A primer and method for detecting CYP2D6 genotyping

CN119061132BActive Publication Date: 2026-06-23XIAN HAORUI GENE TECH LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411132138.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-16
Publication Date
2026-06-23
Estimated Expiration
2044-08-16

AI Technical Summary

Technical Problem

Existing CYP2D6 genotyping technologies suffer from low accuracy, insufficient sequencing length, and an inability to accurately distinguish between homologous genes and multi-exon joint mutations, leading to inaccurate personalized medication guidance.

Method used

Using Pacific Biosciences' HiFi sequencing technology and multiple primer-based single-tube multiplex PCR method, specific amplification primers were designed and combined with third-generation sequencing technology to directly obtain the complete CYP2D6 gene sequence. Through magnetic bead purification and library construction, high-coverage and high-sensitivity genotyping detection was achieved.

Benefits of technology

It achieves high coverage and high sensitivity genotyping of the CYP2D6 gene, can accurately distinguish genes with high homology, reduce human and material costs, and provide complete genetic information for personalized medication guidance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119061132B_ABST
    Figure CN119061132B_ABST
Patent Text Reader

Abstract

The application relates to a primer and a method for CYP2D6 gene typing detection, wherein a CYP2D6 gene fragment is obtained through specific primer PCR amplification; a three-generation sequencing library is constructed from the obtained target PCR product; magnetic bead purification is carried out on the established library; mixed library is carried out on the purified library; the mixed library is taken for machine sequencing; the short board that the traditional sequencing method is not high in accuracy and short in sequencing length is solved; a complete CYP2D6 gene sequence or a missing and recombined sequence can be obtained without assembling, the resolution and the accuracy are effectively improved; new alleles can be completely detected, haplotypes are distinguished, accurate typing is realized, and various types have no place to hide; meanwhile, the detection flux of the scheme is large, multiple samples can be detected at the same time, the experimental process can be automated, and manpower, material resources and financial resources are greatly reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of genotyping detection technology, and in particular to a primer and method for CYP2D6 genotyping detection. Background Technology

[0002] CYP2D6 (Cytochrome P450 2D6) is an enzyme encoded by the CYP2D6 gene. While it accounts for only 2-9% of the total P450 liver protein in the liver, it is involved in the metabolism of approximately 20-30% of commonly used drugs, including antidepressants, antiarrhythmics, antipsychotics, and analgesics. CYP2D6 enzyme activity varies significantly among individuals, primarily due to the transcriptional encoding of the CYP2D6 gene, leading to substantial differences in its function. The CYP2D6 gene exhibits high polymorphism, including single nucleotide polymorphisms (SNPs), insertions / deletions (Indels), copy number variations (CNVs), structural variations (SVs), and fusion with neighboring homologous CYP2D7 pseudogenes. Currently, the PharmVar database contains over 300 CYP2D6 alleles. Different allele variations cause differences in enzyme activity and quantity, resulting in several types of enzyme activity in the encoded protein, including deletion, reduction, normality, and increase, thus affecting drug efficacy. Detecting single nucleotide polymorphisms (SNPs), oligonucleotide insertions, and deletions in the CYP2D6 gene can detect the loss or reduction of CYP2D6 enzyme activity, while detecting copy number increases and deletions can detect increases and decreases in CYP2D6 enzyme activity. Detection of CYP2D6 gene variations can predict the pharmacokinetic characteristics of candidate drugs and their metabolites in vivo. Studying the activity and toxicity of these metabolites will also help us find safer, more rational, and more effective genetic molecular mechanisms underlying oxidative metabolic polymorphisms in the CYP2D6 enzyme system. Therefore, comprehensive detection of CYP2D6 gene variations is of great significance in clinical applications. However, due to frequent copy number variations (CNVs) and highly homologous pseudogenes, accurate CYP2D6 allelic typing has proven challenging. Furthermore, current methods for comprehensive CYP2D6 gene variation detection are costly and unreliable, limiting the resources available to many researchers. Simultaneously, economic reasons have slowed the development of gene testing for personalized medicine.

