Non-viral vector for treating phenylketonuria as well as preparation method and application of non-viral vector

Abstract

The invention provides a non-viral vector for treating phenylketonuria as well as a preparation method and application of the non-viral vector, and belongs to the technical field of biological pharmacy. The non-viral vector for treating phenylketonuria comprises a lipid vector and a nucleic acid molecule for editing PAH gene expression, the lipid carrier comprises a cationic lipid and an auxiliary lipid, and the auxiliary lipid comprises a pH sensitive lipid component and an immune escape promoting lipid component; the nucleic acid molecule for editing PAH gene expression comprises DNA (deoxyribonucleic acid), siRNA (small interfering ribonucleic acid), mRNA (messenger ribonucleic acid) or sgRNA. The non-viral vector is prepared by screening lipid components and proportions. The non-viral vector prepared by the invention is uniform in particle size and stable in system, can wrap or load a gene editing drug, is high in drug encapsulation efficiency, has relatively high drug delivery efficiency for hepatocytes, can obviously recover the phenylalanine hydroxylase level, and achieves the effect of treating phenylketonuria.

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceuticals, and in particular relates to a non-viral vector for treating phenylketonuria, and a preparation method and application thereof. Background Art

[0002] Phenylketonuria (PKU) is an autosomal recessive metabolic disease characterized by a mutation in the gene for phenylalanine hydroxylase (PAH), rendering the gene nonfunctional. PAH is required for the metabolism of the amino acid phenylalanine (Phe) to the amino acid tyrosine. When PAH activity is reduced, phenylalanine accumulates and is converted to phenylalaninate. If untreated, PKU can lead to mental retardation, seizures, and other serious medical problems. Currently, there is no cure for the disease, and the standard of care is through dietary management that minimizes foods that contain large amounts of protein.

[0003] Most cases of PKU are caused by a deficiency in hepatic phenylalanine hydroxylase (PAH). PAH is a multimeric liver enzyme that catalyzes the hydroxylation of phenylalanine (Phe) to tyrosine in the presence of molecular oxygen and a catalytic amount of tetrahydrobiopterin (BH4). In the absence of adequate expression of PAH, phenylalanine levels in the blood are elevated, leading to hyperphenylalaninemia and deleterious side effects in PKU patients. Reduced or absent PAH activity may result in a deficiency of tyrosine and its downstream products, including melanin, 1-thyroxine, and catecholamine neurotransmitters, including dopamine.

[0004] PKU may result from mutations in PAH and / or defects in the synthesis or regeneration of the PAH cofactor (BH4). Various PAH mutations have been shown to affect protein folding in the endoplasmic reticulum, leading to accelerated degradation and / or aggregation due to small deletions and missense mutations in the protein structure that weaken or largely eliminate the enzyme's catalytic activity.

[0005] Currently, lifelong dietary restriction of Phe and BH4 supplementation are the only two available treatment options for PKU, with early therapeutic intervention being crucial to ensure optimal clinical outcomes for affected infants. However, expensive medications and special low-protein foods place a heavy burden on patients, especially when these products are not fully covered by private health insurance, which may lead to malnutrition, psychosocial or neurocognitive complications. In addition, BH4 therapy is mainly effective for mild hyperphenylalaninemia associated with BH4 biosynthesis defects, whereas only 20-30% of patients with mild or classic PKU respond to it. Therefore, new PKU treatment modalities are urgently needed to replace the onerous Phe-restricted diet. Therefore, there is a need to develop an alternative approach for the treatment of phenylketonuria. Summary of the invention

[0006] In view of this, the purpose of the present invention is to provide a non-viral vector for the treatment of phenylketonuria, and a preparation method and application thereof. The non-viral vector is delivered into the body by intravenous injection, and phenylalanine hydroxylase (PAH) is specifically corrected and edited in the liver to solve the PAH functional defects caused by gene mutations, and the function of PAH to catalyze the conversion of alanine into tyrosine is restored, so that PKU patients with weakened or lost PAH activity can receive personalized gene therapy.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a non-viral vector for treating phenylketonuria, wherein the non-viral vector comprises a lipid vector and a nucleic acid molecule for editing the expression of the PAH gene;

