide sequence having 95% or more homology, preferably 96% homology, more preferably 97%, 98%, 99% or 100% homology with the nucleotide sequence shown in SEQ ID NO. 4.

[0030] Further preferably, in the 1), the nucleotide sequence encoding the gene is shown in SEQ ID NO. 4.

[0031] Further preferably, in the 3), the recombinant vector takes pET-28a(+) vector as the expression vector.

[0032] Further preferably, in the 4) or 5), the recombinant microorganism is recombinant E. coli BL21(DE3).

[0033] In the sixth aspect of the present application, the mutant of the agarase provided in the fourth aspect of the present application is used in agar or agarose decomposition and agar oligosaccharide production.

[0034] It should be understood that, within the scope of the present application, each of the technical features of the present application described above and each of the technical features specifically described in the following (such as the examples) can be combined with each other to form a new or preferred technical solution. Due to the limited space, they will not be listed one by one here.

[0035] Compared with the prior art, the present application has the following advantages and progress:

[0036] The present application mines a GH16 family β-agarase, named AgaCA233, from the genomic information of Catenovulum agarivorans DS-2 through bioinformatics technology. The enzyme has high catalytic activity and thermal stability, and can be efficiently applied to the industrial production of agar oligosaccharide. In addition, the present application uses genetic engineering technology to truncate the agarase AgaCA233. By designing a pair of complementary sequence primers in opposite directions, using high-fidelity DNA polymerase for amplification, only part of the gene is amplified to construct a truncated recombinant DNA molecule, and finally a mutant of agarase AgaCA233 is constructed. The thermal stability and catalytic activity of the agarase AgaCA233 mutant of the present application are greatly improved compared with the wild type AgaCA233. It is one of the most stable GH16 family agarases at present, and is a new type of agarase with great potential. It can be applied to the industrial production of agar oligosaccharide by enzyme method, and thus greatly reduce the production cost of agar oligosaccharide. BRIEF DESCRIPTION OF DRAWINGS

[0037] The accompanying drawings, which form a part of this application, are included to provide a further understanding of the application and are incorporated in and constitute a part of this specification. The illustrations are given for the purpose of explaining the application and do not constitute any limitation on the present application.

[0038] Figure 1 : Electrophoresis map of recombinant plasmid. M: standard protein Marker; 1: recombinant plasmid of AgaCA233 mutant.

[0039] Figure 2 : SDS-PAGE analysis of AgaCA233 mutant and AgaCA233. (a) M: marker; 1: E. coli pET-28a(+) bacterial liquid protein; 2: AgaCA233 mutant crude enzyme; 3: AgaCA233 mutant pure enzyme. (b) M: marker; 1: E. coli pET-28a(+) bacterial liquid protein; 2: AgaCA233 crude enzyme; 3: AgaCA233 pure enzyme.

[0040] Figure 3 : Effect of temperature on relative activity of AgaCA233 and AgaCA233 mutant.

[0041] Figure 4 : Comparative analysis of specific enzyme activity of AgaCA233 mutant and AgaCA233.

[0042] Figure 5 : Comparative analysis of thermal stability of AgaCA233 and AgaCA233 mutant at 50℃ and 60℃. (a) 50℃. (b) 60℃. DETAILED DESCRIPTION

[0043] The present application provides an agarase AgaCA233, mutants thereof and uses thereof. The present application will be further described in the following examples, which are intended to facilitate further understanding of the present application by those skilled in the art. However, the examples described below are only a part of the embodiments of the present application, and should not be regarded as limiting the present application in any form. It should be noted that the adjustments and improvements made by those skilled in the art based on the concept of the present application should be regarded as within the scope of protection of the present application. The specific technical operation steps and operators in the examples are carried out according to the general technical conditions described in the literature of the art or the relevant product instructions.

[0044] Example 1 Construction of recombinant expression plasmid of agarase AgaCA233

[0045] From the Catenovulum agarivorans DS-2 genome information, a GH16 family of β-agarase was mined by bioinformatics technology, named AgaCA233. According to the gene sequence of agarase agaca233, NcoI and XhoI enzyme cutting sites were added at both ends, then synthesized by gene company according to the method of chemical total synthesis, then linked with double enzyme cutting linearized pET-28a(+) expression vector, to construct the recombinant expression plasmid pET-28a(+)-agaca233 of agarase AgaCA233, transformed into E. coli Top10, amplified, and the extracted plasmid was verified by sequencing to be completely correct.