[0003] In recent years, with technological innovation, genotyping has become increasingly common. Currently, the representative CYP2D6 genotyping technologies mainly fall into the following categories:

[0004] 1. PCR sequence-specific primer analysis (PCR-SSP);

[0005] The principle of this method is based on the base specificity that determines the CYP2D6 allele. Sequence-specific primers are designed with the first base at the 3' end matching the specific base of each allele. During the PCR reaction, complete DNA replication can only be achieved when the first base at the 3' end of the primer is complementary to the base determining the specific allele. Allele typing is performed by detecting the presence or absence of the PCR product using agarose gel electrophoresis. This method is characterized by its simplicity, low cost, and short processing time. It provides an initial interpretation of the results but can only analyze known specific alleles. It cannot detect new alleles and cannot effectively distinguish them from the highly homologous CYP2D7 gene, resulting in a high number of false positives and false negatives.

[0006] 2. Nucleic acid sequencing technology (PCR-Sequencing-Based Typing; PCR-SBT)

[0007] This refers to Sanger sequencing, a first-generation sequencing technology. This method primarily involves PCR amplification of a specific fragment of the CYP2D6 gene, followed by DNA sequencing analysis of the PCR product to determine its allele genotype. First-generation sequencing can directly obtain gene sequence information for relevant regions, improving the accuracy of genotyping and even directly discovering new alleles. However, because Sanger sequencing can only obtain 600-800 bp of sequence information per run, while the full-length CYP2D6 gene is approximately 5.4 kb, obtaining complete CYP2D6 gene information requires designing primers and sequencing at multiple locations, resulting in high costs and complex operations. Due to this limitation, it cannot distinguish haplotypes in samples, thus failing to effectively differentiate between multiple SNP joint mutations, copy number variations, gene deletions, and recombination with highly homologous genes. This leads to ambiguous results for heterozygous samples, making accurate genotyping impossible.

[0008] 3. Next-Generation Sequencing (NGS)

[0009] Currently, the NGS sequencing platform from Illumina is the dominant technology in the market. This technology involves ligating specific oligonucleotide sequences (i.e., adapters) to both ends of the CYP2D6 gene product and loading the product onto a flowcell with complementary adapter sequences on its surface. DNA replication occurs via a bridged polymerase chain reaction, amplifying the signal and converting the light signal into a base sequence, achieving high-speed, high-throughput sequencing. This method has high throughput, resulting in relatively low cost per sample, and can also discover new alleles. However, this technology can only obtain sequences of 150-250 bp in length, requiring further assembly of the raw sequence to obtain complete CYP2D6 gene information. This process requires statistical calculations, making it difficult to distinguish haplotypes effectively. Therefore, it cannot completely resolve issues such as exon joint mutations, copy number variations, gene deletions, and homologous gene exchange, often resulting in ambiguous or erroneous results.

[0010] Due to the complexity of CYP2D6 genotyping and the limitations of existing common testing technologies, rapid and accurate genotyping is not possible. The inaccuracy and ambiguity of the results may mislead personalized medication guidance, leading to patients potentially overdosing or underdosing, thus failing to achieve optimal therapeutic effects. Therefore, accurate genotyping results can guide clinicians in selecting appropriate drugs and dosages to maximize efficacy and safety. We are therefore attempting to develop new technologies to overcome the shortcomings and bottlenecks of other methods, making CYP2D6 genotyping more accurate and sensitive.

