Packaging method of BaEV retroviral vector and its packaging cell line
By constructing a BaEV retroviral stable packaging cell line, the problem of low transduction efficiency of NK cells in the prior art was solved, and efficient and stable viral packaging and transduction were achieved, which was suitable for large-scale industrial applications.
Patent Information
- Application Number
- CN202411135840.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-17
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-08-17
AI Technical Summary
The prior art is difficult to efficiently transduce NK cells, especially because the natural antiviral ability of NK cells leads to extremely low transduction efficiency of VSVG envelope lentiviruses, and the traditional BaEV retroviral vector packaging method is inefficient and unstable, making it difficult to apply on a large scale on industrial scale.
The BaEV retroviral stable packaging cell line was constructed. By transferring gag-pol and BaEV envelope proteins into HEK293T cells and knocking out the ASCT-1/2 receptor, the problems of intercellular fusion and syncytial formation were solved, and efficient and stable viral packaging and transduction were achieved.
It has achieved efficient transduction of NK cells and T cells, and the transduction positive rate can reach more than 90%, reducing the cost and impurities of virus preparation, simplifying the purification process, and suitable for large-scale industrial applications.
Smart Images

Figure CN119020418B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of cell therapy, and particularly to a packaging method of a BaEV retroviral vector and its packaging cell line. Background Art
[0002] Currently, in terms of underlying technologies for the development of CAR-T and CAR-NK products, the main challenges are: low transduction efficiency, poor amplification multiple, and unsatisfactory cryopreservation effect. Among them, the efficient transduction of NK cells is the bottleneck in the development of CAR-NK. As a natural immune barrier, NK cells are inherently anti-infective and are not easily transduced by viruses. Currently, lentiviral vectors are commonly used in the market for the transduction of NK cells, and lentiviral vectors usually use VSVG (vesicular stomatitis virus envelope glycoprotein) envelope. Although the receptor of VSVG envelope, low-density lipoprotein (LDL), is highly expressed on activated T cells, it is expressed at a low level on activated NK cells. Currently, the maturely applied lentivirus with VSV-G envelope is not sufficient to solve the above transduction and genetic manipulation problems. A large number of studies have shown that the efficiency of VSV-G lentivirus transduction of NK cells is extremely low (only 5-10%), and the reason for this phenomenon is very likely that NK cells have natural antiviral ability. To address the problem of low transduction efficiency of VSVG envelope lentiviral vectors in NK cells, some studies have used small molecule inhibitors to upregulate the expression of LDL-R (low-density lipoprotein receptor) on the surface of NK cells to increase the transduction efficiency of VSVG envelope lentiviral vectors, and some studies have used BX795 to inhibit the antiviral signal of NK to increase the transduction efficiency of NK. However, they all face the disadvantages of unstable CAR positive rate, high toxicity, which is not conducive to the amplification of CAR-NK cells, and cannot be applied clinically on a large scale and stably. In particular, BX795 will have a certain impact on the killing function and proliferation ability of NK cells, which obviously does not meet the requirements of clinical applications. Some studies have also shown that some retroviruses can efficiently transduce NK cells, but there are certain risks in the safety of retroviral insertion sites.
[0003] Patent WO2013 / 045639A1 discloses that the modified lentivirus (BaEV lentivirus) packaged with baboon endogenous virus (BaEV) envelope glycoprotein can efficiently transduce T cells and B cells. Although BaEV envelope glycoprotein (BaEV-G) has extremely high application value, it is difficult to produce high-titer pseudovirus particles. CN117467705 A discloses an efficient BaEV envelope virus packaging method, which introduces BaEV envelope glycoprotein or a vector containing the nucleic acid encoding BaEV envelope glycoprotein, the nucleic acid encoding the target gene, and viral packaging elements into target cells; or constructs a cell line stably expressing BaEV envelope glycoprotein, and introduces the nucleic acid encoding the target gene and viral packaging elements into the cell line.
[0004] To improve the transduction efficiency of NK cells, the most common method currently is to use other envelope proteins to construct lentiviral vectors. Existing studies have shown that baboon endogenous retrovirus (BaEV) envelope glycoprotein pseudotyped lentiviral vectors (BaEV-LV) can significantly improve the transduction efficiency of NK cells, and their transduction efficiency is superior to that of VSVG-LV vectors.
[0005] Currently, most of the BaEV envelope lentiviral vectors and BaEV envelope retroviral vectors can only produce pseudoviruses by transiently transfecting HEK293T cells with expression plasmids and packaging plasmids. This method has low efficiency and problems such as DNA residue, resulting in a cumbersome subsequent purification process and unstable virus titers and virus quality among batches. This method of transient transfection for preparing BaEV pseudoviruses cannot produce high-quality pseudoviruses in large quantities and stably, making it difficult to carry out large-scale industrial applications, and leading to high upfront R & D and industrialization costs for pseudovirus preparation.
[0006] Currently, the BaEV envelope glycoproteins used for lentiviral packaging mainly have the following forms: 1. Wild-type BaEV-WT; 2. BaEV-Rless, which is the form of BaEV envelope glycoprotein without the fusion-restrictive R peptide; 3. BaEV / TR, which is the form of BaEV envelope glycoprotein in which the cytoplasmic tail domain of wild-type BaEV-WT is replaced with the cytoplasmic tail domain of MLV envelope glycoprotein. Compared with BaEV-Rless, the cytotoxicity of the BaEV / TR form is greatly reduced, and the appearance of syncytia during virus packaging is significantly reduced, but the virus titer is lower than that of the BaEV-Rless form. It is reported that compared with wild-type BaEV-WT, BaEV-Rless can improve the transduction efficiency of primary cells. The specific forms of "BaEV-RLess" and "BaEV / TR" are described in detail in Chinese Patent CN104080917B.
[0007] Currently, there is a PG13 stable packaging retroviral cell line on the market that can prepare retroviral vectors in large quantities and stably. The virus envelope is GALV (gibbon ape leukemia virus). The GALV retroviral vector prepared by this system can achieve a transduction efficiency of over 60% for T cells, but only about 20% for NK cells and is limited by the size and structural complexity of the target gene. Therefore, it cannot fully meet the requirements for efficient transduction of other difficult-to-transduce primary immune cells such as T cells and NK cells in the field of cell therapy. Summary of the Invention
[0008] To solve the above problems, the present invention provides a method for packaging a BaEV retroviral vector, the method comprising the following steps: Step 1: constructing a stable BaEV retroviral packaging cell line; Step 2: transfecting a retroviral vector plasmid comprising a target sequence into a virus-producing cell line, the virus-producing cell line being a HEK293T cell line or a derivative thereof, to harvest a transiently transfected and virus-producing retroviral vector; and Step 3: mixing the retroviral vector obtained in Step 2 with the stable BaEV retroviral packaging cell line obtained in Step 1, and promoting the transduction of the retroviral vector into the stable BaEV retroviral packaging cell line by horizontal centrifugation.
[0009] In one embodiment, Step 1 comprises the following steps:
[0010] Step 11: transfecting the structural protein gag-pol required for constructing a retrovirus into a HEK293T cell line or a derivative thereof to obtain a corresponding cell line containing the structural protein gag-pol;
[0011] Step 12: on the basis of the cell line obtained in Step 11, constructing a HEK293T cell line or a derivative thereof in which the ASCT-1 and ASCT-2 receptor proteins are simultaneously knocked out, to obtain a corresponding cell line in which the ASCT-1 and ASCT-2 receptor proteins are knocked out;
[0012] Step 13: transferring the BaEV envelope into the cell line obtained in Step 12 to obtain the stable BaEV retroviral packaging cell line.
[0013] In one embodiment, Step 11 comprises:
[0014] Step 111, transfecting a HEK293T cell line or a derivative thereof with a gag-pol plasmid;
[0015] Step 112, after transfection, adding an antibiotic to screen for a HEK293T cell line or a derivative thereof that highly expresses the gag-pol target gene;
[0016] Step 113, digesting the HEK293T cell line or a derivative thereof obtained in Step 112, culturing the digested cells, and selecting monoclonal cells;
[0017] Step 114, performing a transient transfection and virus titer test on the monoclonal cells obtained in Step 113, screening for monoclonal cells with a high virus titer, to obtain a corresponding cell line containing the structural protein gag-pol.
[0018] In one embodiment, step 12 includes: step 121, knocking out the ASCT-1 gene in the cells containing the structural protein gag-pol protein obtained in step 11; step 122, subjecting the cells obtained in step 121 to flow sorting and culturing to obtain monoclonal cells; step 123, selecting the monoclonal cells obtained in step 122 for targeting detection to obtain monoclonal cells with homozygous knockout of the ASCT-1 gene; and step 124, knocking out two exons of the ASCT-2 gene in the monoclonal cells obtained in step 123, and further selecting monoclonal cells to obtain cells with knockout of the ASCT-1 and ASCT-2 receptor proteins.
