Recombinant respiratory syncytial virus vaccine taking measles attenuated live vaccine as carrier and preparation method of recombinant respiratory syncytial virus vaccine

Abstract

The invention discloses a recombinant respiratory syncytial virus vaccine taking a measles attenuated live vaccine as a carrier and a preparation method of the recombinant respiratory syncytial virus vaccine. The vaccine can initiate immune response and protection against the respiratory syncytial virus and the measles virus, the generated respiratory syncytial virus antigen is PreF trimer recombinant protein, PreF is respiratory syncytial virus F protein with S150C, S190F, V207L and S290C mutations, and a transmembrane region and an anchoring region are removed. The coding gene of the fusion protein of the PreF and foldon sequences is integrated between the P gene and the M gene of the measles attenuated live vaccine. Successful preparation of the vaccine is verified by checking formation of syncytial bodies caused by recombinant viruses, expression detection of exogenous antigen protein, growth kinetics level of the recombinant viruses and the like, and measles virus antigens and respiratory syncytial virus antigens can be expressed at the same time; the measles virus vector is a replicative vector, the upstream and downstream of the production process are mature, and the measles virus vector is suitable for enlarged culture and inoculation and has proved safety and high immunogenicity.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to a recombinant respiratory syncytial virus vaccine using attenuated measles virus as a carrier and a preparation method thereof. Background Art

[0002] Respiratory syncytial virus (RSV) can cause severe respiratory diseases in infants, the elderly, and immunocompromised patients. More than 70% of newborns are infected with RSV in the first year after birth, and the proportion of RSV infection is close to 100% by the age of 2 years. Even if infants have high titers of maternal antibodies against RSV, RSV infection can still cause severe clinical symptoms. Humanized monoclonal antibody drugs (such as palivizumab) are used to prevent RSV infection in high-risk children, but they are expensive. And they need to be injected once a month for five months, which is a huge medical economic burden. Therefore, preventive vaccination is a more economical way to prevent infection.

[0003] The formalin-inactivated RSV vaccine was developed in the mid-1960s. However, infants who had received the inactivated vaccine and were not infected with RSV developed moderate or severe lower respiratory tract disease after being infected with RSV under natural conditions. This phenomenon may be partly attributed to the fact that formalin destroys the conformational epitopes of the RSV fusion protein (F), allowing the vaccine to induce only binding antibodies without neutralizing antibodies or secretory IgA, and there are Th2-biased immune responses and allergic reactions. Therefore, these factors should be considered in the subsequent development of RSV vaccines.

[0004] A new generation of RSV vaccines has been developed, such as stabilized F protein (preF) subunit vaccines or mRNA vaccines. Although these vaccines have been used in the elderly and pregnant women and have shown good protective effects, these platforms are unlikely to be implemented in infants and young children without targeted and thorough evaluation of the safety, tolerability and immunogenicity of the vaccines.

[0005] Measles virus (MeV) and respiratory syncytial virus (RSV) are two important global pathogens that cause high morbidity and mortality in developing countries. Studies have found that measles outbreaks are positively correlated with an increase in RSV infections in children under 6 months of age, which may be due to immunosuppression caused by measles infection. Children infected with measles virus are more susceptible to other pathogens (including RSV). Vaccination against measles in early childhood may be an effective strategy to prevent severe morbidity and mortality caused by measles and respiratory syncytial virus infections in many low- and middle-income countries.

[0006] The live attenuated measles virus vaccine has been widely used in infants and young children since the 1960s and is generally considered to be one of the safest and most effective vaccines. Since the establishment of the MeV reverse genetics system in 1995, MeV has been used as a vector to deliver vaccines against more than 50 human pathogens. The development of recombinant vector vaccines derived from the licensed live attenuated measles vaccine strain "Shanghai 191" in my country is theoretically considered safe and effective. Based on the above factors, it is very necessary to develop a bivalent vaccine against both measles and respiratory syncytial virus based on the live attenuated measles vaccine, which may provide corresponding protection for infants and young children. Summary of the invention

[0007] The purpose of the present invention is to develop a recombinant respiratory syncytial virus vaccine using a live attenuated measles vaccine as a carrier based on the reverse genetics platform of the live attenuated measles vaccine, so as to provide infants and young children with dual protection against measles and respiratory syncytial virus infection.

