NtLHT1 gene and its application in tobacco resistance to low nitrogen stress
By artificially mutating the NtLHT1 gene in tobacco, its nitrogen absorption and utilization capacity under low nitrogen stress was enhanced, thus solving the growth limitation of tobacco in low nitrogen environment and realizing efficient nitrogen utilization of tobacco under low nitrogen stress.
Patent Information
- Application Number
- CN202411308276.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-19
- Publication Date
- 2026-04-21
- Estimated Expiration
- 2044-09-19
AI Technical Summary
There are no reports in the existing technology of improving the resistance of tobacco to low nitrogen stress through NtLHT1 gene sequence, and the growth and development of tobacco in low nitrogen environment is restricted.
By artificially intervening in the NtLHT1 gene of tobacco, a mutated NtLHT1 gene was obtained, which enhanced its nitrogen uptake capacity under low nitrogen stress, increased the uptake of nitrate nitrogen and ammonium nitrogen, enhanced the activity of nitrate reductase and glutamine synthase, and increased the expression level of nitrogen transporter genes.
The NtLHT1 gene-edited mutant strains significantly improved the absorption and utilization of nitrogen in tobacco under low nitrogen stress, enhanced nitrogen efficiency, and improved the resistance of tobacco to low nitrogen stress.
Smart Images

Figure CN119020373B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of crop breeding, specifically relating to an NtLHT1 gene and its application in tobacco's resistance to low nitrogen stress. Background Technology
[0002] LHTs (Lysine histidine transporters) belong to the amino acid transporter (AATs) family. Currently identified LHTs mainly include LHT1, LHT2, LHT6, and LHT7.
[0003] In Arabidopsis, AtLHT1 participates in the uptake of lysine and histidine in the root epidermis (Chen and Bush, 1997). LHT1 knockout seedlings cannot utilize glutamate or aspartic acid as their sole nitrogen source, and amino acid uptake into the mesenchymal protoplast is also inhibited (Hirner et al., 2005). AtLHT1 is an important mediator of amino acid uptake in the roots (Svennerstam et al., 2007). LHT1 and AAP5 account for the majority of low-concentration amino acid uptake in the roots (Svennerstam et al., 2008). LHT1 knockout mutants exhibit strong growth reduction, while LHT1 overexpression plants show strong growth enhancement when amino acids are used as the nitrogen source (Forsum et al., 2008). Furthermore, AtLHT1 participates in the uptake and transport of the ethylene synthesis precursor ACC, thus affecting the exogenous ACC-induced ethylene response (Shin et al., 2015). LHT1 knockout plants show significantly reduced uptake of L-glutamine (Ganeteg et al.). AtLHT2 has a strong affinity for proline and aspartic acid and is specifically expressed in the tapetum of Arabidopsis thaliana, participating in the transport and allocation of amino acids in floral organs and affecting pollen development (Hirner et al., 2006). AtLHT6 is expressed in the root epidermis, root hairs, and cortical tissues, participating in the absorption of acidic amino acids, glutamine, and alanine, and possibly phenylalanine (Perchlik et al., 2014). In Arabidopsis thaliana, AtLHT1 is a negative regulator of disease resistance, and its substrate glutamine plays a key role in plant defense responses after binding to the salicylic acid pathway (Liu et al., 2010). In rice, OsLHT6 is specifically expressed in the meristem of new shoots (Zhao et al., 2012), and loss of OsLHT1 function inhibits the growth of rice roots and shoots, significantly reducing yield (Wang et al., 2019). MpLHT1 in *Mallotus thaliana* is responsible for the transport of ACC and can also transport hydroxyproline and histidine, which helps to balance ACC and other amino acids in the growth and reproduction of succulents (Li et al., 2022). Its ACC transport function is consistent with that of AtLHT1 in *Arabidopsis thaliana*.