[0019] In one embodiment, step 13 includes: step 131, transfecting the cells with knockout of the ASCT-1 and ASCT-2 receptor proteins obtained in step 12 with the BaEV envelope plasmid; step 132, after transfection, adding antibiotics to screen for a retroviral vector packaging cell line with high expression of the BaEV envelope; step 133, digesting the retroviral vector packaging cell line with the BaEV envelope obtained in step 132, culturing the digested cells, and selecting monoclonal cells; and step 134, performing a transient transfection virus titer test on the monoclonal cells obtained in step 133, screening for monoclonal cells with a high virus titer, and obtaining the stable BaEV retroviral packaging cell line.
[0020] In one embodiment, in step 131, the BaEV envelope plasmid is a wild-type BaEV envelope plasmid or a BaEV-Rless envelope plasmid.
[0021] In one embodiment, the retroviral vector plasmid containing the target sequence in step 2 is the pMFG-CD19 CAR plasmid, and the virus-producing cells in step 2 are Phoenix-Ampho cells.
[0022] In one embodiment, when the pMFG-CD19 CAR plasmid is transfected into the Phoenix-Ampho cells and the transfected Phoenix-Ampho cells are cultured with a medium change for 48 - 96 hours, the cell culture supernatant and the Phoenix-Ampho cells are harvested to harvest the transient transfection virus-producing retroviral vector in step 2.
[0023] In one embodiment, in step 3, when promoting the transduction of the retroviral vector into the BaEV retrovirus stable packaging cell line by horizontal centrifugation, first, the retroviral vector obtained in step 2 is mixed with the BaEV retrovirus stable packaging cell line obtained in step 1 for the first centrifugal transduction and incubation to obtain the BaEV retrovirus stable packaging cell line after the first transduction; subsequently, the retroviral vector obtained in step 2 and the BaEV retrovirus stable packaging cell line after the first transduction are subjected to the second centrifugal transduction and incubation to finally obtain the BaEV retrovirus stable packaging cell line in step 3.
[0024] In one embodiment, the temperature of the first centrifugal transduction or the second centrifugal transduction is 32°C, the centrifugal transduction time is 1 to 2 hours, and the incubation time after transduction is 2 to 3 hours.
[0025] In one embodiment, a BaEV retrovirus stable packaging cell line prepared by the above packaging method is provided.
[0026] The present invention first transfers the structural proteins gag-pol required for the preparation of retroviruses and the BaEV envelope protein into HEK293T cells to stably express them.
[0027] The present invention first knocks out the ASCT-1 / 2 receptor of HEK293T cells. On the one hand, it solves the problems of cell-cell fusion and syncytium formation induced by the BaEV envelope, enabling the cells to produce virus normally; on the other hand, it avoids the repeated infection of the BaEV virus itself, causing cell death. After knocking out the ASCT1 / 2 receptor, the cells are no longer affected by virus infection and can grow continuously and produce virus continuously.
[0028] The present invention has developed a stable packaging cell line (BaEV-PackRV) that can stably and mass-produce BaEV retroviral vectors. This packaging cell line has provided retroviral gag, pol, and envelope proteins (BaEV) to mediate the packaging and transcription of the target gene. First, a plasmid containing the target gene is transiently transfected into a common virus preparation cell line, such as the HEK293T cell line or its derivative cell lines, such as Phoenix-Ampho, etc. The supernatant is collected and transduced into BaEV-PackRV to obtain a production cell line that stably produces virus. Therefore, only a small amount of plasmid is used for the production of retroviral vectors during the first transient transfection, saving a large amount of plasmid preparation and purification processes. For subsequent virus preparation, only the virus-producing cell line needs to be resuscitated and cultured, and the cell culture supernatant is collected, which is the required retroviral vector. Using the BaEV stable packaging cell line as the raw material for the production of retroviral vectors greatly reduces the cost of virus preparation; reduces impurities and downstream purification processes, and reduces the cost of virus preparation for cell therapy products by more than 10 times.
[0029] Based on the exploration of the transduction positive rate of the BaEV-PackRV cells by the retroviral vector harvested from transient transfection under different combinations of the transient transfection virus harvesting time, temperature, centrifugation time, and incubation time, the present invention determines the optimal method for preparing the BAEV retrovirus production cell line, which can achieve the packaging of the BAEV retroviral vector carrying the plasmid of the exogenous gene CD19 CAR, construct the BAEV retroviral vector production cell line, and produce the BAEV retroviral vector with high titer.
[0030] In addition, the expression level of the envelope receptor on NK cells is related to the virus integration efficiency. The BaEV envelope receptors are neutral amino acid transporters ASCT-1 and ASCT-2 (ASCT-1 / 2), both of which are highly expressed on activated NK cells, facilitating the efficient infection of NK cells by the virus and thus enhancing the transduction efficiency of NK cells.
[0031] The present invention prepares a BaEV retrovirus stable packaging cell line (BaEV-PackRV) for the low-cost, high-quality, and efficient large-scale industrial preparation of pseudovirus and its application in the efficient transduction of cell therapy products. Compared with the transient transfection of BaEV lentivirus, it can produce a high-titer virus vector without multi-plasmid transfection, with a simpler production process and lower cost, enabling better control of product quality and large-scale production; compared with the GALV retrovirus that can be stably packaged, it can achieve the efficient transduction of primary immune cells such as NK cells and T cells that are difficult to transduce at a lower multiplicity of infection (MOI). The transduction positive rate can be as high as 90% and remain stable, and the ultra-high transduction efficiency does not affect the viability and expansion of NK cells and T cells. Brief Description of the Drawings
[0032] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present application. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.
[0033] Figure 1 is the flow chart for constructing the BaEV retrovirus packaging cells of the present invention;
[0034] Figure 2 is the result diagram of RT-PCR for detecting the relative expression level of gag-pol in HEK293T-gag-pol monoclonal cells;
[0035] Figure 3It is a flow cytometry diagram for detecting the virus-producing titer of HEK293T-gag-pol monoclonal cells;
[0036] Figure 4 It is the sequencing identification of HEK293T-gag-pol-ASCT-1-KO homozygous knockout monoclonal cells, and 8 ASCT-1 gene knockout homozygotes are screened;
[0037] Figure 5 It is a Western blot verification diagram of the expression results of the ASCT-1 gene in homozygous knockout monoclonal cells;
[0038] Figure 6 It is a sequencing verification diagram of the knockout situation of the ASCT-2 receptor;
[0039] Figure 7 It is a PCR detection diagram of the exon knockout situation of HEK293T-gag-pol-ASCT-1-KO monoclonal cells;
[0040] Figure 8 It is a diagram of the growth status of two types of cells photographed with a microscope 24 hours after the BaEV envelope plasmid is transfected into HEK293T-gag-pol-ASCT-1&2-KO and HEK293T cells respectively;
[0041] Figure 9 It is a diagram of the BaEV envelope copy number of monoclonal cells expressing BaEV detected by RT-PCR after the BaEV envelope plasmid is transfected into HEK293T-gag-pol-ASCT-1&2-KO cells;
[0042] Figure 10 It is to take monoclonal cells with a higher BaEV envelope copy number, count them every two days, and draw a growth curve diagram;
[0043] Figure 11 It is a flow cytometry diagram for detecting the virus-producing titer of BaEV-Rless-57 and BaEV-WT-64 transient transfection;
[0044] Figure 12 It is a diagram of the transduction positive rate of BaEV-Rless-57-copGFP and BaEV-WT-64-copGFP virus-producing cell lines detected by flow cytometry;
[0045] Figure 13 It is a diagram of the transduction positive rate of the virus-producing titer of BaEV-Rless-57-copGFP and BaEV-WT-64-copGFP stable transfection
[0046] Figure 14It is the result graph of the positive rates of GALV-CD19 CAR and BaEV-CD19 CAR transduced T cells;
[0047] Figure 15 It is the curve graph of the proliferation fold of CAR-T cells;
[0048] Figure 16 It is the result graph of the positive rates of GALV-CD19 CAR and BaEV-CD19 CAR transduced NK cells;
[0049] Figure 17 It is the curve graph of the proliferation fold of CAR-NK cells. Detailed implementation manners
[0050] To enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of this application.