[0011] While PCR-SSP offers advantages such as simplicity, low cost, short processing time, and ease of analysis, it cannot detect novel alleles or perform genotyping, and the number of alleles it can detect is limited. Detecting too many alleles would result in a massive workload and a significant increase in labor and reagent costs. Furthermore, the specificity of the detection sites increases the difficulty of primer design. PCR-SBT also offers advantages such as simplicity, low cost, short processing time, and ease of analysis, and can detect novel alleles. However, it also cannot perform genotyping. Due to technological limitations, it primarily relies on exon amplification, making it difficult to distinguish variants resulting from multi-exon mutations, leading to ambiguous results. NGS technology can detect novel alleles, but due to read length limitations, assembly is highly dependent on data computation. Assembling many small fragments can introduce numerous ambiguous results, especially when gene recombination occurs, causing further confusion during assembly.

[0012] Currently, gene sequencing technology has steadily advanced to the latest third-generation sequencing (TGS) technology, with gene sequence read lengths exceeding 10,000 bp, far surpassing SBT and NGS. We chose to use Pacific Biosciences' sequencing technology platform, whose HiFi sequencing mode achieves a read accuracy of QV30 (99.9%), and single subread lengths can reach 15-50 kb. This effectively addresses the shortcomings of traditional sequencing methods, such as low accuracy and short read lengths. Complete CYP2D6 gene sequences, or deleted and recombinant sequences, can be obtained without assembly, and resolution and accuracy are significantly improved. Currently, there are no products on the market using Pacific Biosciences technology for CYP2D6 genotyping; therefore, leveraging its technological advantages, we have developed a series of CYP2D6 genotyping workflows. Summary of the Invention

[0013] This invention provides a multiplex PCR method using multiple primer pairs in one tube for CYP2D6 genotyping, which can accurately distinguish genes with high homology and improve the coverage, sensitivity and accuracy of CYP2D6 genotyping.

[0014] This application is achieved through the following technical solution: a detection primer for CYP2D6 gene typing, comprising the following specific amplification primer sequences for the CYP2D6 gene:

[0015] Upstream primer CYP2D6-1-F2: GATGCCTTGAGGTCGTCTTCTTTGG;

[0016] Downstream primer CYP2D6-1-R2: CACGGGCGATAATGTGGCAACTC;

[0017] Upstream primer CYP2D6-2-F1: GGGAGAAAGGAGTAAAGGAATAGTTGAAGAAT;

[0018] Downstream primer CYP2D6-2-R1: CAAAGGTTGGTGTTGAGAAGTCTGATGAAT.

[0019] A method for CYP2D6 genotyping detection includes:

[0020] PCR amplification of the CYP2D6 gene fragment;

[0021] Third-generation sequencing libraries were constructed using the obtained target PCR products;

[0022] The established library was purified using magnetic beads;

[0023] The purified library is then mixed with other libraries.

[0024] Take the mixed library and sequence it.

[0025] Preferred methods for PCR amplification of the CYP2D6 gene include:

[0026] Design specific amplification primers for the CYP2D6 gene. The sequences of the specific amplification primers for the CYP2D6 gene are as follows:

[0027] Upstream primer CYP2D6-1-F2: GATGCCTTGAGGTCGTCTTCTTTGG;

[0028] Downstream primer CYP2D6-1-R2: CACGGGCGATAATGTGGCAACTC;

[0029] Upstream primer CYP2D6-2-F1: GGGAGAAAGGAGTAAAGGAATAGTTGAAGAAT;

[0030] Downstream primer CYP2D6-2-R1: CAAAGGTTGGTGTTGAGAAGTCTGATGAAT;

[0031] Primers were synthesized, and phosphorylation modification with 5′ bases was performed during synthesis;

[0032] The synthesized primers were mixed to obtain a primer mixture;

[0033] PCR amplification was performed by adding PCR amplification system reagents to the primer mixture.

[0034] Preferred methods for constructing a library include:

[0035] Barcode adapter dilution: Dilute the dry powder barcode adapter to a concentration of 100 μM using TE buffer.

[0036] Barcode annealing converts a single-chain barcode adapter into a double-chain one.