[0008] (I) Selection and integration of recombinant respiratory syncytial virus antigen genes

[0009] Respiratory syncytial virus (RSV) contains two glycoproteins on its surface: G protein and F protein. G protein is responsible for binding to receptors, and F protein is responsible for causing fusion of cell and viral envelope, thereby mediating viral invasion. In theory, both proteins can be used as targets for antigen design. Compared with F protein, G protein sequence is variable and poorly conservative, while RSV F protein is highly conservative, with amino acid sequence identity in subtypes A and B higher than 90%, so F protein is more suitable for designing antigens for vaccines. Based on the failure experience caused by the inactivated vaccine of respiratory syncytial virus, the present invention refers to the existing design scheme that can stabilize the F protein to maintain the conformation of PreF instead of PostF, and introduces 4 mutation sites on the F protein, so that the corresponding protein sequence mutates. These 4 mutations are S150C, S190F, V207L, S290C, respectively, and the transmembrane region and anchor region of the F protein are removed at the same time, and the foldon sequence is replaced after the 513th amino acid to enable it to form a trimer. The present invention also performs human codon optimization on the amino acid sequence designed above, so that it can be better expressed in cells.

[0010] According to the characteristic that the expression level of measles virus protein decreases from N, P, M, F, H, and L in sequence, the present invention selects to integrate the above-mentioned preF gene between the P gene and the M gene of measles virus to maintain the high level expression of the gene.

[0011] (II) Preparation method of recombinant respiratory syncytial virus vaccine using attenuated live measles vaccine as carrier

[0012] The present invention is based on the existing reverse genetics platform of attenuated measles live vaccine, and rapidly prepares the recombinant respiratory syncytial virus vaccine with attenuated measles live vaccine as carrier. In short, the plasmid containing the measles virus genome and preF gene and the auxiliary plasmid are mixed, and co-transfected into cells that are easy to transfect (such as 293T) using a liposome transfection reagent. After 3 days of transfection, the cell suspension is transferred to a monolayer of Vero cells for amplification until syncytia are observed under an optical microscope, which proves that the recombinant virus is initially rescued successfully.

[0013] After the recombinant virus is selected for monoclonal clones, the sequence of the recombinant virus genome, the expression of the inserted gene protein, the growth kinetics of the recombinant virus, etc. will be checked to verify whether the virus is the expected recombinant virus. When a large amount of recombinant virus needs to be prepared, the harvested virus is ultracentrifuged using sucrose gradient centrifugation, and the resulting precipitate is resuspended in serum-free opti-MEM or PBS and then aliquoted and stored for subsequent use.

[0014] Specifically, the present invention first provides a recombinant respiratory syncytial virus vaccine with a live attenuated measles vaccine as a carrier, which can induce immune response and protection against both respiratory syncytial virus and measles virus. The respiratory syncytial virus antigen produced by the vaccine is a PreF trimer recombinant protein, wherein PreF is a respiratory syncytial virus F protein with S150C, S190F, V207L, and S290C mutations and the transmembrane region and anchor region are removed, and the coding gene of the fusion protein of PreF and foldon sequence is integrated between the P gene and the M gene of the live attenuated measles vaccine.

[0015] The PreF in the present invention is the amino acid sequence at positions 1 to 513 of the F protein with S150C, S190F, V207L, and S290C mutations, as shown in SEQ ID No: 1 in the sequence table. The nucleotide sequence of the coding gene of PreF after human codon optimization is shown in SEQ ID No: 2 in the sequence table.

[0016] The foldon sequence is a polypeptide derived from the C-terminus of T4 bacteriophage fiber protein, usually composed of a specific amino acid sequence, which can induce monomeric proteins to form a trimer structure through self-folding. The foldon domain is mainly used to modify soluble proteins to form a trimer form.

[0017] In some embodiments of the present invention, the amino acid sequence of the foldon sequence used is GYIPEAPRDGQAYVRKDGEWVLLSTFL (SEQ ID No: 3); the nucleotide sequence of its encoding gene after human codon optimization is shown in SEQ ID No: 4 in the sequence listing.