[0051] Cell source: HEK293T, Phoenix-Ampho, Phoenix-ECO, and PG13 cells are all commercial cell lines and are all purchased from ATCC. Plasmid source: pCMV-MMLV-gag-pol-PGK-puro, pMFG-CD19 CAR, pMFG-copGFP, pCMV-BaEV-Rless-PGK-hygr-PA, pCMV-BaEV-WT-PGK-hygr-PA, and PX458 plasmids are all commercial plasmids and are all purchased from Guangdong Junhou Biopharmaceutical Co., Ltd. The reagents and raw materials used in the present invention are all from commercial reagents if not otherwise specified.
[0052] The present invention provides a method for constructing a BaEV retrovirus packaging cell line as Figure 1 shown, and the specific method is described as follows.
[0053] Example 1 Construction and screening of HEK293T-gag-pol cells
[0054] 1. Resuscitation and seeding of HEK293T cells
[0055] Resuscitate HEK293T cells, and the culture medium is DMEM containing 10% FBS. Place them in a 5% CO 2 cell incubator and culture for 48 h. When the cell confluence reaches about 80%, digest the cells, and take 8×10 5 cells per well and inoculate them into a 6-well plate, and place them at 37°C, 5% CO2 Cultured in an incubator.
[0056] 2. Transfection of pCMV-MMLV-gag-pol-PGK-puro plasmid
[0057] 24 hours after plating HEK293T cells, observe the cell confluence under a microscope to reach 70 - 80%, and then perform transfection. Prepare the transfection system: the dosage of pCMV-MMLV-gag-pol-PGK-puro plasmid is 3.3 μg, the ratio of FugeneHD:DNA is 3:1, and make up to 200 μL with DMEM medium. After mixing, let it stand at room temperature for 15 minutes, add 200 μL to each well, and place it in an incubator at 37°C with 5% CO 2 Cultured in the incubator.
[0058] 3. Puromycin screening:
[0059] 24 hours after transfection, replace it with DMEM complete medium containing 3 μg / mL puromycin, treat the cells once every two days, and keep the puromycin screening concentration at 3 μg / mL after changing the medium. After 1 week of drug screening, treat the cells once every four days, and use puromycin with a final concentration of 8 μg / mL for screening after changing the medium to obtain HEK293T-gag-pol cells with high expression of the gag-pol target gene.
[0060] 4. Selection of monoclonal cells:
[0061] Digest HEK293T-gag-pol cells, adjust the cell density to 100 cells / mL, inoculate into a 96-well plate, add 100 μL of cell suspension to each well, and place the cells in an incubator at 37°C with 5% CO 2 Cultured in the incubator. Monitor the cell growth status and gradually expand the monoclonal cells.
[0062] 5. Identification of monoclonal cells:
[0063] Extract RNA from monoclonal cells and reverse transcribe to obtain cDNA, and perform RT-PCR to detect the expression of gag-pol ( Figure 2 ). The primers for gag-pol are gag-pol-qPCR-F: gacggaaatggtggaga; gag-pol-qPCR-R: atgcctgcgaggtagtg.
[0064] Figure 2It shows the gag-pol gene expression levels of different monoclonal cells, but does not represent the gag-pol protein expression levels and protein functions. Therefore, we selected 6 monoclonal cells with high (clone 2), medium (clone 10, clone 19, clone 28), and low (clone 1, clone 14) gag-pol gene expression for transient transfection and virus production testing.
[0065] 6. Virus production of HEK293T-gag-pol monoclonal cells:
[0066] The above 6 monoclonal cells were selected for transient transfection and virus production testing. The transfection method was the same as above. Prepare the transfection system: the dosage of pMFG-copGFP plasmid was 1 μg, and the pCMV-BaEV-Rless-PGK-hygr-PA or pCMV-BaEV-WT-PGK-hygr-PA plasmid was 500 ng each, and the volume was made up to 100 μL with DMEM medium. After 24 h of transfection, replace with fresh complete DMEM medium and place in an incubator at 32 °C for virus production. After 48 h, collect the cell supernatant respectively, filter the cell supernatant with a 0.45 μm filter membrane, and then perform titer detection.
[0067] 7. Detection of the titer of the retrovirus produced by transient transfection of HEK293T-gag-pol monoclonal cells:
[0068] Seed HEK293T cells into a 24-well plate, with 2×10 5 cells per well. After 24 h, discard the cell culture medium, add 1 mL of the virus solution to be tested, and then add 1 μg / mL polybrene. Centrifuge at 2500 rpm at 32 °C for 1 h. Place in an incubator at 37 °C for continued culture. After 24 h of virus transduction, replace with fresh medium. After 48 h, detect the transduction efficiency by flow cytometry ( Figure 3 ). Calculation method of virus biological titer: Virus titer (TU / mL) = number of infected cells * percentage of positive cells / volume of virus stock solution (Table 1). By flow cytometry, the positive infection rate of the retrovirus produced by transient transfection of HEK293T-gag-pol monoclonal cells at different dilution ratios reflects the biological titer of the virus.
[0069] Transient transfection and virus production testing were carried out on the 6 selected HEK293T-gag-pol monoclonal cells. Among them, the virus production titer of HEK293T-gag-pol-Clone 1 was relatively high. Subsequently, Clone 1 cells will be selected for the construction of the KO cell line.
[0070] Table 1: Detection of virus production titers of different HEK293T-gag-pol monoclonal cells
[0071] Transduction positive rate Virus titer (TU / mL) Clone 1 62.8% 1.54E+06 Clone 2 8.38% 2.05E+05 Clone 10 9.69% 2.37E+05 Clone 14 6.71% 1.64E+05 Clone 19 15.8% 3.87E+05 Clone 28 44.8% 1.10E+06
[0072] Example 2: Construction of HEK293T-gag-pol-ASCT-1&2-KO cell line
[0073] 1. Plasmid construction:
[0074] Design ASCT-1-gRNA and ASCT-2-gRNA fragments, and synthesize primers. See Table 2 for specific primers. Form the target fragment by self-ligation of the primers. Double-digest the PX458 plasmid with BbsI restriction endonuclease, recover and purify it. Perform seamless cloning of the target fragment and the linearized vector, and transform the product into DH5α Escherichia coli. After shaking the bacteria, plate and culture overnight, and pick monoclonal colonies for shaking, sequencing, and double-digest verification.
[0075] Table 2 Primer sequences
[0076] Primer name Primer sequence ASCT-1-gRNA-F CACCAACAACGTAGAGCTCAACGC(SEQ ID NO.1) ASCT-1-gRNA-R AAACGCGTTGAGCTCTACACTGTT(SEQ ID NO.2) ASCT-2-gRNA-1-F CACCAAACCCCTACCGCTTCCTGT(SEQ ID NO.3) ASCT-2-gRNA-1-R AAACACAGGAAGTAGTAGGGGTTT(SEQ ID NO.4) ASCT-2-gRNA-2-F CACCGAGGAATATCACCGGAACCA(SEQ ID NO.5) ASCT-2-gRNA-2-R AAACTGGTTGCGGTGATATTCCTC(SEQ ID NO.6)
[0077] 2. Knockout of ASCT-1 gene in HEK293T-gag-pol:
[0078] Add 3 μg of PX458-ASCT-1-gRNA plasmid to 150 μl of electroporation buffer to prepare an electroporation reaction solution. Take 1×10 6 HEK293T-gag-pol-Clone 1, centrifuge and discard the supernatant. After adding the electroporation reaction solution, gently pipette, and transfer to an electroporation cuvette. Use a Lonza 2b electroporator with the electroporation program Q-001 for electroporation. After completion, aspirate the cell suspension in the electroporation cuvette and add it to pre-warmed DMEM medium for continued culture. The PX458-ASCT-1-gRNA plasmid carries a GFP tag and transiently expresses after electroporating HEK293T-gag-pol-Clone 1. After 24 h, sort GFP-positive cells by flow cytometry.
[0079] 3. Selection of monoclonal cells:
[0080] Adjust the density of the GFP cells sorted by flow cytometry to 100 cells / mL, inoculate into a 96-well plate, add 100 μL of cell suspension to each well, and place the cells in an incubator at 37°C and 5% CO 2 for culture. Monitor the cell growth status, gradually expand the monoclonal cells, and perform expansion and verification after the cells reach confluence.
[0081] 4. Detection of the targeting situation of HEK293T-gag-pol-ASCT-1-KO monoclonal cells
[0082] Extract the DNA of monoclonal cells and perform PCR experiments to detect the expression of the ASCT-1 gene. The primers for ASCT-1 are ASCT-1-F: ggtctgagacaagacacatg; ASCT-1-R: gtcactctaagggatggcag. Sequence the PCR products and compare the results with the website https: / / decodr.org / . Sequencing found 8 homozygous knockout clones ( Figure 4 ). Sequence identification of HEK293T-gag-pol-ASCT-1-KO homozygous knockout monoclonal cells was performed, and 8 ASCT-1 gene knockout homozygotes were screened. Select 8 homozygous knockout clones for Western blot to verify the expression of the ASCT-1 gene. According to Figure 5 , the Western blot results showed that the ASCT1 gene was not expressed in HEK293T-gag-pol-ASCT-1-KO-Clone-30 cells. Therefore, Clone-30 was selected for knockout of the ASCT-2 gene.