[0037] The connector connection reacts to create a unique barcode adapter for each sample;

[0038] Exonuclease digestion removes products from failed adapter ligation, yielding a high-quality library.

[0039] Preferably, the methods for purifying the established library include:

[0040] The exonuclease digestion products were purified using 0.45* magnetic beads to remove reagents from the library construction process and small sequence fragments, resulting in a high-quality library. Single-sample libraries were quantified using Qubit.

[0041] The beneficial effects of this application are:

[0042] This method effectively addresses the shortcomings of traditional sequencing methods, such as low accuracy and short sequencing length. It can obtain complete CYP2D6 gene sequences or deleted / recombined sequences without assembly, and effectively improves resolution and accuracy. It can completely detect new alleles, distinguish haplotypes, and accurately genotype, leaving no genotype undetected. At the same time, this method has a high throughput, can detect multiple samples simultaneously, and can automate the experimental process, greatly reducing manpower, material resources, and financial resources. Attached Figure Description

[0043] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0044] Figure 1 This is a diagram of the product of the CYP2D6 gene;

[0045] Figure 2 This is a schematic diagram of the two haplotypes of NA17221 in an embodiment of this application;

[0046] Figure 3 This is a schematic diagram of the two haplotype typings of sample No. 2 in the embodiments of this application; Detailed Implementation

[0047] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the examples set forth herein; rather, these embodiments are provided to make this application more comprehensive and complete, and to fully convey the concept of the exemplary embodiments to those skilled in the art.

[0048] A primer for CYP2D6 gene typing is provided in this embodiment. The primers are specific amplification primers for the CYP2D6 gene. The primers are synthesized with 5' phosphorylation. The primer sequences are as follows.

[0049]

[0050] During the synthesis of the / 5Phos / indicator, the 5′ base is phosphorylated.

[0051] Through primer design, the amplified region extends to the upstream region of the CYP2D7 gene, effectively providing complete CYP2D6 gene information. Furthermore, due to the characteristics of this technology, all CYP2D6 information (including exon and intron regions) is obtained. Currently, most CYP2D6 genotyping only requires exon region information, while the technology in this example provides more comprehensive intron information, as well as flanking sequences of gene deletion regions or regions that may recombine with CYP2D7, clearly identifying common copy number variations and perfectly distinguishing haplotypes. This provides a complete solution for future research on the function of the CYP2D6 gene, a feature not available in traditional technologies.

[0052] This embodiment also provides a method for CYP2D6 genotyping detection, including:

[0053] PCR amplification of the CYP2D6 gene fragment;

[0054] The amplification method used in this embodiment includes:

[0055] Design specific amplification primers for the CYP2D6 gene. Primer synthesis selected 5' phosphorylation. The primer sequences are as follows.

[0056] primer Sequence(5′-3′) CYP2D6-1-F2 / 5Phos / GATGCCTTGAGGTCGTCTTCTTTGG CYP2D6-1-R2 / 5Phos / CACGGGCGATAATGTGGCAACTC CYP2D6-2-F1 / 5Phos / GGGAGAAAGGAGTAAAGGAATAGTTGAAGAAT CYP2D6-2-R1 / 5Phos / CAAAGGTTGGTGTTGAGAAGTCTGATGAAT

[0057] Note: The 5′ base is phosphorylated during the synthesis of the / 5Phos / indicator.

[0058] Primer mixing system

[0059] Before use, the synthesized primer powder is centrifuged at high speed and diluted to the working solution concentration using EB buffer. The diluted primers are then used to prepare primer MIX according to the system in the table below.

[0060]

[0061] After preparing the primer mix, add the reagents listed in the PCR amplification system table below to the reaction tubes in sequence, cap the tubes, mix well, and centrifuge.