[0009] The lipid carrier includes cationic lipids and auxiliary lipids, and the auxiliary lipids include pH-sensitive lipid components and immune escape-promoting lipid components;

[0010] The nucleic acid molecule for editing PAH gene expression includes DNA, siRNA, mRNA or sgRNA, and the sequence of the sgRNA is shown in SEQ ID NO.1.

[0011] Preferably, the cationic lipid comprises one or more of DLin-MC3-DMA, ALC-0315, SM-102 and ATX-126.

[0012] Preferably, the pH-sensitive lipid component is dioleoylphosphatidylethanolamine, and the immune escape-promoting lipid component is distearoylphosphatidylcholine and / or DSPE-PEG2000.

[0013] Preferably, the molar ratio of the cationic lipid: pH sensitive lipid component is 1:(0.1-10), and the amount of the immune escape promoting lipid component does not exceed 20% of the mass of the lipid carrier.

[0014] Preferably, the auxiliary lipid further comprises a membrane fluidity regulating lipid component, the membrane fluidity regulating lipid component is DSPC and / or cholesterol, and the molar ratio of the cationic lipid:membrane fluidity regulating lipid component is 1:(0.1-5).

[0015] Preferably, the non-viral vector further comprises an auxiliary molecule, and the auxiliary molecule comprises one or more of sodium citrate, disodium hydrogen phosphate, sodium dihydrogen phosphate and sodium chloride.

[0016] The present invention also provides a method for preparing the non-viral vector for treating phenylketonuria, comprising the following steps:

[0017] 1) dissolving the cationic lipid and the auxiliary lipid in a solvent to obtain a carrier material solution;

[0018] 2) evaporating the solvent of the carrier material solution to obtain a lipid film;

[0019] 3) drying the lipid film, hydrating it with water or a non-ionic buffer, and then sequentially dispersing it by ultrasonication, stirring it, and filtering it with a microporous membrane to obtain a lipid carrier solution;

[0020] 4) After mixing the nucleic acid molecule for editing PAH gene expression with the lipid carrier solution, the mixture is incubated at 10-30° C. for 20-60 min, so that the lipid carrier can encapsulate or load the nucleic acid molecule for editing PAH gene expression to obtain a non-viral vector for treating phenylketonuria.

[0021] Preferably, the solvent is chloroform; the non-ionic buffer is a HEPES solution with a concentration of 10 to 40 mmol / L;

[0022] The ultrasonic dispersion condition is ultrasonic treatment in a water bath at 40-60° C. for 1-20 min; the stirring condition is magnetic stirring in a water bath at 40-60° C.; the pore size of the microporous filter membrane is ≤0.22 μm.

[0023] Preferably, during step 4), the molar ratio of the nitrogen element in the nucleic acid molecule to the phosphorus element in the lipid carrier is 1 to 10:1;

[0024] Step 4) After the incubation, an auxiliary molecule is added at a final concentration of 1 to 150 mmol / L, and then the incubation is continued at 10 to 30°C.

[0025] The present invention also provides the use of the non-viral vector or the non-viral vector prepared by the preparation method in preparing a drug for treating phenylketonuria.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] The present invention utilizes lipid nanocarriers to encapsulate or load nucleic acid molecules such as gene editing vectors for correcting and editing the phenylalanine hydroxylase (PAH) gene, and constructs a non-viral vector with high specificity for phenylalanine hydroxylase (PAH) gene-positive cells. The lipid carrier is a cationic liposome composed of cationic lipids and auxiliary lipid components. The nucleic acid drugs can be efficiently delivered to target cells (c.835T>C homozygous HuH-7 cells) through immune escape and pH response mechanisms, and the nucleic acid drugs are released into the target cells, thereby ensuring that the drug activity is not destroyed during delivery. The delivered nucleic acid molecules correct the PAH variant in human hepatocytes through targeted correction editing of c.835T>C homozygous HuH-7 cells, significantly restore the level of phenylalanine hydroxylase, and can significantly improve the effect of treating genetic diseases such as phenylketonuria.