[0083] 5. Knockout of the ASCT-2 gene in HEK293T-gag-pol-ASCT-1-KO:
[0084] Electroporate HEK293T-gag-pol-ASCT-1-KO-Clone-30 cells with the PX458-ASCT-2-gRNA-1 plasmid and the PX458-ASCT-2-gRNA-2 plasmid to knockout two exons of the ASCT-2 gene, and further select monoclonal cells. The method is the same as before. Extract the genomic DNA of monoclonal cells and sequence it using 1-ASCT-2-F. To ensure that all transcripts of the ASCT-2 protein are disrupted, 8 clones with deletion fragments greater than 5000 bp were screened, and Clone-30, 47, 51, and 58 were selected for the next PCR verification experiment. The PCR detection primers for ASCT-2 are shown in Table 3.
[0085] According to the PCR results in the figure, the PCR results of 3 pairs of primers for Clone 47 of HEK293T-gag-pol-ASCT-1-KO were all negative, indicating that the ASCT-2 gene knockout in Clone 47 monoclonal cells was successful. Then, Clone 47 was selected for the next experiment. Sequence verification of the ASCT-2 receptor knockout situation is as Figure 6 shown. Extract the genomic DNA of monoclonal cells and sequence verify the ASCT-2 receptor knockout situation. A total of 8 HEK293T-gag-pol-ASCT-1-KO monoclonal cells with deletion fragments greater than 5000 were screened. The Western blot results are as Figure 7As shown in the figure, 3 pairs of primers were used to detect the knockout of two exons of the ASCT02 gene. The PCR detection results showed that all transcripts of the ASCT-2 protein in Clone-47 single cells were disrupted.
[0086] Table 3 PCR detection primers for ASCT-2
[0087]
[0088] Example 3 Construction of a stable packaging cell line for BaEV
[0089] 1. Transfect the BaEV envelope plasmid into HEK293T-gag-pol-ASCT-1&2-KO cells:
[0090] Seed the above HEK293T-gag-pol-ASCT-1&2-KO-clone-47 cells in a six-well plate. After 24 hours of cell seeding, observe the cell confluence under a microscope to reach 70-80%. Transfect HEK293T-gag-pol-ASCT-1&2-KO cells with pCMV-BaEV-Rless-PGK-hygr-PA and pCMV-BaEV-WT-PGK-hygr-PA respectively. Prepare the transfection system: the plasmid dosage is 3.3 μg, the ratio of Fugene HD:DNA is 3:1, and the DMEM medium is supplemented to 200 μL. After mixing, let it stand at room temperature for 15 minutes, and add 200 μL to each well, then place it in an incubator at 37°C and 5% CO 2 for culturing.
[0091] Take pictures under a microscope 24 hours after transfection to record the growth status of the two types of cells ( Figure 8 ). After transfection, the cell state of HEK293T-ASCT-1&2-KO cells was significantly better than that of wild-type HEK293T cells. After knocking out the ASCT-1 and ASCT-2 genes, the problem of syncytium formation and inability to produce virus normally after transfection of BaEV was solved.
[0092] 2. Hygromycin screening:
[0093] 24 hours after transfection, change to DMEM complete medium containing 3 μg / mL hygromycin, and treat the cells once every two days. After changing the medium, continue to maintain the screening concentration of hygromycin at 300 μg / mL. After 1 week of drug screening, treat the cells once every four days, and use puromycin at a final concentration of 800 μg / mL for screening after changing the medium to obtain a retroviral vector packaging cell line with high expression of BaEV-WT or BaEV-Rless target genes.
[0094] 3. Pick monoclonal colonies:
[0095] Digest the cells after hygromycin screening, adjust the cell density to 100 cells / mL, inoculate into a 96-well plate, add 100 μL of cell suspension to each well, and place the cells in an incubator at 37 °C and 5% CO 2 Incubate. Monitor the cell growth status, gradually expand and cryopreserve the monoclonal cells.
[0096] 4. Detection of BaEV envelope copy number in monoclonal cells:
[0097] Extract single-cell RNA and reverse transcribe it to cDNA, and perform RT-PCR to detect the expression of BaEV-Rless or BaEV-WT envelope. The primers for BaEV envelope detection are BaEV-qPCR-F: ggcatacacttatctacccacgaac; BaEV-qPCR-R: tgatcaatagcagggatggggac. Prepare the RT-PCR reaction system according to Table 3. Pipette 15 μL of the mixture into the 8-well PCR reaction wells, and set 3 replicates for each group. The reaction system is shown in Table 4, and set the fluorescence PCR amplification program according to Table 5. In addition, use the BaEV plasmid as a positive control product, calculate its copy number: (6.02×10 23 copies / mol)×(ng / μL×10 9 ) / (DNA length×660) = copies / μL, and draw a standard curve. According to the standard curve, calculate the BaEV envelope copy number of each monoclonal cell ( Figure 9 ).
[0098] Figure 9 shows the copy number levels of BaEV envelopes in different monoclonal cells. Among BaEV-Rless cells, the monoclonal envelope expression level of R57 (BaEV-Rless-57) is the highest; among BaEV-WT cells, the monoclonal envelope expression level of W64 (BaEV-WT-64) is the highest.
[0099] Table 4: RT-PCR reaction system
[0100] Composition Volume Final concentration 2×Mix 10μL / 10μM Primer(F) 0.5μL 0.25μM 10μM Primer(R) 0.5μL 0.25μM DNase-free water 4μL / Template DNA 5μL / Total 20μL /
[0101] Table 5: RT-PCR reaction program
[0102]
[0103] 5. Plotting the growth curve of monoclonal cells:
[0104] Select the top five monoclonal cells with the highest BaEV-Rless and BaEV-WT envelope copy numbers, and take 4×10 5Inoculate into six-well plates, using HEK293T cells as a control. Perform cell counting every two days and plot the growth curve ( Figure 10 ). The doubling time of all monoclonal cells was delayed compared to HEK293T. Among them, BaEV-WT-64 and BaEV-Rless-57 grew relatively fast and were used for subsequent virus production ability tests.
[0105] 6. Detection of transient virus production ability of monoclonal cells:
[0106] Select the above two monoclonal cells, BaEV-Rless-57 and BaEV-WT-64, for transient virus production tests. Seed the two types of cells into six-well plates respectively and perform transfection 24 hours later. Prepare the transfection system: the amount of pMFG-copGFP plasmid is 3.3 μg, and the ratio of Fugene HD to DNA is 3:1. Make up to 200 μL with DMEM medium. After mixing, let it stand at room temperature for 15 minutes, and add 200 μL to each well. Incubate in an incubator at 37 °C and 5% CO 2 . Replace the fresh DMEM complete medium 24 hours after transfection and incubate in an incubator at 32 °C for virus production. Collect the cell supernatant 48 hours later, filter the cell culture supernatant with a 0.45 μm filter membrane and perform titer detection.
[0107] 7. Titer detection:
[0108] Seed HEK293T cells into 24-well plates, with 2×10 5 cells per well. After 24 hours, discard the cell culture medium, add 1 mL of the virus liquid to be tested, and then add 1 μg / mL polybrene. Centrifuge at 2500 rpm at 32 °C for 1 hour. Incubate in an incubator at 37 °C. Replace the fresh medium 24 hours after virus transduction. After 48 hours, detect the GFP positive rate by flow cytometry to calculate the transduction efficiency ( Figure 11 ). Detect the positive infection rate of the retrovirus produced by transient transfection of pMFG-copGFP in BaEV-Rless-57 and BaEV-WT-64 monoclonal cells on HEK293T cells by flow cytometry, which reflects the biological titer of the virus. Virus titer calculation method: Virus titer (TU / mL) = number of infected cells × percentage of positive cells / volume of virus stock solution (Table VI).
[0109] During the transient virus production process of BaEV-WT-64 and BaEV-Rless-57 cells, no syncytium formation was found. According to the virus production titer detection, the virus titer packaged by BaEV-WT-64 was higher than that of BaEV-Rless-57, and subsequent stable transfection virus production tests were carried out.