[0062] Reagent Name Volume added to a single sample (uL) 2×PCR Buffer for KOD FX Neo 12.5 dNTPs (2mM) 5 Primer Mix 0.16 KOD Neo FX 0.5 DNase / RNase-Free Deionized Water 6.84-X gDNA X(50ng) Total 25

[0063] Set the PCR instrument program according to the parameters in the table below for amplification: heated lid: 105℃, heating / cooling rate: 6.0℃ / s.

[0064]

[0065] PCR product quality control: The PCR products were analyzed using 1% agarose gel electrophoresis to determine whether the target gene was amplified. Voltage: 150V Time: 50min. The following figure shows the amplification results for an example. (5ul of amplification product + 5ul of 6× loading buffer were used for gel electrophoresis).

[0066] Library Construction

[0067] 1. Barcode Preparation

[0068] 1) Barcode adapter dilution

[0069] Centrifuge the barcode adapter dry powder tubes at 10000 rpm for 5 min, add a certain volume of TE buffer to dilute the dry barcode powder to a concentration of 100 uM, vortex to mix, and then briefly centrifuge; a total of 96 barcode adapters were collected, and the sequence types are shown in the table below as examples:

[0070]

[0071] Note:

[0072] a. The barcode adapter sequence information is provided by PacBio; / 5Phos / indicates that the 5′ base is phosphorylated during barcode synthesis.

[0073] b. The above underscores mark the barcode sequence.

[0074] 2) Barcode annealing

[0075] Prepare 10× annealing buffer according to the table below, and dilute the 100uM barcode adapter solution 5 times with 10× annealing buffer and RNAase-free water. Vortex to mix and then centrifuge briefly. Then place the mixture on a PCR instrument and anneal the single-stranded barcode adapter to double strands according to the following annealing program. After the annealing program is completed, immediately place the product on ice for 5 min, and then store it at -20℃.

[0076] a.10×annealing buffer ingredients

[0077] Tris-HCl, pH 7.5 100mM NaCl 1M RNAase-Free Water Supplementary system

[0078] b. Annealing system

[0079]

[0080] c. Annealing procedure

[0081] The annealing temperature is decreased in increments of 5℃.

[0082]

[0083]

[0084] 2. Connector connection reaction

[0085] 1) Configure the connectors on the ice to connect the reaction MIX according to the table below:

[0086] Reaction reagents Volume added to a single sample (uL) 10×T4 DNA Ligase Buffer 1.5 dNTP Mix (10mM each) 0.1 dATP (100mM) 0.1 T4 DNA Polymerase 0.3 T4 Po1ynucleotide Kinase 0.3 T4 DNA Ligase (Rapid) 1.25 Total 3.55

[0087] 2) The following table shows the connection system: Add the listed materials in order, close the tube cap, mix well and centrifuge.

[0088] Amplification products 8.95 μL (200–300 ng) Barcode connector 2.5μL Ligase Mix 3.55μL Total 15μL

[0089] 3) The table below shows the connection reaction procedure. After setting the parameters in advance, proceed with the connection reaction. Hot cap: 75℃, heating / cooling rate: 6℃ / s

[0090] temperature time Cycle number 37℃ 25min 1× 25℃ 20min 1× 65℃ 10min 1× 4℃ ∞

[0091] 2. Exonuclease digestion reaction

[0092] 1) Exonuclease system: Incorrect ligation may occur during the ligation process, so the incorrect ligation products are digested with exonuclease. Prepare the exonuclease MIX on ice according to the table below. After the ligation reaction is complete, place the tube on ice, add 2 μL of exonuclease MIX to each tube, cap the tube, mix well, and centrifuge.

[0093] Reagent Name Volume added to a single sample (uL) Exonuclease | 1.5μL Exonuclease||| 0.5μL Total 2μL

[0094] 2) External digestion procedure: The table below shows the digestion reaction parameters. These should be set in advance for the digestion reaction. Heating cap: 45℃, heating / cooling rate: 6℃ / s.

[0095] temperature time Cycle number 37℃ 60min 1× 4℃ ∞

[0096] Magnetic bead purification should be performed as soon as possible after the digestion reaction is complete.