[0004] Our research group discovered the tobacco amino acid transporter gene NtLHT1, with a nucleotide sequence of 1368 bp (SEQ ID NO.1) encoding a 455 aa protein. Tobacco plants with NtLHT1 gene knockout showed increased amino acid content in their leaves (ZL202210160515.2). These studies indicate that LHTs are mainly involved in the absorption and transport of amino acids in plants, thus participating in plant physiological processes.
[0005] During crop growth and development, the nitrogen absorbed by the root system is mainly inorganic nitrogen such as nitrate nitrogen and ammonium nitrogen, and it can also absorb some organic nitrogen, such as amino acids. Currently, there are no reports of improving tobacco's resistance to low nitrogen stress through the NtLHT1 gene sequence. Summary of the Invention
[0006] The purpose of this invention is to provide an NtLHT1 gene and its application in the resistance of tobacco to low nitrogen stress, providing a theoretical basis and material foundation for the breeding of tobacco nitrogen-efficient strains.
[0007] To achieve the above objectives, this application employs the following technical solution:
[0008] An NtLHT1 gene was artificially mutated by altering the TCCTTATGCCATGGCACAACTTGG fragment of the tobacco NtLHT1 gene, whose nucleotide sequence is shown in SEQ ID NO.1. The mutated nucleotide fragment sequences are TCCTTATGCCATGGACACAACTTGG and TCCTTATGCCATGGCAACTTGG, respectively.
[0009] Furthermore, the nucleotide sequence of the mutated NtLHT1 gene is shown in SEQ ID NO.2 and SEQ ID NO.3.
[0010] Application of NtLHT1 gene in tobacco resistance to low nitrogen stress, and application of NtLHT1 gene mutations in any of the above to improve tobacco resistance to low nitrogen stress.
[0011] Furthermore, compared with the unmutated NtLHT1 gene-edited line, the mutant tobacco plant under low nitrogen stress showed enhanced uptake of nitrate and ammonium nitrogen.
[0012] Furthermore, compared with the unmutated NtLHT1 gene-edited lines, the mutant tobacco plants showed enhanced activities of nitrate reductase and glutamine synthase in their leaves, as well as increased expression of nitrogen transporter genes.
[0013] Furthermore, the unmutated NtLHT1 gene-edited strain is a tobacco NtLHT1 gene-edited tobacco strain with the nucleotide sequence shown in SEQ ID NO.1, and the tobacco variety is Honghua Dajinyuan.
[0014] Furthermore, compared with the unmutated NtLHT1 gene-edited lines, the expression levels of nitrogen transporter genes NRT1-7.1 and NRT1.2 in the mutant NtLHT1 gene-edited lines were higher.
[0015] Furthermore, low nitrogen stress refers to a nitrogen concentration below 3 mM.
[0016] The beneficial effects of this invention are:
[0017] 1. The NtLHT1 gene sequence obtained by this invention has a significant effect on improving the resistance of tobacco to low nitrogen stress.
[0018] 2. This invention provides two mutant fragment sequences of a set of NtLHT1 gene sequences in tobacco, which are technical solutions for improving tobacco's resistance to low nitrogen stress and fill the gap in the field of nitrogen absorption and utilization technology of this gene family in tobacco. Attached Figure Description
[0019] Figure 1 This is a peak diagram for the detection of NtLHT1 mutants. HD represents the control (large red), and R1 and R2 represent NtLHT1 mutants.
[0020] Figure 2 The nitrate nitrogen content in leaves during the vigorous growth period is shown in Figure 1. HD represents the control group Hongda, while R1 and R2 are NtLHT1 mutants.
[0021] Figure 3 The values represent the ammonium nitrogen content in leaves during the vigorous growth period. HD represents the control group Hongda, while R1 and R2 represent the NtLHT1 mutant.
[0022] Figure 4 To measure the nitrate reductase activity in the leaves during the vigorous growth period, HD is the control Hongda, and R1 and R2 are NtLHT1 mutants;
[0023] Figure 5 The activity of glutamine synthase in leaves during the vigorous growth period was measured. HD was the control group, and R1 and R2 were NtLHT1 mutants.