[0018] In some embodiments of the present invention, the above-mentioned PreF and foldon sequences are connected by the peptide segment LEGS, and the amino acid sequence of the fusion protein of the two is shown in SEQ ID No: 5 in the sequence listing, and the nucleotide sequence of the encoding gene after human codon optimization is shown in SEQ ID No: 6 in the sequence listing.

[0019] Furthermore, the live attenuated measles vaccine is preferably derived from the live attenuated measles vaccine strain "Shanghai 191".

[0020] The present invention also provides a recombinant virus vaccine vector, which is a fusion protein gene of the PreF and foldon sequences of the respiratory syncytial virus inserted between the P gene and the M gene of the measles live attenuated vaccine vector, wherein the PreF is a respiratory syncytial virus F protein having S150C, S190F, V207L, and S290C mutations and the transmembrane region and the anchor region are removed.

[0021] Preferably, the fusion protein gene of the PreF and holdon sequence encodes an amino acid sequence as shown in SEQ ID No: 5 in the sequence listing; more preferably, the nucleotide sequence of the fusion protein gene of the PreF and foldon sequence is as shown in SEQ ID No: 6 in the sequence listing.

[0022] Host cells containing the above-mentioned recombinant virus vaccine vectors are also within the protection scope of the present invention.

[0023] The present invention further provides a method for preparing the above-mentioned recombinant respiratory syncytial virus vaccine using the attenuated live measles vaccine as a carrier, comprising the following steps:

[0024] (1) inserting the coding gene of the fusion protein of the PreF and foldon sequences between the P gene and the M gene of the measles live attenuated vaccine to construct a full-length clone plasmid of a recombinant measles live attenuated vaccine containing respiratory syncytial virus preF, referred to as rMeV-RSV preF;

[0025] (2) The codon-optimized measles virus N, P, and L gene sequences were respectively constructed into plasmid vectors containing the T7 promoter to obtain three auxiliary plasmids that express N, P, and L respectively through the T7 promoter;

[0026] (3) mixing the plasmids constructed in steps (1) and (2) and the T7 RNA polymerase expression plasmid, and co-transfecting the cells via liposomes;

[0027] (4) Cultivate the co-transfected cells and collect the viruses.

[0028] In the above step (2), the codon-optimized N, P, and L gene sequences of the measles virus are shown in SEQ ID Nos: 7, 8, and 9 in the sequence listing, respectively.

[0029] In the above step (3), the plasmid transfection mass ratio is preferably T7 pol∶rMeV-RSV preF∶N∶P∶L=(1~3)∶(3~5)∶(1~1.5)∶(1~1.5)∶(0.5~1), wherein T7 pol represents the T7 RNA polymerase expression plasmid, and N, P, and L represent the plasmids constructed in step 2) and expressing N, P, and L driven by the T7 promoter, respectively.

[0030] The present invention verifies the successful preparation of the recombinant respiratory syncytial virus vaccine using the attenuated live measles vaccine as a carrier by examining the formation of syncytia caused by the recombinant virus, the expression detection of exogenous antigenic proteins, and the growth kinetics level of the recombinant virus. The main technical advantages of the present invention are:

[0031] 1) The recombinant respiratory syncytial virus with the attenuated live measles vaccine as a vector can simultaneously express measles virus antigens and respiratory syncytial virus antigens;

[0032] 2) The measles virus vector used is a replicable vector with mature upstream and downstream production processes, suitable for expanded culture and vaccination;

[0033] 3) The measles virus vector used has proven safety and high immunogenicity. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 .Schematic diagram of the structure of the pCC1-rMeV-RSV preF plasmid constructed by the present invention.

[0035] Figure 2 .The results of blind transmission of P0 generation rMeV-EGFP and rMeV--RSV preF viruses, the upper part is the optical microscope picture, and the lower part is the fluorescence microscope picture.

[0036] Figure 3 .Agarose nucleic acid electrophoresis results of each fragment of P2 generation rMeV--RSV preF genome cDNA.

[0037] Figure 4 .Immunoblotting results of rMeV-EGFP and rMeV--RSV preF protein.