[0110] Table VI: Detection results of transient virus production titers of BaEV-Rless-57 and BaEV-WT-64
[0111] Positive rate Titer (TU / mL) BaEV-Rless-57 9.52% 3.8e5 BaEV-WT-64 21.8% 8.72e5
[0112] Example 4: Construction of BaEV-copGFP retroviral vector packaging cell line
[0113] 1. Preparation of BaEV-copGFP retroviral vector:
[0114] The pMFG-copGFP plasmid is used to produce virus, and the virus expressing copGFP is used to test the WT and Rless envelopes. The "two-step method" is adopted to construct BaEV-Rless-copGFP and BaEV-WT-copGFP virus-producing cell lines, and Phoenix-Ampho and BaEV-Rless / BaEV-WT retroviral vector packaging cell lines are used successively. Transfect the pMFG-copGFP plasmid into Phoenix-Ampho cells and collect the cell supernatant to harvest amphotropic retroviral vectors. Mix it with BaEV-Rless / BaEV-WT cells, and promote the transduction of BaEV cells by the retroviral vector by horizontal centrifugation to obtain a stable BaEV retroviral vector packaging cell line. Flow cytometry was used to detect the transduction positive rates of BaEV-Rless-copGFP cells and BaEV-WT-copGFP cells, and the transduction positive rates of both cells reached 60% ( Figure 12 ), and virus preparation can be carried out subsequently.
[0115] 2. Preparation and titer detection of BaEV-copGFP retroviral vector:
[0116] Expand BaEV-Rless-57-copGFP cells and BaEV-WT-64-copGFP cells to T75 culture flasks and place them in a 32 °C incubator for virus production. After 48 h, collect the cell culture supernatants respectively, filter the cell culture supernatants with a 0.45 μm filter membrane and then carry out titer detection ( Figure 13 ). Flow cytometry was used to detect the infection positive rates of the retroviruses stably produced by BaEV-Rless-57-copGFP and BaEV-WT-64-copGFP on HEK293T cells, which reflected the biological titer of the virus. The calculation method of virus titer: virus titer (TU / mL) = number of infected cells × percentage of positive cells / volume of virus stock solution (Table VII). The transient transfection virus production titer and stable transfection virus production titer of BaEV-WT-64 cells are both higher than those of BaEV-Rless-57. Subsequently, BaEV-WT-64 was selected as the BaEV retroviral vector packaging cell line (BaEV-PackRV).
[0117] Table VII: Detection Results of the Virus Titers of BaEV-Rless-57-copGFP and BaEV-WT-64-copGFP Stable Transfectants
[0118] Positive rate Titer (TU / mL) BaEV-Rless-57-copGFP 2.42% 9.68e5 BaEV-WT-64-copGFP 17.7% 1.4e6
[0119] Example 5: Preparation of Retroviral Vectors by Transient Transfection of pMFG-CD19 CAR Plasmids
[0120] In this example, retroviral vectors were prepared by transient transfection of pMFG-CD19 CAR plasmids, and cell supernatants were collected. The transfection efficiency of Phoenix-Ampho cells and the biological titers of retroviral vectors at different harvesting times were investigated. The specific procedures are as follows.
[0121] I. Resuscitation and Culture of Phoenix-Ampho Cells
[0122] The cryopreserved adherent Phoenix-Ampho cells were taken out from the liquid nitrogen tank and rapidly thawed in a 37°C water bath. They were centrifuged at 1000 rpm / min for 5 min, the supernatant was discarded, and they were resuspended with an appropriate amount of DMEM complete medium containing 10% FBS (fetal bovine serum). Then they were transferred into a T75 flask and statically cultured in a 37°C, 5% carbon dioxide incubator until they grew into a confluent monolayer for transfection.
[0123] II. Transfection of Phoenix-Ampho Cells with pMFG-CD19 CAR Plasmids
[0124] 1. Inoculate Phoenix-Ampho cells in a 6-well cell culture plate at an inoculation density of 5×10 5 cells / well and place them in a 37°C, 5% carbon dioxide incubator for cell culture;
[0125] 2. After culturing the cells for ~24 h until the confluence of Phoenix-Ampho cells reaches 80-90%, perform transfection experiments;
[0126] 3. Take out the 6-well cell culture plate inoculated with Phoenix-Ampho cells from the carbon dioxide incubator, remove the old medium in the culture plate, and replace it with fresh DMEM complete medium containing 10% fetal bovine serum;
[0127] 4. Prepare the transfection complex: Take an appropriate volume of the transfection reagent FuGene HD and mix it evenly with the pMFG-CD19 CAR retroviral vector plasmid according to the requirements of the transfection reagent instructions, and statically incubate for ~10 min to obtain the transfection complex;
[0128] 5. Transfection: Drop the transfection complex obtained above into the 6-well cell culture plate containing Phoenix-Ampho cells. Add ~0.2 mL of the transfection complex to each well. After mixing, place the 6-well cell culture plate in an incubator at 37°C and 5% carbon dioxide for static culture;
[0129] 6. Medium replacement and culture: After 24 hours of transfection, take out the 6-well cell culture plate from the incubator, remove the old medium in the culture plate, and replace it with fresh DMEM complete medium containing 10% fetal bovine serum. The replacement volume is 2.5 mL / well. Then place the culture plate in an incubator at 37°C and 5% carbon dioxide for continued culture.
[0130] Investigation of the optimal harvesting time of transient transfection retrovirus: As shown in Table VIII, after culturing the culture plate in an incubator at 37°C and 5% carbon dioxide for different times, harvest the cell culture supernatant and Phoenix-Ampho cells in the 6-well plate at the above different time points to obtain a transient transfection retrovirus vector carrying the CD19 CAR foreign gene.
[0131] After transfecting Phoenix-Ampho cells with the pMFG-CD19 CAR plasmid, the specific myc tag in the plasmid will be expressed on the surface of Phoenix-Ampho cells. Use the anti-hc-Myc flow antibody to detect the transfection efficiency (positive transfection rate) of the pMFG-CD19 CAR plasmid transfected into Phoenix-Ampho cells. The results are shown in Table IX.
[0132] Detection of the biological titer of transient transfection retrovirus: Seed 293-T cells into a 24-well plate at a transduction cell number of 5×105 cells / well. Dilute the supernatant of the transiently transfected retrovirus 5-fold and infect 293-T cells with a virus volume of 500 uL / well, and add the polybrene co-transfection agent. Two days after infection, collect the infected 293-T cells and detect the positive rate of 293-T cells by flow cytometry. The calculation method of the biological titer is: Titer (TU / mL) = transduction cell number × positive rate × dilution factor ÷ virus volume. The results are shown in Table X.
[0133] Table VIII: Time points for harvesting the transient transfection retrovirus vector after medium replacement and culture
[0134] Group 1 2 3 4 5 6 7 8 Virus harvesting time / (h) 8 16 24 48 72 96 120 148
[0135] Table IX: Results of harvesting the transient transfection retrovirus vector after medium replacement and culture
[0136]
[0137] Table X: Detection of the biological titer of the retrovirus harvested at different times after transient transfection
[0138]
[0139]
[0140] According to the transfection positive rate in Table 9 and the results of the biological titer experiment in Table 10, when the virus vector was harvested 8 h and 16 h after changing the medium of Phoenix-Ampho cells transfected with the pMFG-CD19CAR plasmid, the transfection positive rate of Phoenix-Ampho cells was lower than 20%, indicating that the positive cells did not expand in a short time, and the biological titer of the transiently transfected retroviral vector was too low to meet the subsequent production requirements. The transfection positive rate of Phoenix-Ampho cells increased significantly 24 h after changing the medium and reached 67.3%. Continuing the culture, it was found that the transfection positive rate of Phoenix-Ampho cells was higher than 85% at 48 h, 72 h, and 96 h after changing the medium, and reached the highest value of 95.5% at 96 h, and the cell viability was higher than 90%. The biological titer gradually increased with the increase of the culture time and reached the highest value of 9.95E+05 TU / mL at 96 h, indicating that the transfection positive rate of Phoenix-Ampho cells was the highest during this period, the pMFG-CD19CAR gene was highly expressed in Phoenix-Ampho cells, and a high-titer transiently transfected retroviral vector could be harvested. Subsequently, as the time for harvesting the virus vector increased, when the culture reached 120 h and 148 h after changing the medium, the transfection positive rate of the cells decreased, probably because the amplification rate of untransfected Phoenix-Ampho cells exceeded that of transfected Phoenix-Ampho cells, and the transfected cells gradually died, resulting in a gradual decrease in the biological titer, indicating that a longer culture time may not be conducive to the harvest of high-titer retroviral vectors.
[0141] Based on all the results of this example, we believe that the optimal time for harvesting the virus vector after transfection and changing the medium is 48 - 96 h. At this time, the transfection positive rate of Phoenix-Ampho cells is higher than 90%, and the cell viability is higher than 90%. The biological titer is relatively high. The transiently transfected CD19 CAR retroviral vector harvested during this period can be applied to subsequent cell transduction.