[0046] Wild type agarase AgaCA233 amino acid sequence:

[0047] ADWDGVPIPAPAGQNKTWQILSISDDFNYAASPNNKPSAFTSRWNDSYINAWKGPGDTEFSSGHSYTNSGKLALQAAEKPGTDKVYAGIISSKQTFTYPLYIEARAKSTNNTMANAVWMLSADSTQELDAMEAYGSDRPGQEWFDRRMHVSHHVFIREPFQDYQPKDAGSWIYNNEEPWRVAYHNYGMHWKDPWNVDYYIDGVLVRSVSGQQMIDPHNYTNGTGVNKPLHIIIDMEHQDWRDVKPTPAELADPARSIFYVDWIRVYKPVDSSASAPTPPTSATSLKARHSNKCIDLAAGNSANGTNMQQWNCSATNTNQDITFVAKGGGYYEMKTKHNKCIDVAGKATANGANLVQWNCYNGTNQQFKLLDKGNGWFQLQAKHSGKCLEIANSATTNGANLQQWGCGNGNNQQWKFQ(SEQ ID NO. 1).

[0048] Wild type agarase agaca233 gene DNA sequence:

[0049]

[0050] Construction of recombinant expression plasmid of AgaCA233 mutant

[0051] Using primer F(-cbm) and R(-cbm), the mutant gene AgaCA233m was amplified by PCR with pET-28a(+)-agaca233 as template according to the following reaction system and reaction conditions.

[0052] Primer sequence for amplifying the mutant gene AgaCA233m of agarase AgaCA233:

[0053] F(-cbm): TTTAAGAAGGAGATATACCATGGGC;

[0054] R(-cbm):

[0055] TGGTGGTGGTGGTGGTGCTCGAGTTTATAAACACGGATCCAATCTACAT.

[0056] Table 1. PCR reaction system

[0057]

[0058] Table 2. PCR reaction process

[0059]

[0060]

[0061] The AgaCA233m fragment amplified by PCR was ligated with the plasmid pET-28a(+) linearized by double digestion (NcoI and XhoI) according to the ligation system in Table 3, and the target gene and the linearized vector were ligated, thereby obtaining the recombinant expression plasmid pET-28a(+)-AgaCA233m of AgaCA233 mutant.

[0062] Amino acid sequence of agarase AgaCA233 mutant:

[0063] ADWDGVPIPAPAGQNKTWQILSISDDFNYAASPNNKPSAFTSRWNDSYINAWKGPGDTEFSSGHSYTNSGKLALQAAEKPGTDKVYAGIISSKQTFTYPLYIEARAKSTNNTMANAVWMLSADSTQELDAMEAYGSDRPGQEWFDRRMHVSHHVFIREPFQDYQPKDAGSWIYNNEEPWRVAYHNYGMHWKDPWNVDYYIDGVLVRSVSGQQMIDPHNYTNGTGVNKPLHIIIDMEHQDWRDVKPTPAELADPARSIFYVDWIRVYK (SEQ ID NO. 3).

[0064] Agarase AgaCA233m mutant gene DNA sequence:

[0065] GCAGACTGGGATGGCGTACCTATTCCAGCACCAGCAGGTCAAAACAAAACTTGGCAAATTCTATCTATTTCAGATGACTTTAACTACGCAGCTTCACCAAATAACAAACCAAGCGCTTTTACTAGCCGTTGGAACGACAGCTACATTAATGCTTGGAAAGGGCCGGGCGATACAGAGTTTAGCTCAGGTCACTCGTACACCAATTCTGGTAAATTAGCTTTACAGGCGGCTGAAAAACCAGGCACAGACAAAGTTTACGCAGGTATTATTTCTTCAAAACAAACATTTACTTATCCGCTTTATATTGAAGCGCGGGCCAAATCAACCAACAATACTATGGCCAATGCGGTGTGGATGTTAAGTGCCGATTCCACCCAAGAATTAGATGCTATGGAAGCTTACGGGAGTGACAGACCAGGCCAAGAGTGGTTTGATCGCCGCATGCATGTGAGCCACCACGTATTTATTCGCGAACCATTCCAAGACTATCAACCAAAGGATGCAGGTTCTTGGATATACAATAATGAAGAGCCATGGCGCGTTGCTTATCATAACTATGGTATGCACTGGAAAGATCCTTGGAATGTTGATTATTATATTGACGGCGTGTTGGTTAGAAGTGTTTCAGGCCAGCAAATGATTGATCCACATAATTACACCAATGGCACTGGCGTGAATAAACCTTTGCACATTATTATTGATATGGAACATCAAGATTGGCGTGATGTTAAACCAACACCAGCCGAACTAGCCGATCCTGCCAGAAGCATTTTTTATGTAGATTGGATCCGTGTTTATAAA (SEQ ID NO. 4).