[0024] Figure 6 The expression level of the nitrogen transporter gene NRT1-7.1 is shown in Figure 1. HD represents the control group (red), and R1 and R2 represent NtLHT1 mutants.
[0025] Figure 7 The expression level of the nitrogen transporter gene NRT1.2 is shown in Figure 1. HD represents the control group (red), and R1 and R2 represent NtLHT1 mutants. Detailed Implementation
[0026] The technical solutions of the present invention will be described in detail below through embodiments. The following embodiments are merely exemplary and can only be used to explain and illustrate the technical solutions of the present invention, and should not be construed as limiting the technical solutions of the present invention.
[0027] In the various embodiments of this application, unless otherwise specified, the technology or conditions are based on the prior art or conditions. The materials or equipment used, unless otherwise specified, are all conventional products that can be purchased.
[0028] Unless otherwise stated, in this invention, the percentage sign refers to volume percentage, and the ratio refers to volume ratio.
[0029] The tobacco variety used in this application is Honghua Dajinyuan, a commercially available tobacco variety.
[0030] The detection data corresponding to each embodiment of this application are as follows: Figures 1 to 7 As shown.
[0031] Example 1
[0032] The seeds and tobacco seedlings provided in this embodiment are the control safflower big golden yuan (abbreviated as HD) and the NtLHT1 gene mutant (abbreviated as R1 and R2), respectively.
[0033] Among them, the NtLHT1 gene mutants (R1, R2) were obtained from tobacco of Honghua Dajinyuan (containing the NtLHT1 gene, see the prior patent application, patent application number: ZL 202210160515.2) through gene editing technology.
[0034] R1 and R2 are nucleotide fragments in the tobacco NtLHT1 gene with nucleotide sequences as shown in SEQ ID NO.1, which were artificially mutated into TCCTTATGCCATGGCACAACTTGG and TCCTTATGCCATGGCAACTTGG nucleotide sequence fragments, respectively.
[0035] R1 becomes the above HD segment: TCCTTATGCCATGGACACAACTTGG.
[0036] R2 is the HD segment above transformed into: TCCTTATGCCATGGCAACTTGG.
[0037] The effects of different nitrogen concentrations on seed germination of the three materials were observed: *Hypericum sepium* (HD) and NtLHT1 gene mutants (R1 and R2).
[0038] 1. Preparation of nitrogen treatment solution:
[0039] Using nitrogen-free 1 / 10 MS liquid culture medium as the base solution, amino acids of corresponding concentrations were added to prepare various treatment solutions, resulting in a total of 6 treatments.
[0040] Table 1 Factor Treatment Table
[0041]
[0042] 2. Seed germination experiment:
[0043] Tobacco seeds of uniform maturity and size from three groups were selected for germination experiments. Twenty seeds were placed neatly in round petri dishes and covered with two layers of sterilized filter paper as a germination bed. The respective treatment solutions were added using a pipette. The dishes were then placed in a light incubator (set to 25°C, 16 h light / 8 h dark) for cultivation.
[0044] 3. Phenotypic observation:
[0045] Starting from day 3 after sowing, the germination status of the seeds was observed and recorded daily. Phenotypic observation was performed after 15 days of cultivation. Phenotypic analysis was conducted on different materials under the same treatment.
[0046] 4. Research Results:
[0047] Thirty days later, the tobacco seedlings were placed on agar medium for phenotypic analysis. After 15 days of seed germination, the growth of wild type and NtLHT1 mutant (R1, R2) did not change significantly when treated with MS (40 mM). However, after 15 days of low nitrogen LN (100 µM) treatment, the growth of NtLHT1 mutant (R1, R2) was better than that of the control, suggesting that the nitrogen uptake and utilization of the NtLHT1 edited lines were better than those of the control.