[0038] Figure 5 .Growth kinetic curves of rMeV-EGFP and rMeV--RSV preF. DETAILED DESCRIPTION

[0039] In conjunction with the accompanying drawings, the construction process of the recombinant respiratory syncytial virus vaccine using the attenuated live measles vaccine as a carrier of the present invention is described in detail by way of examples, and its effect is verified by experiments.

[0040] 1. Construction of a full-length clone of the recombinant respiratory syncytial virus vaccine using the attenuated live measles vaccine as a vector

[0041] The full-length cloned plasmid pCC1-rMeV-RSVpreF of the recombinant attenuated live measles vaccine containing respiratory syncytial virus preF was modified based on the pCC1-rMeV-EGFP plasmid constructed and preserved in this laboratory. The pCC1-rMeV-EGFP plasmid is a plasmid vector pCC1 (provided by Nanjing GenScript Co., Ltd.) that recombines the measles virus sequence MeV and the gene sequence of enhanced green fluorescent protein (EGFP) derived from the attenuated live measles vaccine strain "Shanghai 191". In short, the EGFP fragment in the pCC1-rMeV-EGFP plasmid was modified to have two different restriction sites MluI and AsiSI between the P and M genes. The PCR method was used to generate the same restriction sites as the EGFP fragment at both ends of the RSV preF-foldon gene fragment. Then, the pCC1-rMeV-EGFP and RSV preF-foldon gene fragments were digested and connected using the nucleases of MluI and AsiSI. The ligation products were transferred to the competent cells EPI300. After the monoclonal culture was obtained, it was sent to Beijing Ruibo Xingke Biotechnology Co., Ltd. for sequencing to screen out the correct clones, which were named pCC1-rMeV-RSVpreF. The nucleases and T4 DNA ligases used above were purchased from NEB. The PCR template plasmid pCMV14-RSV-preF-foldon of the RSV preF-foldon gene fragment was commissioned to Nanjing GenScript Biotechnology Co., Ltd. for gene synthesis, which contains the human codon-optimized RSV preF gene sequence of 1-513 amino acids in length (SEQ ID No: 2) and the foldon gene sequence that forms a protein trimer (SEQ ID No: 4). The PCR primer sequences used are as follows:

[0042] Forward primer: 5'-CGCGCG ACGCGT GCCACCATGGAACTGCTGATCCTGAAGG CCAACG-3' (SEQ ID No: 10, wherein the underlined portion is an MluI restriction site);

[0043] Reverse primer: 5'-ATGTCAGTA GCGATCGCTCACAGGAAGGTGCTCAGCAGCAC-3' (SEQ ID No: 11, wherein the underlined portion is the AsiSI restriction site).

[0044] The structure of plasmid pCC1-rMeV-RSV preF is as follows Figure 1 shown.

[0045] 2. Preparation of recombinant respiratory syncytial virus vaccine rMeV-RSV preF using a reverse genetics platform with live attenuated measles vaccine as a vector

[0046] pCC1-rMeV-EGFP, pCC1-rMeV-RSV preF, auxiliary plasmids pCAGGS-T7 polymerase, pT7-CFE-N, pT7-CFE-P, and pT7-CFE-L plasmids were amplified in large quantities and endotoxins were removed before use. Among them, pCAGGS-T7polymerase is a T7 RNA polymerase expression plasmid, pT7-CFE-N is a plasmid that expresses measles virus auxiliary protein nucleocapsid protein (N) through T7 promoter, pT7-CFE-P is a plasmid that expresses measles virus phosphoprotein (P) through T7 promoter, and pT7-CFE-L is a plasmid that expresses measles virus RNA polymerase (L) through T7 promoter. In order to improve the expression level, the measles virus N, P, and L gene sequences in the auxiliary plasmid are sequences after human codon optimization of the natural gene sequences. The optimized N, P, and L gene sequences are shown in SEQ ID No: 7, 8, and 9 in the sequence list, respectively.