[0097] Library purification

[0098] 1. Take VAHTS™ DNA Clean Beads (hereinafter referred to as magnetic beads) out of the refrigerator half an hour in advance and place them on a vertical mixer to mix slowly at room temperature for 30 minutes;

[0099] 2. After adding the digested product to the PCR tube, add 1 volume of DNase / RNase-Free Deionized Water (a deionized water that does not contain DNase and RNase), then add 15.3 μL of magnetic beads (0.45x), gently tap to mix or vortex at low speed, and let stand at room temperature for 10 min, gently tapping to mix 2-3 times during the process.

[0100] 3. Briefly centrifuge the PCR tube (to gather the liquid in the tube to the bottom of the tube by short-term high-speed centrifugation), then place it on a magnetic rack to adsorb magnetic beads for 10 minutes. During this time, prepare 70% alcohol. The alcohol should be prepared fresh for each use.

[0101] 4. Discard the supernatant, and then add 200 μL of 70% alcohol along the opposite side of the tube wall where the magnetic beads are adsorbed. Do not dislodge the magnetic beads when adding the alcohol.

[0102] 5. Repeat the previous step to perform a second alcohol cleaning;

[0103] 6. Discard the alcohol, centrifuge the PCR tube, then put it back into the magnetic rack and discard the residual liquid;

[0104] 7. After opening the PCR tube, allow it to dry for no more than 30 seconds, then add 12 μL of EB Buffer;

[0105] 8. Gently tap the magnetic beads to mix them, keeping the system in a mixed state. Let it stand at room temperature for 10 minutes, tapping it 2-3 times during this period.

[0106] 9. Briefly separate the PCR tube and place it on a magnetic rack to adsorb magnetic beads for 10 minutes;

[0107] 10. Transfer 10 μL of the supernatant to a new PCR tube;

[0108] 11. Use Qubit to quantify single-sample libraries, and pool 6 ng of the same quality from each single-sample library to form a mixed library.

[0109] Mixed inventory

[0110] 1. Measure an accurate volume of x μL (>400 ng) of the mixed library using a pipette, and add x*0.6 μL of magnetic beads (0.6x); the purification process is the same as the library purification process, and finally elute the library with 50 μL of EB;

[0111] 2. Take x μL (>200 ng) of the library obtained in the previous process and add x*0.45 μL of magnetic beads (0.45x) to it; the purification process is the same as the library purification process, and finally the library is eluted with 20 μL of EB;

[0112] 3. Quantify the final library using Qubit, requiring three replicates. Take the average value as the final library concentration, which should be higher than 3 ng / μL.

[0113] 4. Use the 5200Fragment Analyzer System to analyze the library and calculate the average fragment size.

[0114] For sequencing, it is recommended to use 150pM of data, use HiFireads mode, and have an average fragment size of 5000bp.

[0115] The test results, after sequencing, are as follows: Figure 1 As shown, where Figure 1 M is the marker point.

[0116] In this embodiment, the sequencing results and operation procedures are described as follows:

[0117] The amplified products are used to construct libraries. The data obtained after sequencing these libraries are converted into high-accuracy HiFi data. Data analysis is then performed to obtain mutation site and structural variation information. Finally, the data is compared with standard databases to obtain the corresponding haplotype or a new haplotype. The sample types for sequencing are listed in the table below. The table only illustrates representative haplotype types. This invention can detect various haplotypes, such as those listed in the pharmvar database, as well as new haplotypes not included in the pharmvar database. Examples and detection results are as follows:

[0118]

[0119]

[0120] In this embodiment, typical sequence listings of partial sequencing of samples NA17221 and 16 are provided as examples.