[0142] Example 6 Transduction of BAEV-PackRV Cells with the Transiently Harvested CD19 CAR Retroviral Vector
[0143] In this example, the CD19 CAR retroviral vector transiently harvested in Example 5 was used to transduce BAEV-PackRV cells, and the effects of different combinations of virus centrifugation temperature, centrifugation time, and cell incubation time after centrifugation on the transduction efficiency of BAEV-PackRV cells were investigated. The process is as follows.
[0144] I. Resuscitation and culture of BAEV-PackRV cells: Take out the cryopreserved adherent BAEV-PackRV cells from the liquid nitrogen tank, quickly thaw them in a 37°C water bath, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend the cell pellet with an appropriate amount of DMEM complete medium containing 10% fetal bovine serum, transfer it into a T75 cell culture flask, and place it in a 37°C, 5% carbon dioxide incubator for static culture until the cells grow into a monolayer for transduction.
[0145] II. Transduction of BAEV-PackRV cells with CD19 CAR transient transfection retroviral vector
[0146] 1. Coating of transduction reagent: Coat a 12-well plate with RetroNectin transduction enhancer, that is, dilute RetroNectin to 20 μg / mL, add 1 mL to each well of the 12-well plate, and store it in a 2-8°C refrigerator.
[0147] 2. Centrifugal enrichment of transient transfection retroviral vector: After 24 h, take out the 12-well plate from the 2-8°C refrigerator, suck out the RetroNectin coating solution in the wells, add 1 mL of the transient transfection CD19 CAR retroviral vector prepared in Example 5 to the 12-well plate, centrifuge at 2000 rpm for 1 h to enrich the CD19 CAR retroviral vector in the 12-well plate, and then discard the unenriched retroviral vector to obtain a 12-well plate enriched with the CD19 CAR retroviral vector for use.
[0148] 3. Preparation of transduced cells: Take out the BAEV-PackRV cells from the 37°C, 5% carbon dioxide incubator, add trypsin for cell digestion, terminate the digestion with DMEM complete medium containing 10% fetal bovine serum, perform cell counting, take 1×10 5 BAEV-PackRV cells, and centrifuge to obtain a cell pellet for use.
[0149] 4. Primary centrifugal transduction: Take 1 mL of the transient transfection CD19 CAR retroviral vector, resuspend the above-prepared transduced BAEV-PackRV cells, mix the viral vector and BAEV-PackRV cells evenly, and then put them into the 12-well plate enriched with the CD19 CAR retroviral vector in the above "2". Then centrifuge at different temperatures for different times, and incubate the centrifuged BAEV-PackRV cells in a 37°C, 5% carbon dioxide incubator for different time periods to investigate the effects of different combinations of centrifugation temperature, centrifugation time, and incubation time on the transduction of BAEV-PackRV cells. The specific experimental design is shown in Table XI below.
[0150] 5. Non-centrifugation control group: Take 1 mL of the transiently transfected CD19 CAR retroviral vector, resuspend the BAEV-PackRV cells in the above-mentioned "3", mix the viral vector with the BAEV-PackRV cells, and then place them in the 12-well plate that has been enriched with the CD19 CAR retroviral vector in the above-mentioned "2", and incubate statically in an incubator at 37°C and 5% carbon dioxide for 24 h.
[0151] Table XI: Experimental design of the transduction of BAEV-PackRV cells with the CD19 CAR transiently transfected viral vector
[0152]
[0153]
[0154] Conduct a single centrifugation transduction experiment according to the grouping in Table XI above. After the experiment, discard the CD19 CAR transiently transfected retroviral vector in each 12-well plate, add fresh DMEM complete medium containing 10% fetal bovine serum, and place it in an incubator at 37°C and 5% carbon dioxide for static culture. After 48 h, digest the BAEV-PackRV cells in each well plate with trypsin, and detect the cell viability and transduction positive rate after centrifugation. Because the specific myc tag will be expressed on the surface of the transduced BAEV-PackRV cells, use the anti-hc-Myc flow antibody to detect the transduction positive rate and cell viability of the CD19 CAR transiently transfected retroviral vector transducing BAEV-PackRV cells. The results are shown in Table XII below.
[0155] Table XII: Effects of different centrifugation and incubation conditions on the transduction of BAEV-PackRV cells with the CD19 CAR transiently transfected retroviral vector
[0156]
[0157]
[0158] Result analysis: By comparing the detection results of the experimental centrifugation groups 1 - 27 and the control non - centrifugation group 28, when the transduced cells were incubated after centrifugation at 4°C, the cell viability of experimental groups 1 - 9 was all lower than 90%, and the positive rate was all lower than 10%, indicating that low - temperature conditions would lead to a decrease in cell viability and cause a large number of transduced cells to die; when the transduced cells were incubated after centrifugation for 0.5 h, although the cell viability of experimental groups 10 - 13, 16, 19 - 22, 25 was higher than 90%, the positive rate was all lower than 20%, indicating that both too short centrifugation time and incubation time during transduction were not conducive to transduction; for the control group 28, the transduction efficiency was low, indicating that non - centrifugation could not promote transduction. According to the results in Table XII, for experimental groups 14, 15, 17, 18, 23, 24, 26 and 27, the cell viability of each group was higher than 90%, and the positive rate was higher than 20%, but the transduction positivity could not reach more than 90%, which could not meet the requirements for subsequent high - titer virus vector harvesting.
[0159] To further improve the transduction positive rate of BAEV - PackRV cells, attempts were made to increase the number of centrifugation transductions, and the transduction effects of different centrifugation times, centrifugation temperatures, centrifugation times, and incubation times after centrifugation on the transduction of BAEV - PackRV cells with the CD19 CAR transient transfection retroviral vector, that is, the transduction positive rate, were investigated. The operations were carried out as follows:
[0160] 1. Coating of transduction reagent: Coat a 12 - well plate with RetroNectin transduction - promoting reagent, that is, dilute RetroNectin to 20 μg / mL, add 1 mL per well to the 12 - well plate, and store it in a 2 - 8°C refrigerator;
[0161] 2. Centrifugal enrichment of transient transfection retroviral vector: After 24 h, take out the 12 - well plate from the 2 - 8°C refrigerator, suck out the RetroNectin coating solution in the well plate, add 1 mL of the transient transfection CD19 CAR retroviral vector prepared in Example 1 to the 12 - well plate, centrifuge at 2000 rpm for 1 h to enrich the CD19 CAR retroviral vector in the 12 - well plate, and then discard the unenriched retroviral vector to obtain a 12 - well plate enriched with the CD19 CAR retroviral vector for later use;
[0162] 3. Preparation of transduced cells: Take out BAEV - PackRV cells from a 37°C, 5% carbon dioxide incubator, add trypsin for cell digestion, terminate digestion with DMEM complete medium containing 10% fetal bovine serum, perform cell counting, take 1×10 5 BAEV - PackRV cells, and use them after centrifugation to obtain cell pellets;
[0163] 4. Primary centrifugal transduction: Take 1 mL of the transient transfection CD19 CAR retroviral vector, resuspend the BAEV-PackRV cells in step 3, mix the viral vector with the BAEV-PackRV cells, and place them in the 12-well plate that has been enriched with the CD19 CAR retroviral vector in step 2. Examine the effects of different combinations of centrifugation temperature, centrifugation time, and incubation time on the transduction of BAEV-PackRV cells. The specific design is as shown in Table XIII below.
[0164] 5. Secondary centrifugal transduction: Take out the 12-well plate after the primary centrifugal transduction and incubation in step 4 from the 37°C, 5% carbon dioxide incubator, discard the supernatant of the viral vector in the well plate, add 1 mL of fresh transient transfection CD19 CAR retroviral vector, and examine the effects of different combinations of centrifugation temperature, centrifugation time, and incubation time on the transduction of BAEV-PackRV cells. The specific design is as shown in Table XIII below.
[0165] Table XIII Experimental design of multiple transductions of BAEV-PackRV cells with the CD19 CAR transient transfection viral vector Conduct the centrifugal transduction experiment according to the grouping in Table XIII above. After the experiment, discard the CD19 CAR transient transfection retroviral vector in each 12-well plate, add fresh DMEM complete medium containing 10% fetal bovine serum, and place it in a 37°C, 5% carbon dioxide incubator for static culture. After 48 hours, digest the BAEV-PackRV cells in each well plate with trypsin, and use the anti-hc-Myc flow antibody to detect the transduction positive rate and cell viability of the CD19 CAR transient transfection retroviral vector transducing BAEV-PackRV cells. The results are shown in Table XIV below.