[0047] 293T cells were inoculated into six-well plates one day in advance and cultured until the cell confluence reached 80%-90% on the next day. TM3000 liposome transfection reagent was used to transfect the liposome-plasmid mixture formed by pCC1-MeV-EGFP or pCC1-rMeV-RSVpreF with pCAGGS-T7 polymerase, pT7-CFE-N, pT7-CFE-P, and pT7-CFE-L, respectively. After 4-6 hours of transfection, the liposome-plasmid mixture in the six-well plate was replaced with DMEM containing 2% FBS and cultured at 37°C and 5% CO2 for 2-3 days. A monolayer of Vero cells was prepared in a 10 cm cell culture dish in advance, so that the cell confluence reached 70%-80% on the second day. After that, the collected 293T cell suspension was added to the monolayer of Vero cells that reached the requirements, and continued to be cultured at 37°C and 5% CO2. After about 3 days, rMeV-EGFP could be seen to express a large amount of EGFP under a fluorescence microscope, and a large number of syncytial lesions could be seen under an optical microscope. The supernatant of the rescued cells (i.e., P0 generation) was blindly transferred to a monolayer of Vero cells, and the recombinant virus was observed to infect about 24 hours after infection. The results are shown in Figure 2 Under an optical microscope, cells infected with rMeV-EGFP and rMeV-RSV preF formed obvious syncytial lesions, and under a fluorescence microscope, rMeV-EGFP could be seen to express a large amount of green fluorescence. The above results preliminarily proved that rMeV-EGFP and rMeV-RSV preF were successfully rescued.

[0048] 3. Detection of the preF gene in the recombinant respiratory syncytial virus rMeV-RSV preF genome using measles live attenuated vaccine as a vector

[0049] In order to verify whether the RSV preF gene was successfully inserted into the rescued virus, the recombinant virus rMeV-RSVpreF needed to be sequenced and identified. In brief, viral genomic RNA was extracted from the P2 generation rMeV-RSV preF according to the instructions of the reagent Trizol LS and stored at -80°C. TM SuperScript TM IV first-strand synthesis system for reverse transcription, the obtained cDNA was used as PCR template to amplify the rMeV-RSV preF genome fragments. Theoretically, the lengths of the gene fragments are as follows: N fragment is 1723bp, M fragment is 2028bp, F fragment is 1871bp, H fragment is 2000bp, and the L gene is divided into two gene segments for PCR, L1 fragment is 3510bp, L2 fragment is 3280bp, and P fragment contains P gene and RSVpreF gene, so the expected sequence length is 3488bp. The agarose nucleic acid electrophoresis results of PCR products are shown in Figure 3The length of each gene fragment was consistent with the expectation, and then sequencing was performed to identify that the preF gene existed in the rMeV-RSV preF genome. The primers used are shown in Table 1.

[0050] Table 1

[0051]

[0052] 4. Verification of the expression level of preF protein in the recombinant respiratory syncytial virus vaccine rMeV-RSV preF using the live attenuated measles vaccine as a vector

[0053] Vero cells were inoculated in a six-well plate one day in advance and cultured overnight. The cell confluence should be 80%-90% on the next day. Vero cells were infected with rMeV-EGFP and rMeV-RSV preF, respectively, and then cultured for 2 days at 37°C and 5% CO2. After 2 days, the cell pellets were collected, lysed in RIPA buffer, centrifuged at 12000rpm for 30min to obtain the protein in the supernatant, and separated by 10% SDS-PAGE gel. Palivizumab with a dilution of 1:1000, MeV-N mouse primary antibody, and actin mouse primary antibody with a dilution of 1:2000 were used to detect RSV preF, MeV-N and actin proteins in the cells, respectively, and then the corresponding primary antibodies were detected with HRP (horseradish peroxidase)-conjugated goat anti-human IgG Fc segment secondary antibody and goat anti-mouse IgG secondary antibody with a dilution of 1:5000. The results are as follows. Figure 4 As shown, the expression of RSV preF protein can be successfully detected in the cell sample of rMeV-RSV preF, and the target protein size is about 65kDa, while there is no corresponding band in rMeV-EGFP, and the N protein of rMeV can be detected in both samples. The above results prove that the recombinant respiratory syncytial virus vaccine rMeV-RSV preF with measles live attenuated vaccine as the carrier can successfully express RSV preF protein.