[0121] The sequence listing of the NA17221 sample includes the NA17221 sample haplotype 1: copy1 sequence CYP2D6*1 genotyping; the NA17221 sample haplotype 1: copy2 sequence CYP2D6*1 genotyping; and the NA17221 sample haplotype 2 sequence: CYP2D6*2 genotyping; the underlined portion in the NA17221 sample haplotype 1 sequence listing is the DUP region; Figure 2 This is a schematic diagram of the two haplotypes of NA17221.

[0122] The sequencing sequence listing of sample 16 includes haplotype 1 sequence of sample 16: CYP2D6*5 genotype, and haplotype 2 sequence of sample 6: CYP2D6*5 genotype, where the underlined part is the CYP2D6 gene deletion region; Figure 3 This is a schematic diagram of the two haplotype deletion regions of the CYP2D6 gene.

[0123] In this embodiment, for two samples with complete haplotypes, two complete full-length sequences of haplotypes can be obtained at once, and the corresponding typing (including whether the mutation site is a single SNP or multiple SNPs) can be given.

[0124] For a sample with one haplotype deletion and one haplotype complete, the flanking sequence of one haplotype deletion sequence and the full-length sequence of another haplotype complete can be obtained at once, and the corresponding typing (including whether the mutation site is a single SNP or multiple SNPs) can be given.

[0125] For a sample with two haplotype deletions, the flanking sequences of the two haplotype deletion sequences can be obtained at once, and the corresponding typing can be given.

[0126] For samples with copy number variations, sequences with a total copy number in the range of 2-5N can be obtained in one go, and the copy number of haplotypes can be distinguished while providing the corresponding genotypes; (e.g., haplotype 1 has a copy number of 2N, haplotype 2 has a copy number of 3N; haplotype 1 has a copy number of 1N, haplotype 2 has a copy number of 3N; etc.)

[0127] For samples that recombine with the homologous gene CYP2D7, the recombination sequence can be obtained in one go, and the corresponding genotype can be given.

[0128] The following are the sequences mentioned above:

[0129] NA17221 sample haplotype 1: copy2 sequence CYP2D6*1 genotyping

[0130] DUP area

[0131]

[0132]

[0133] Haplotype 1 sequence of sample 16: CYP2D6*5 genotyping

[0134] CAAAGGTTGGTGTTGAGAAGTCTGATGAATATTGAATTCCTGAAGCTCAGACTTTTTTCTCTCTGGAAGTTTTTGGGTTCCACTCTGTCCTCAGTGTTGTGAAATTTCTTGACAACAAAATTGGGGCTGGGTCCCCTTCATTCATTGTCATGAACACTTGGTGTTTCCTTCTCTACTGGAAACTCATGTTCTTCCTCTGTGAGAACTTGTCTTGACAAAAAAGAAACGTATTTATTAGACATCTTTCCTTGCCTCCTAGTCTGTTGTCTCTGCTGCCTGTTTCAGAAACATCTAAACAACAATTTAGCTGTTGGAGCTCCTGACCTCTTCTCTGTTCTTTCTGGAAAATATTTTTTTCAAGTTTAGCTTCTATACTTTGATTAGATTTTGCATTCCTATTATTATATTTTTTATTTTTAAGGCAAGGTCTTTCTCTGTTGCCCAGGCTGGAGTGCAGTGGCACGATCACAGTTCACTGCAGCTTTGTTCCTGGACTCAAGTGATCCTCCCACCTCAGCCTCCCAAGCAGCTGGAACTACAGGTGTGTGCCACCACACCCAGCCAGTATTTTAATTTTTTGTAGAGATGGGGTCTCCTTAGGTGGCCCAGGCTGGTGTTGAATTCCTAGGCTCAAACAATCCTCCTGCCTTAGCCTCCCAAAATGCTGGGATTACAGGCATGAGCTAAGGCACCCAGACTATATTTTTGTCAAGAATTAGTGGTGGTGGGTGTTTGAACATTTTTATTTTAGACCCTCCTATTCTTATTTCATGAATGCAAAGTTTTATCTTTCTAAAGATATCAATTATAGATTTTTTTTTTAAGACAGTTTCACTCTTGTTGACCAGGCTGGAGTGCAATGATGCGATCTCGGCTCACTGCAGCCTCTGCCTCCCAGGTTCAAGCAATTCTCCTGCCTCAGCCTCCTGAGTAGCTG CYP2D6 gene deletion region