[0166] Table XIV Results of different centrifugation and incubation times on the transduction of BAEV-PackRV cells with the CD19 CAR transient transfection retroviral vector
[0167]
[0168]
[0169] According to the experimental results in Table XIV, the transduction efficiency and cell viability detection results of two - time centrifugal transduction and one - time centrifugal transduction were analyzed. It was found that at 32°C and 37°C, the cell viability of BAEV - PackRV cells after transduction was higher than 90%. However, the positive rate (above 70%) of the experimental groups 1 - 8 with two - time transduction was much higher than that of the control groups 9 - 16 with one - time transduction (25 - 30%), indicating that increasing the number of centrifugations during transduction in the present invention can effectively improve the transduction positive rate of BAEV - PackRV cells. However, when the centrifugation temperature of the experimental groups 5 - 8 during transduction was 37°C, the transduction positive rate was about 70 - 80%, which was significantly lower than the transduction positive rate of more than 90% in the experimental groups 1 - 4, indicating that centrifugation at 32°C can significantly promote the transduction of BAEV - PackRV cells. Subsequently, by comparing the detection results of two - time centrifugal transduction of the experimental groups 1 - 4, it was found that there was no significant difference in the cell positive rate after centrifugation for 1 h, 2 h and incubation for 2 h, 3 h.
[0170] Transduction cell amplification: The BAEV - PackRV cells in the experimental groups 1 - 4 of Table XIV (with a relatively high transduction positive rate) were sub - cultured in T75 cell culture flasks at a ratio of 1:4, passaged once every 3 days, and cultured for 5 generations; samples were taken at each passage to detect the cell viability and positive rate, and the results are shown in Table XV below.
[0171] Table XV Results of cell sub - culture
[0172] Cultivation time (d) 3 6 9 12 15 Cell viability % 95.21 93.55 97.29 94.10 93.47 Transduction positive rate % 96.1 94.2 92.7 93.3 91.9
[0173] Through the above detection results of the transduction efficiency and cell viability of the CD19CAR transient transfection retroviral vector transducing BAEV - PackRV cells under different combinations of the number of centrifugations, centrifugation temperature, centrifugation time and incubation time, it was found that: two - time transduction, transduction temperature 32°C, single - time centrifugal transduction time of 1 - 2 h, and incubation time of 2 - 3 h after transduction can achieve high - efficiency transduction of the transient transfection retroviral vector to BAEV - PackRV cells, and the cells after transduction can maintain a relatively high viability and stable positive rate after sub - culture and amplification.
[0174] Example 7 Construction of BaEV - CD19 CAR and GALV - CD19 CAR virus - producing cell lines and virus preparation
[0175] 1. Construction of BaEV - CD19 CAR virus - producing cell line
[0176] As described in Example VI, the horizontal centrifugation method was used to promote the transduction of the retroviral vector into the BaEV stable packaging cell line, and a stable BaEV - CD19 CAR retroviral vector packaging cell line was obtained. After expanding the culture of the cells, the cell culture supernatant was collected to obtain the retroviral vector for subsequent transduction of immune effector cells.
[0177] As described in CN117467706A, the term "chimeric antigen receptor" or "CAR" refers to a group of engineered polypeptides or proteins that, when present in immune effector cells, bind to a specific antigen contained on target cells and generate an intracellular signal after recognizing the specific antigen, activating downstream pathways in the cell where the receptor is located to initiate the killing of the target cells by the immune effector cells. The immune effector cells include, but are not limited to, NK cells, macrophages, neutrophils, T cells, etc.
[0178] 2. Construction of GALV-CD19 CAR toxin-producing cell line
[0179] According to the method of "Construction of BaEV retroviral vector packaging cell line" described above, Phoenix-ECO and PG13 retroviral vector packaging cell lines were used sequentially. The pMFG-CD19 CAR plasmid was transfected into Phoenix-ECO cells and the cell supernatant was collected to harvest amphotropic retroviral vectors. It was mixed with PG13 cells and horizontal centrifugation was used to promote the transduction of the retroviral vector into PG13 cells, obtaining a stable GALV-CD19 CAR retroviral vector packaging cell line. The cells were expanded and virus preparation was carried out.
[0180] Example VIII: Testing of BaEV-CD19 CAR and GALV-CD19 CAR transduction of T cells
[0181] 1. Plate coating: Add RetroNectin (10 μg / mL) to a 12-well plate (without tissue treatment), 1 mL per well. Incubate overnight at 4°C in the dark.
[0182] 2. Transduction: The next day, remove the RetroNectin solution and rinse with PBS. Dilute the virus vector with medium to prepare stock solution, virus vector suspensions diluted two-fold and four-fold, denoted as stock solution, 1:2 dilution, and 1:4 dilution groups respectively. In the coated 12-well plate, add 1 mL of the above-mentioned BaEV-CD19 CAR retroviral vector and 1 mL of GALV-CD19 CAR retroviral vector respectively, place in a centrifuge at 32°C, centrifuge at 2500 rpm for 1 h, and remove the virus supernatant in the well plate. Take 4×10 5After activation, T cells were resuspended in 1 mL of BaEV-CD19 CAR retroviral vector or 1 mL of GALV-CD19 CAR retroviral vector. The cell suspension was then added to the corresponding wells, and polybrene (final concentration 6 μg / mL) was added. The 12-well plate was centrifuged at 2500 rpm at 32 °C for 1 h and then incubated in a 37 °C incubator for 2 h. The supernatant in the wells was discarded, and the corresponding retroviral vector (containing polybrene) was added. The plate was placed in a centrifuge at 32 °C and centrifuged at 2500 rpm for 1 h. After that, the cells were placed in a 37 °C incubator and incubated for 2 h.
[0183] 3. Culture: Discard the supernatant in the wells, add 1 mL of fresh complete T cell medium to resuspend the cells, and add h-IL2 (final concentration 500 U / mL), then continue the culture.
[0184] 4. Detection of transduction positive rate: 48 h after transduction, take 2×10 5 transduced T cells, incubate with FITC-CD19-FC antigen at 4 °C for 30 min, and then use a flow cytometer to detect the transduction efficiency of T cells ( Figure 14 ). The positive rates of transduction of T cells by two retroviruses, GALV-CD19 CAR and BaEV-CD19 CAR, were detected according to the undiluted virus, 1:2 dilution, and 1:4 dilution. When the titer of BaEV-CD19 CAR virus was lower than that of GALV-CD19 CAR virus, the positive rate of transduction of T cells by BaEV-CD19 CAR was significantly higher than that of GALV-CD19 CAR. After diluting the virus 4-fold, at a lower MOI, the positive rate of transduction of T cells by BaEV-CD19 CAR could maintain the same level as that of the undiluted virus.
[0185] Each time during subculture, take 2×10 5 transduced CAR-T cells, incubate with FITC-CD19-FC antigen or G4S antibody at 4 °C for 30 min, and then use a flow cytometer to detect the transduction efficiency of T cells. Up to 8 days after transduction, the CAR positive rate of CAR-T always maintained the same level as that on the second day after transduction. The results of the positive rates of transduction of T cells by GALV-CD19 CAR and BaEV-CD19 CAR are shown in Table XVI.
[0186] Table XVI Positive rates of transduction of T cells by GALV-CD19 CAR and BaEV-CD19 CAR
[0187]
[0188] 5. Amplification factor detection: After transduction, continuously detect the proliferation of CAR-T until the 8th day after transduction. There is almost no difference in the proliferation multiples of CAR-T transduced with BAEV-CD19-CAR and GaLV-CD19-CAR at different dilution multiples. As Figure 15 shown, it indicates that the BAEV envelope not only greatly improves the transduction efficiency of the retroviral vector on primary T cells but also does not affect the normal proliferation of CAR-T.
[0189] Example 9. Test on transduction of BAEV-CD19 CAR and GALV-CD19 CAR into NK cells
[0190] 1. Plate coating: Add RetroNectin (10 μg / mL) to a 12-well plate (without tissue treatment), 1 mL per well. Incubate overnight at 4°C in the dark.