[0028] The non-viral vector prepared by the present invention has uniform particle size, stable system, wide application range, can encapsulate or load gene editing drugs, can deliver nucleic acid molecules such as DNA, siRNA, mRNA to cells, and has high drug encapsulation rate, and has high drug delivery efficiency for hepatocytes. By screening liposome components and the ratio between them, the problem of unstable efficiency of cationic liposomes when delivering nucleic acid drugs to cells is solved, and nucleic acid drugs are efficiently delivered to target cells and play a role. At the same time, the drug loading stability and pH response function are taken into account, the degradation of liposomes in cells is improved, and the release efficiency of nucleic acid drugs in cells is improved.

[0029] The gene expression vector preparation method of the present invention is simple, the sgRNA targeting is good, and the editing efficiency of the base editing system is high. The non-viral vector of the present invention takes advantage of the base editing system to quickly, simply, efficiently, and specifically edit and correct PAH variants in human hepatocytes. Combined with cationic liposomes, it can accurately target and correct PAH variants in human hepatocytes and effectively restore the level of phenylalanine hydroxylase, that is, it shows superiority in treating genetic diseases, and will provide an effective drug treatment approach for targeted treatment of genetic diseases such as phenylketonuria. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is a diagram showing the working principle of cationic liposomes in delivering nucleic acid drugs;

[0031] Figure 2 is the particle size of the cationic liposome prepared by the present invention;

[0032] Figure 3 Zeta potential of the cationic liposome prepared by the present invention;

[0033] Figure 4 The appearance of the cationic liposome prepared by the present invention;

[0034] Figure 5 A schematic diagram of the change in Zeta potential of the cationic liposomes prepared in the present invention;

[0035] Figure 6 is a schematic diagram of a base editor;

[0036] Figure 7 Agarose gel electrophoresis diagram for analysis of gene drug encapsulation efficiency;

[0037] Figure 8 Schematic diagram of the particle size change of the composite measured by laser particle size / Zeta potential instrument;

[0038] Fig. 9 is the relative expression of PAH gene;

[0039] Fig.10 Generation of PAH P281L homozygous HuH-7 cell line (wherein, the top is the sequence from wild-type HuH-7 cells; the middle is sequenced from the HuH-7 cell pool after the initial editing; the bottom is the homozygous sequence from the isolated clone line of the P281L variant (HuH-7P281L cells); the red arrow indicates the P281L site);

[0040] Fig.11 The delivery efficiency of different carriers;

[0041] Fig.12 is the activity of PAH enzyme. DETAILED DESCRIPTION

[0042] The present invention provides a non-viral vector for treating phenylketonuria, wherein the non-viral vector comprises a lipid vector and a nucleic acid molecule for editing the expression of the PAH gene;

[0043] The lipid carrier includes cationic lipids and auxiliary lipids, and the auxiliary lipids include pH-sensitive lipid components and immune escape lipid components. In the present invention, the cationic lipids include one or more of DLin-MC3-DMA, ALC-0315, SM-102 and ATX-126; the pH-sensitive lipid component is dioleoylphosphatidylethanolamine (DOPE), which is a pH-sensitive element of liposomes. It is stable under physiological conditions (pH7.4), but undergoes structural changes under acidic conditions (pH5.0-6.8). Using this property, DOPE can help liposomes escape from lysosomes under acidic conditions of lysosomes and prevent DNA from being degraded; the immune escape lipid component is distearoylphosphatidylcholine (DSPC) and / or DSPE-PEG2000. ; The DSPE-PEG2000 can increase the stability of the liposome-DNA complex by its spatial configuration, and at the same time can achieve the in vivo immune escape of the complex; the molar ratio of the cationic lipid: pH-sensitive lipid component is preferably 1: (0.1-10), and more preferably 1: (0.5-8); the amount of the immune escape-promoting lipid component does not exceed 20% of the mass of the lipid carrier; the auxiliary lipid also includes a membrane fluidity regulating lipid component, and the membrane fluidity regulating lipid component is DSPC and / or cholesterol, and the molar ratio of the cationic lipid: membrane fluidity regulating lipid component is preferably 1: (0.1-5), and more preferably 1: (0.3-4.5).