[0048] Example 2
[0049] Using the control group safflower big golden yuan (HD) and NtLHT1 gene mutants (R1, R2) as experimental materials, different nitrogen concentrations were applied to observe the effects on the growth of NtLHT1 gene mutant seedlings.
[0050] 1. Seedlings from the three groups were treated with 1 / 2 nitrogen-free Hoagland nutrient solution as the base solution, with 0.75 mM, 1.5 mM, and 3 mM NH4NO3 added respectively. Phenotypic analysis was performed after 15 days of treatment in solutions with different nitrogen concentrations.
[0051] 2. Results: After treatment with 0.75 mM N and 1.5 mM N for 15 days, the plant height of the NtLHT1 gene mutants (R1, R2) was significantly higher than that of the control HD. After treatment with 3 mM N for 15 days, there was no significant difference in growth and plant height between the NtLHT1 gene mutants (R1, R2) and the control HD. As nitrogen concentration decreased, a nitrogen deficiency phenotype appeared; the lower the nitrogen concentration, the more pronounced the yellowing of leaves. Under low nitrogen stress, the NtLHT1 gene mutants exhibited higher nitrogen absorption and utilization efficiency and better plant growth, indicating that their nitrogen absorption and utilization were superior to the control.
[0052] Example 3
[0053] Using the control group *Hedyotis diffusa* (HD) and NtLHT1 gene mutants (R1, R2) as experimental materials, a hydroponic experiment was conducted to investigate the absorption and utilization characteristics of inorganic nitrogen.
[0054] 1. A total of 9 processes are set up.
[0055] Table 2 Factor Treatment Table
[0056]
[0057] 2. Seedling raising. The floating seedling raising method is used for tobacco seedling cultivation.
[0058] 3. Nutrient solution preparation. Hoagland nutrient solution was used as the base nutrient solution for each treatment.
[0059] Table 3 Nitrogen-deficient nutrient solution formula
[0060]
[0061] 4. Hydroponic Experiment. 80-day-old tobacco seedlings (of similar size and growth) were removed with tweezers, and the soil in the roots was washed away with clean water. They were then placed in hydroponic containers with different concentrations of treatment solutions. The nutrient solution was changed every 7 days, and phenotypes were observed and physiological indicators were measured after 14 days.
[0062] 5. Measurement of physiological indicators.
[0063] (1) Determination of nitrate nitrogen content: The method of nitrate nitrogen reagent kit of plant (Suzhou Gres Biotechnology Co., Ltd.) was used.
[0064] (2) Determination of ammonium nitrogen content: The plant ammonium nitrogen content kit (catalog number: G0410F) from Suzhou Green Biotechnology Co., Ltd. was used.
[0065] (3) Total nitrogen content determination: The Kjeldahl method was used for determination.
[0066] (4) Nitrate reductase activity assay: The plant nitrate reductase kit (catalog number: G0402W96) from Suzhou Green Biotechnology Co., Ltd. was used.
[0067] (5) Glutamine synthase activity assay: The glutamine synthase kit (catalog number: G0401W) from Suzhou Greens Biotechnology Co., Ltd. was used.
[0068] (6) Nitrogen transporter gene expression level determination: The expression levels of nitrogen metabolism-related genes in tobacco roots were analyzed using qPCR. ① Total RNA extraction: Total RNA was extracted from tobacco leaves hydroponically cultured with 0.1g of 0.75mM and 3mM inorganic nitrogen using Trizol reagent. ② Reverse transcription was performed using a Servicebio reverse transcription kit to convert the RNA into cDNA, which was then used as a template for real-time quantitative PCR (qPCR). After reverse transcription, the cDNA was diluted to 100 μL with ultrapure water for later use. ③ Real-time quantitative PCR: The cDNA sequences of GS and NR in tobacco were searched on the NCBI website, and primers were designed. The primer sequences are shown in Table 5. The materials were analyzed by qRT-PCR using Rapid SYBR® Green reagent on a PCR instrument. Reaction system (10 μL): 0.5 μL each of upstream and downstream primers, 3 μL of H2O, 5 μL of 2×PCR mix, and 1 μL of cDNA. PCR reaction conditions: 95℃ for 5 min; 95℃ for 10 s, 60℃ for 30 s, 72℃ for 20 s, 40 cycles. Each sample was tested in triplicate. The Ct value was collected using a calibrated threshold setting, with tobacco 18S as an internal control, and a 2... -ΔΔCt The method is used for relative quantitative calculation.