[0191] 2. Transduction: The next day, remove the RetroNectin solution and rinse with PBS. Dilute the viral vector with the medium to prepare stock solution, two-fold diluted, and four-fold diluted viral vector suspensions, denoted as the stock solution, 1:2 dilution, and 1:4 dilution groups respectively. In the coated 12-well plate, add 1 mL of the above BAEV-CD19 CAR retroviral vector and 1 mL of the GALV-CD19 CAR retroviral vector respectively, place in a centrifuge at 32°C, centrifuge at 2500 rpm for 1 h, and remove the viral supernatant in the well plate. Take 4×10 5 activated NK cells, resuspend them with 1 mL of the BAEV-CD19 CAR retroviral vector or 1 mL of the GALV-CD19 CAR retroviral vector, add the cell suspension to the corresponding wells, and add polybrene (final concentration 6 μg / mL). After centrifuging the 12-well plate at 32°C at 2500 rpm for 1 h, incubate in a 37°C incubator for 2 h. Discard the supernatant in the well plate, add the corresponding retroviral vector (containing polybrene), place in a centrifuge at 32°C, centrifuge at 2500 rpm for 1 h. After completion, place the cells in a 37°C incubator and incubate for 2 h.
[0192] 3. Culture: Discard the supernatant in the well plate, add 1 mL of fresh complete medium for NK cells to resuspend the cells, and continue culturing.
[0193] 4. Transduction positive rate detection: 48 h after transduction, take 2×10 5 transduced NK cells, incubate with FITC-CD19-FC antigen at 4°C for 30 min, and then detect the transduction efficiency of NK cells with a flow cytometer ( Figure 16) The positive rates of transduction of two retroviruses, GALV-CD19 CAR and BaEV-CD19 CAR, into NK cells were detected by flow cytometry at undiluted, 1:2 dilution, and 1:4 dilution. When the titer of BaEV-CD19 CAR was half that of GALV-CD19 CAR, the positive rate of transduction of BaEV-CD19 CAR into NK cells was higher than that of GALV-CD19 CAR. After the virus was diluted 4-fold, the transduction positive rate remained stably above 90%. In contrast, the transduction positive rate of GALV-CD19 CAR was only 20%. In comparison, the BaEV envelope greatly improved the transduction efficiency of the retroviral vector into primary NK cells.
[0194] Each time of subculture, 2×10 5 transduced NK cells were taken and incubated with FITC-CD19-FC antigen at 4°C for 30 min. Then, the transduction efficiency of NK cells was detected by flow cytometry until 22 days after transduction. The CAR positive rate of CAR-NK transduced with the BaEV envelope remained at the same level as that on the second day after transduction. The results of the positive rates of transduction of GALV-CD19 CAR and BaEV-CD19 CAR into NK cells are shown in Table XVII.
[0195] Table XVII: Positive rates of transduction of GALV-CD19 CAR and BaEV-CD19 CAR into NK cells
[0196]
[0197] 5. Detection of amplification multiple: After transduction, the proliferation of CAR-NK was continuously detected until 22 days after transduction. There was almost no difference in the proliferation multiples of CAR-NK transduced with BAEV-CD19 CAR and GaLV-CD19 CAR at different dilution multiples, as Figure 17 shown, indicating that the BaEV envelope does not affect the normal proliferation of CAR-NK while greatly improving the transduction efficiency of the retroviral vector into primary NK cells.
[0198] Those skilled in the art will also recognize, or be able to ascertain, many equivalents to the specific embodiments of the invention described herein using no more than routine experimentation. These equivalents are also encompassed by the appended claims.
Claims
1. A method for packaging a BaEV retroviral vector, the method comprising the following steps: Step 1: Construction of BaEV retrovirus stable packaging cell line; Step 2: transfecting a retroviral vector plasmid containing a target sequence into a virus production cell line, wherein the virus production cell line is a HEK293T cell line or a cell line derived therefrom, to harvest a transiently transfected retroviral vector; Step 3: the retroviral vector obtained in step 2 is mixed with the BaEV retroviral stable packaging cell line obtained in step 1, and horizontal centrifugation is performed to promote the retroviral vector to transduce the BaEV retroviral stable packaging cell line; Step 1 includes the following steps: Step 11: Transform the structural protein gag-pol protein encoding gene required for the construction of retrovirus into the HEK293T cell line or its derivative cell line to obtain the corresponding cell line containing the structural protein gag-pol protein encoding gene; Step 12: Based on the cell line obtained in step 11, a HEK293T cell line or a cell line derived therefrom in which the ASCT-1 and ASCT-2 receptor protein encoding genes are simultaneously knocked out is constructed to obtain a cell line in which the ASCT-1 and ASCT-2 receptor protein encoding genes are correspondingly knocked out; Step 13: transferring the BaEV envelope into the cell line obtained in step 12 to obtain the BaEV retrovirus stable packaging cell line; In step 3, when horizontal centrifugation is used to promote the transduction of the retroviral vector into the BaEV retroviral stable packaging cell line, the retroviral vector obtained in step 2 is first mixed with the BaEV retroviral stable packaging cell line obtained in step 1 for the first centrifugal transduction and incubation to obtain the first transduced BaEV retroviral stable packaging cell line; then the retroviral vector obtained in step 2 and the first transduced BaEV retroviral stable packaging cell line are subjected to a second centrifugal transduction and incubation to finally obtain the BaEV retroviral stable packaging cell line in step 3.
2. The method according to claim 1, characterized in that The step 11 comprises: Step 111, transfecting HEK293T cell line or its derivative cell line with a plasmid containing the gag-pol gene; Step 112, after transfection, adding antibiotics to screen HEK293T cell lines or cell lines derived therefrom that highly express the gag-pol target gene; Step 113, digesting the HEK293T cell line or its derivative cell line obtained in step 112, culturing the digested cells, and selecting monoclonal cells; Step 114, performing transient transfection toxin production titer test on the monoclonal cells obtained in step 113, screening monoclonal cells with high toxin production titer, and obtaining the corresponding cell line containing the structural protein gag-pol protein coding gene.
3. The method according to claim 1, characterized in that The step 12 comprises: Step 121, knocking out the ASCT-1 gene in the cells containing the gene encoding the structural protein gag-pol protein obtained in step 11; Step 122, flow sorting and culturing the cells obtained in step 121 to obtain monoclonal cells; Step 123, selecting the monoclonal cells obtained in step 122, performing a targeting test, and obtaining monoclonal cells homozygous for ASCT-1 gene knockout; Step 124, knocking out two exons of the ASCT-2 gene in the monoclonal cells obtained in step 123, and further selecting the monoclonal cells to obtain cells in which the ASCT-1 and ASCT-2 receptor protein encoding genes are knocked out.
4. The method according to claim 1, characterized in that: The step 13 comprises: Step 131, transfecting the cells with ASCT-1 and ASCT-2 receptor protein encoding gene knockout obtained in step 12 with BaEV envelope plasmid; Step 132, after transfection, adding antibiotics to screen for retroviral vector packaging cell lines that highly express the BaEV envelope; Step 133, digesting the BaEV enveloped retroviral vector packaging cell line obtained in step 132, culturing the digested cells, and selecting monoclonal cells; Step 134, performing a transient toxin production titer test on the monoclonal cells obtained in step 133, screening monoclonal cells with high toxin production titers, and obtaining the BaEV retrovirus stable packaging cell line.
5. The method according to claim 4, characterized in that In step 131, the BaEV envelope plasmid is a wild-type BaEV envelope plasmid.
6. The packaging method according to claim 1, characterized in that: The reverse transcription vector plasmid including the target sequence in step 2 is pMFG-CD19 CAR plasmid, and the virus preparation cells in step 2 are Phoenix-Ampho cells.
7. The packaging method according to claim 6, characterized in that: When the pMFG-CD19 CAR plasmid is transfected into the Phoenix-Ampho cells and the transfected Phoenix-Ampho cells are cultured in a medium-changing manner for 48-96 hours, the cell culture supernatant and Phoenix-Ampho cells are harvested to harvest the transiently transfected toxin-producing retroviral vector of step 2.
8. The packaging method according to claim 1, characterized in that: The temperature of the first centrifugal transduction or the second centrifugal transduction is 32° C., the centrifugal transduction time is 1 to 2 hours, and the post-transduction incubation time is 2 to 3 hours.
Citation Information
Patent Citations
Lentiviral vector pseudotyped with mutant BaEV glycoprotein
CN104080917B
BaEV envelope glycoprotein and application thereof
CN117467706A
LENTIVIRAL VECTORS PSEUDOTYPED WITH MUTANT BaEV GLYCOPROTEINS
WO2013045639A1
Efficient BaEV envelope virus packaging method
CN117467705A
Cited By
Methods of producing engineered viroid particles by stabilizing cell lines and engineered viroid particles thereof
CN120866241A
A method for producing engineered virus-like particles using stable cell lines and the engineered virus-like particles thereof.
CN120866241B
Method for preparing immune cell treatment products in batches without electrotransduction and product thereof
CN120866421A
Method for electroless transfer, batch production of immune cell therapy products and products thereof
CN120866421B
Cell strain for producing engineered virus-like particles, method thereof and engineered virus-like particles
CN121472154A