[0066] Table 3. Connection system of target gene and vector

[0067]

[0068] The connection product was detected using 1% agarose gel electrophoresis, and the results are shown in FIG. 2. Figure 1As shown, the results show that the target band is in the range of 5000-7500 bp, and the target band is about 6500 bp, which is consistent with the band. The recombinant expression plasmid containing the AgaCA233 mutant is obtained.

[0069] Example 3 Induced expression of agarase AgaCA233 and AgaCA233 mutant in E. coli

[0070] The plasmids pET-28a(+)-agaca233 and pET-28a(+)-AgaCA233m were transformed into competent cells of E. coli BL21(DE3) according to the following method to obtain AgaCA233 and AgaCA233 mutant engineering strains E. coli BL21(DE3) / pET-28a(+)-agaca233 and E. coli BL21(DE3) / pET-28a(+)-AgaCA233m. The specific steps are as follows:

[0071] (1) Take 5 μL of recombinant plasmid sample and add it to 50-100 μL of competent cells. Mix slowly and place on ice for 30 min.

[0072] (2) Perform 90s heat shock (42°C water bath), then quickly return to ice bath and wait for 3-5 min.

[0073] (3) Add 500 μL of LB liquid medium (without antibiotics), mix gently, and shake culture for 1 h (37°C).

[0074] (4) Centrifuge the bacterial solution (5000 rpm, 1 min) to precipitate the bacterial cells, and remove most of the supernatant (about 50-100 μL of bacterial cells are resuspended).

[0075] (5) Uniformly spread the bacterial solution on LB plates (containing Kana antibiotic) and incubate in a 37°C incubator overnight.

[0076] (6) Pick single colonies from the LB plate for culture. Take 50 μL of bacterial solution for testing to identify whether the recombinant strain is correct.

[0077] The successfully constructed genetically engineered strains E. coli BL21(DE3) / pET-28a(+)-agaca233 and E. coli BL21(DE3) / pET-28a(+)-AgaCA233m were inoculated into 5 mL of LB medium and cultured for 12 h (37°C, 220 rpm) as seed liquid. 200 μL of the seed liquid was inoculated into 200 mL of LB medium containing Kana and cultured for 2 h (37°C, 220 rpm) before 200 μL of IPTG (0.5 M) was added at a ratio of 1‰ and the culture was further cultured for 20-24 h (16°C, 220 rpm) to induce the expression of the target protein. The bacterial cells were collected and centrifuged to discard the supernatant. 15 mL of lysis buffer (Tris 20 mM, NaCl 20 mM, DTT 1 mM, imidazole 20 mM, pH 7.0) was added to the bacterial cells, which were placed in an ice-water mixture for ultrasonic disruption (power 260-300 W, total disruption time 30 min, working time 3 s, interval time 3 s). After ultrasonic disruption, the bacterial cells were centrifuged again (4°C, 8000 rpm) for 40 min, and the obtained supernatant was the crude enzyme solution. The crude enzyme solution was purified by using a nickel column His Trap TM HP-5 mL to obtain recombinant enzyme AgaCA233 and AgaCA233 mutant. The enzyme solution was mixed with 5x SDS loading buffer, boiled for 10 min, and then centrifuged at 12000 rpm for 10 min. The supernatant was subjected to SDS-PAGE protein electrophoresis using 5% concentrated gel and 12% separation gel.

[0078] The results are shown in Table 1. Figure 2 As shown in Table 1, compared with the control group of empty vector E. coli pET-28a(+), the genetically engineered strains E. coli BL21(DE3) / pET-28a(+)-agaca233 and E. coli BL21(DE3) / pET-28a(+)-AgaCA233m had excess protein bands in the supernatant after ultrasonic disruption, and the size of the overexpressed protein was about 50 kD and 30 kD, which was consistent with the expected size, indicating that the overexpression of the recombinant agarase AgaCA233 and AgaCA233 mutant in E. coli was successful and the expression was soluble.