[0069] Table 5 Primer Design for Quantitative Fluorescence
[0070]
[0071] (7) Calculation of nitrogen use efficiency: Plant nitrogen accumulation / nitrogen application rate × 100%
[0072] 6. Research Results:
[0073] (1) Analysis of nitrogen content in different forms:
[0074] ① Nitrate nitrogen content analysis: During the vigorous growth period, leaves of materials treated with different nitrogen concentrations in hydroponics were collected, and their nitrate nitrogen content was measured. Under treatments of 3 mM N, 1.5 mM N, and 0.75 mM N, the nitrate nitrogen content of the NtLHT1 gene mutants (R1, R2) was significantly higher than that of the control, and there was no significant difference between the two gene mutants. The nitrate nitrogen content in the leaves showed a decreasing trend with decreasing nitrogen concentration. These results indicate that the NtLHT1 gene mutant materials have a higher nitrogen uptake capacity. ② Ammonium nitrogen content analysis: During the vigorous growth period, the ammonium nitrogen content of leaves of materials under different treatments was measured. Under treatments of 3 mM N, 1.5 mM N, and 0.75 mM N, the ammonium nitrogen content of the NtLHT1 gene mutants (R1, R2) was significantly higher than that of the control, and there was a significant difference between the two gene mutant materials. The ammonium nitrogen content in the leaves showed a decreasing trend with decreasing nitrogen concentration. The results above indicate that the NtLHT1 gene mutant material has enhanced absorption capacity for ammonium nitrogen under low nitrogen stress.
[0075] (2) Analysis of nitrate reductase and glutamine synthase activities:
[0076] ① Leaves from different materials treated with different nitrogen concentrations during the vigorous growth period were collected, and their nitrate reductase activity was measured. At 3 mM N, the nitrate reductase activities of R1 and R2 were higher than those of HD. As the nitrogen concentration decreased, the nitrate reductase activity in the leaves showed a decreasing trend. At 1.5 mM N, there was no significant difference in nitrate reductase activity among the three materials; under 0.75 mM N treatment, the nitrate reductase activity of the NtLHT1 gene mutant material R1 was significantly higher than that of the controls HD and R2, and there was no significant difference between the latter two. These results indicate that the nitrate reductase activity of the NtLHT1 gene mutant material varies under different nitrogen concentrations, exhibiting higher nitrate reductase activity compared to the control. ② During the vigorous growth period, leaves from different materials treated with different nitrogen concentrations were collected, and the glutamine synthase activity of each material was measured. At 3 mM N treatment, there was no significant difference in glutamine synthase activity among the three materials; as the nitrogen concentration decreased, the glutamine synthase content in the leaves showed a decreasing trend. Under treatments with 1.5 mM N and 0.75 mM N, the glutamine synthase activities of NtLHT1 gene mutant materials R1 and R2 were significantly higher than those of the control. These results indicate that the glutamine synthase activity of NtLHT1 gene mutant materials varies under different nitrogen concentrations, exhibiting higher glutamine synthase activity compared to the control.
[0077] (3) Analysis of nitrogen transporter gene expression levels:
[0078] The expression levels of nitrate reductase and glutamine synthase genes in the roots of different materials under different treatments during the vigorous growth period were measured. Regardless of whether it was high, medium or low nitrogen treatment, the expression levels of nitrate reductase and glutamine synthase genes in R1 and R2 were significantly higher than those in HD.