[0135] This technical solution leverages the advantages of Pacific Biosciences' third-generation sequencing, namely its long length and high accuracy, to fully detect new alleles, distinguish haplotypes, and accurately genotype, leaving no genotype undetected. Furthermore, this solution boasts high throughput, allowing for simultaneous testing of multiple samples, and the experimental process can be automated, significantly reducing manpower, material resources, and financial costs.

[0136] Other embodiments of this application will readily occur to those skilled in the art upon consideration of the specification and practice of the embodiments disclosed herein. This application is intended to cover any variations, uses, or adaptations of this application that follow the general principles of this application and include common knowledge or customary techniques in the art not disclosed herein.

[0137] It should be understood that this application is not limited to the precise structure described above and shown in the accompanying drawings, and various modifications and changes can be made without departing from its scope. The scope of this application is limited only by the appended claims.

Claims

1. A detection primer for CYP2D6 genotyping, characterized by, include: Specific amplification primers for the CYP2D6 gene, the primer sequences of which are as follows: Upstream primer CYP2D6-1-F2: GATGCCTTGAGGTCGTCTTCTTTGG; Downstream primer CYP2D6-1-R2: CACGGGCGATAATGTGGCAACTC; Upstream primer CYP2D6-2-F1: GGGAGAAAGGAGTAAAGGAATAGTTGAAGAAT; Downstream primer CYP2D6-2-R1: CAAAGGTTGGTGTTGAGAAGTCTGATGAAT; In this process, phosphorylation modification of the 5' base is used during synthesis.

2. A method for non-diagnostic CYP2D6 genotyping, characterized in that, include: PCR amplification of the CYP2D6 gene fragment; Third-generation sequencing libraries were constructed using the obtained target PCR products; The established library was purified using magnetic beads; The purified library is then mixed with other libraries. Take a mixed library and sequence it. The method for PCR amplification of the CYP2D6 gene fragment includes: Design specific amplification primers for the CYP2D6 gene fragment. The specific amplification primer sequences for the CYP2D6 gene fragment are as follows: Upstream primer CYP2D6-1-F2: GATGCCTTGAGGTCGTCTTCTTTGG; Downstream primer CYP2D6-1-R2: CACGGGCGATAATGTGGCAACTC; Upstream primer CYP2D6-2-F1: GGGAGAAAGGAGTAAAGGAATAGTTGAAGAAT; Downstream primer CYP2D6-2-R1: CAAAGGTTGGTGTTGAGAAGTCTGATGAAT; Primers were synthesized, and phosphorylation modification with 5' bases was performed during synthesis; The synthesized primers were mixed to obtain a primer mixture; PCR amplification was performed by adding PCR amplification system reagents to the primer mixture.

3. The method for non-diagnostic CYP2D6 genotyping according to claim 2, characterized in that, Methods for constructing third-generation sequencing libraries include: Barcode adapter dilution: Dilute the dry powder barcode adapter to a concentration of 100 μM using TE buffer. Barcode annealing converts a single-chain barcode adapter into a double-chain one. The connector connection reacts to create a unique barcode adapter for each sample; Exonuclease digestion removes products from failed adapter ligation, yielding a high-quality library.

4. The method for non-diagnostic CYP2D6 genotyping according to claim 3, characterized in that, Methods for purifying the constructed library include: The exonuclease digestion product was purified using 0.45* magnetic beads to remove reagents from the library construction process and small sequence fragments, resulting in a high-quality library. Qubit was used to quantify a single-sample library.