[0054] 5. Growth kinetics of recombinant respiratory syncytial virus vaccine rMeV-RSV preF using attenuated measles vaccine as carrier

[0055] In order to explore the effect of RSV preF gene on the replication ability of measles live attenuated vaccine virus, the present invention used rMeV-EGFP as a control and detected the growth kinetic curve of rMeV-RSV preF. A monolayer of Vero cells was inoculated in a six-well plate one day in advance and cultured overnight so that the cell confluence reached about 80% on the second day. Vero cells were infected with rMeV-EGFP and rMeV-RSV preF, respectively, with MOI = 0.03. Cells and cell supernatants were then collected at 0h, 24h, 48h, 72h, 96h and other time points for virus titer determination, and the growth curves of rMeV-EGFP and rMeV-RSV preF were plotted for comparison. The results are shown in Figure 5 The replication degree of rMeV-RSV preF in the first few days was significantly lower than that of rMeV-EGFP, but the difference in titers of the two viruses was small when reaching the peak, proving that the RSV preF gene has limited effect on the replication ability of rMeV, which will be beneficial for subsequent large-scale production.

[0056] Finally, it should be noted that the purpose of publishing the embodiments is to help further understand the present invention, but those skilled in the art can understand that various substitutions and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the present invention should not be limited to the contents disclosed in the embodiments, and the scope of protection claimed by the present invention shall be subject to the scope defined in the claims.

Claims

1. A recombinant respiratory syncytial virus vaccine using a live attenuated measles vaccine as a carrier, which can induce immune responses and protection against both respiratory syncytial virus and measles virus, characterized in that: The respiratory syncytial virus antigen produced by the vaccine is a PreF trimer recombinant protein, wherein PreF is a respiratory syncytial virus F protein with S150C, S190F, V207L, and S290C mutations and the transmembrane region and anchor region removed, and the coding gene for the fusion protein of PreF and foldon sequences is integrated between the P gene and the M gene of the live attenuated measles vaccine.

2. The vaccine according to claim 1, characterized in that The amino acid sequence of the PreF is shown as SEQ ID No: 1 in the sequence listing, and / or the amino acid sequence of the foldon sequence is shown as SEQ ID No: 3 in the sequence listing.

3. The vaccine according to claim 2, characterized in that The amino acid sequence of the fusion protein of the PreF and foldon sequences is shown in SEQ ID No: 5 in the sequence listing.

4. The vaccine according to claim 3, characterized in that The nucleotide sequence of the gene encoding the fusion protein of the PreF and foldon sequences is shown in SEQ ID No: 6 in the sequence listing.

5. The vaccine according to claim 1, characterized in that The measles live attenuated vaccine is derived from the measles live attenuated vaccine strain "Shanghai 191".

6. A recombinant virus vaccine vector, which is a fusion protein gene of the PreF and foldon sequences of respiratory syncytial virus inserted between the P gene and the M gene of the attenuated live measles vaccine vector, wherein: The PreF is a respiratory syncytial virus F protein with S150C, S190F, V207L, and S290C mutations and the transmembrane region and the anchor region are removed.

7. The recombinant virus vaccine vector according to claim 6, characterized in that The amino acid sequence encoded by the fusion protein gene of the PreF and foldon sequences is shown in SEQ ID No: 5 in the sequence listing.

8. The recombinant virus vaccine vector according to claim 7, characterized in that The nucleotide sequence of the fusion protein gene of the PreF and foldon sequences is shown in SEQ ID No: 6 in the sequence listing.

9. A host cell comprising the recombinant virus vaccine vector according to any one of claims 6 to 8.

10. The method for preparing a recombinant respiratory syncytial virus vaccine using a live attenuated measles vaccine as a carrier according to any one of claims 1 to 5, comprising the following steps: 1) inserting the coding gene of the fusion protein of the PreF and foldon sequences between the P gene and the M gene of the measles live attenuated vaccine to construct a full-length clone plasmid of the recombinant measles live attenuated vaccine containing respiratory syncytial virus preF, referred to as rMeV-RSV preF; 2) The codon-optimized measles virus N, P, and L gene sequences were respectively constructed into plasmid vectors containing T7 promoters to obtain three auxiliary plasmids for expressing N, P, and L respectively through T7 promoters; 3) Mix the plasmids constructed in steps 1) and 2) and the T7 RNA polymerase expression plasmid and co-transfect them via liposome cell; 4) Cultivate the co-transfected cells and collect the viruses.

Images