[0079] (4) Analysis of total nitrogen uptake and nitrogen fertilizer utilization rate of tobacco plants:
[0080] Regarding total nitrogen uptake by tobacco plants: Under the 0.75 mM N treatment, the total nitrogen uptake of tobacco plants in materials R1 and R2 was lower than that of the control; under the 1.5 mM N treatment, the total nitrogen uptake of tobacco plants in material R1 was higher than that of the control, while that of material R2 was lower than that of the control; under the 3 mM N treatment, the total nitrogen uptake of tobacco plants in materials R1 and R2 was higher than that of the control. Regarding nitrogen use efficiency, regardless of whether it was under low nitrogen (0.75 mM), medium nitrogen (1.5 mM), or high nitrogen (3 mM) treatments, the nitrogen use efficiency of material R2 was higher than that of the control, with an increase ranging from 4 to 10 percentage points. The highest nitrogen use efficiency was achieved under the low nitrogen (0.75 mM) treatment, reaching 56%.
[0081] Table 6 Total nitrogen uptake and nitrogen fertilizer utilization rate of tobacco plants
[0082]
[0083] (5) This gene may increase the expression levels of nitrate reductase and glutamine synthase genes, thereby increasing the activity of nitrate reductase and glutamine synthase, thus improving the resistance of tobacco to low nitrogen stress.
[0084] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.
Claims
1. The application of the mutated NtLHT1 gene in tobacco's resistance to low nitrogen stress, characterized in that, The TCCTTATGCCATGGCACAACTTGG fragment in the tobacco NtLHT1 gene, whose nucleotide sequence is shown in SEQ ID NO.1, was artificially mutated. The mutated fragment sequences are TCCTTATGCCATGGACACAACTTGG and TCCTTATGCCATGGCAACTTGG, respectively. The nucleotide sequences of the mutated NtLHT1 gene are shown in SEQ ID NO.2 and SEQ ID NO.3, respectively; Application of the mutated NtLHT1 gene in improving the resistance of tobacco to low nitrogen stress; Low nitrogen stress refers to nitrogen concentrations below 3 mM.
2. The application of the mutated NtLHT1 gene according to claim 1 in the resistance to low nitrogen stress in tobacco, characterized in that, Compared with the unmutated NtLHT1 gene-edited line, the mutant tobacco plant under low nitrogen stress showed enhanced uptake of nitrate and ammonium nitrogen.
3. The application of the mutated NtLHT1 gene according to claim 1 in the resistance to low nitrogen stress in tobacco, characterized in that, Compared with the unmutated NtLHT1 gene-edited lines, the mutant tobacco plants showed enhanced activities of nitrate reductase and glutamine synthase in their leaves, as well as increased expression of nitrogen transporter genes.
4. The application of the mutated NtLHT1 gene according to claim 2 or 3 in the resistance to low nitrogen stress in tobacco, characterized in that, The unmutated NtLHT1 gene-edited strain is a tobacco NtLHT1 gene-edited tobacco strain with the nucleotide sequence shown in SEQ ID NO.1, and the tobacco variety is Honghua Dajinyuan.
5. The application of the mutated NtLHT1 gene according to claim 2 or 3 in the resistance to low nitrogen stress in tobacco, characterized in that, Compared with the unmutated NtLHT1 gene-edited lines, the expression levels of nitrogen transporter genes NRT1-7.1 and NRT1.2 in the mutant NtLHT1 gene-edited lines were higher.
Citation Information
Patent Citations
Application and method of tobacco amino acid transporter related gene NtLHT1
CN114540368A
Application of NtLHT1 gene in improving tobacco biomass and / or nitrogen utilization efficiency
CN117384945A
Use of zea mays amino acid transporter and coding gene thereof in plant disease resistance
WO2024099163A1