[0079] Example 4 Catalytic activity and thermal stability of agarase AgaCA233 and AgaCA233 mutant

[0080] (1) Determination of the optimum temperature of the enzyme

[0081] In 1.5 mL EP tube, 270 μL agarose solution (concentration of 0.25%) was added, and was placed in an electric heating constant temperature water tank with temperature of 40, 50, 60, 70, 80 and 90 ℃ for 10 min, then 30 μL of enzyme reaction was added for 20 min, and 300 μL of 3, 5-dinitrosalicylic acid was added for boiling for 7 min to terminate the reaction, and the OD value of the reaction solution at 540 nm was determined by using an enzyme marker, and the relative enzyme activity was calculated according to the enzyme activity determination method to determine the optimum temperature of the enzyme reaction.

[0082] The optimum temperature experiment results of AgaCA233 and AgaCA233 mutant showed that AgaCA233 could catalyze agarose to produce reducing sugar under the temperature condition of 40-80 ℃, and the optimum temperature was 60 ℃, but when the temperature was higher than 80 ℃, the enzyme activity of AgaCA233 was almost lost. The experimental results showed that AgaCA233 mutant had high enzyme activity in the temperature range of 40-100 ℃, Figure 3 and the optimum temperature was 80 ℃. Thus, it can be seen that the catalytic stability of AgaCA233 mutant at high temperature is significantly improved compared with the wild type.

[0083] (2) Enzyme activity determination and evaluation of agar degradation ability

[0084] AgaCA233 mutant and AgaCA233 were diluted to 0.0003 mg·mL -1 , 0.003 mg·mL -1 , respectively. The OD value at 540 nm was determined by DNS method, and the amount of galactose was converted. We defined the amount of enzyme required to hydrolyze agarose to produce 1 mg of galactose per unit time (per minute) as an enzyme activity unit U, and the enzyme activity of AgaCA233 mutant and AgaCA233 was calculated to be 0.046 U and 0.0221 U, respectively. The specific enzyme activity relationship between the two was shown in Figure 4 It can be seen that the specific enzyme activity of AgaCA233 mutant is 19.45 times higher, which significantly improves the ability of agarase to catalyze agarose decomposition.

[0085] (3) Study on temperature stability

[0086] The enzyme solution was incubated in a constant temperature water bath at 50 ℃ and 60 ℃ for different time, and the enzyme activity was determined, and the reaction was carried out for 20 min, and then boiled for 7 min to terminate the reaction, and the OD value of the reaction solution at 540 nm was determined by using an enzyme marker, and the relative enzyme activity was calculated according to the enzyme activity determination method to determine the temperature stability of the enzyme reaction.

[0087] The results of the temperature thermal stability experiments of AgaCA233 and AgaCA233 mutants at 50℃ and 60℃ are shown in Table 2 as follows: Figure 5 As shown in Table 2, when AgaCA233 was incubated at 50℃ for 180 min, only about 30% of the relative enzyme activity remained. However, when the AgaCA233 mutant was incubated at 50℃ for 180 min, about 70% of the relative enzyme activity remained. When the incubation time was increased to 300 min, the relative enzyme activity was still higher than 50%. At 60℃, when AgaCA233 was incubated for 10 min, about 50% of the relative enzyme activity remained. When the incubation time was increased to 60 min, only about 30% of the relative enzyme activity remained. The AgaCA233 mutant still had a relatively high enzyme activity when incubated at 60℃ for 120 min, and the relative enzyme activity was still higher than 70%. Thus, it is shown that the thermal stability of the AgaCA233 mutant is better than that of AgaCA233 at 50℃ and 60℃.

[0088] The above is only the preferred embodiments of the present application, and does not limit the present application in any way. Any modification and change of the above embodiments according to the technical essence of the present application should be within the protection scope of the technical scheme of the present application.

Claims

1. A mutant of agarase AgaCA233, characterized in that, The amino acid sequence of the mutant is shown in SEQ ID NO.

3.

2. A biological material related to the mutant of the agarase AgaCA233 according to claim 1, the biological material including at least one of the following 1) to 5): 1) a gene encoding the mutant of the agarase AgaCA233 according to claim 1; 2) an expression cassette containing the gene encoding according to 1); 3) a recombinant vector containing the gene encoding according to 1); 4) a recombinant microorganism containing the gene encoding according to 1); 5) a recombinant microorganism containing the recombinant vector according to 3).

3. The biomaterial of claim 2, wherein, The nucleotide sequence of the gene encoding according to 1) is a nucleotide sequence having 95% or more homology with the nucleotide sequence shown in SEQ ID NO.

4.

4. The biomaterial of claim 3, wherein, The nucleotide sequence of the gene encoding according to 1) is shown in SEQ ID NO.

4.

5. Use of the mutant of the agarase AgaCA233 according to claim 1 in agar decomposition and production of oligoagar.

Images