[0044] In the present invention, the nucleic acid molecule for editing PAH gene expression includes DNA, siRNA, mRNA or sgRNA, and the sequence of the sgRNA is shown in SEQ ID NO.1, specifically GTCACAGTTCGGGGGTATACA. The working principle of the non-viral vector prepared by the present invention is as follows Figure 1 As shown, the non-viral vector prepared by the present invention is a pH-sensitive cationic liposome-nucleic acid drug (e.g., DNA) complex. The function of the pH-sensitive cationic liposome is to effectively transport the nucleic acid drug into the target cell and release it under the specific pH environment of the target cell, so that the nucleic acid drug can exert its effect.

[0045] In the present invention, the non-viral vector further comprises an auxiliary molecule, and the auxiliary molecule comprises one or more of sodium citrate, disodium hydrogen phosphate, sodium dihydrogen phosphate and sodium chloride. The auxiliary molecule functions to improve the stability of the non-viral vector.

[0046] The present invention also provides a method for preparing the non-viral vector for treating phenylketonuria, comprising the following steps:

[0047] 1) dissolving the cationic lipid and the auxiliary lipid in a solvent to obtain a carrier material solution;

[0048] 2) evaporating the solvent of the carrier material solution to obtain a lipid film;

[0049] 3) drying the lipid film, hydrating it with water or a non-ionic buffer, and then sequentially dispersing it by ultrasonication, stirring it, and filtering it with a microporous membrane to obtain a lipid carrier solution;

[0050] 4) mixing the nucleic acid molecule for editing the expression of the PAH gene with the lipid carrier solution and incubating the mixture at 10-30° C. for 20-60 min, so that the lipid carrier can encapsulate or load the nucleic acid molecule for editing the expression of the PAH gene to obtain a non-viral vector for treating phenylketonuria;.

[0051] In the present invention, the cationic lipid and the auxiliary lipid are dissolved in a solvent to obtain a carrier material solution; the solvent is preferably chloroform.

[0052] In the present invention, the solvent of the carrier material solution is evaporated to obtain a lipid film.

[0053] In the present invention, the lipid film is dried and hydrated with water or non-ionic buffer, and then ultrasonically dispersed, stirred, and filtered through a microporous filter membrane to obtain a lipid carrier solution. The non-ionic buffer is preferably a HEPES solution with a concentration of 10 to 40 mmol / L, and more preferably a HEPES solution with a concentration of 20 to 25 mmol / L; the ultrasonic dispersion condition is ultrasonic treatment in a water bath at 40 to 60°C for 1 to 20 minutes; the temperature of the water bath is preferably 45 to 55°C; the ultrasonic time is preferably 5 to 10 minutes; the stirring condition is magnetic stirring in a water bath at 40 to 60°C, and the temperature of the water bath is preferably 45 to 55°C; the pore size of the microporous filter membrane is preferably ≤0.22 μm.

[0054] In the present invention, the nucleic acid molecule for editing the expression of the PAH gene is mixed with a lipid carrier solution and incubated at 10-30°C for 20-60 minutes, so that the lipid carrier encapsulates or loads the nucleic acid molecule for editing the expression of the PAH gene to obtain a non-viral vector for treating phenylketonuria; during mixing, the molar ratio of the nitrogen element in the nucleic acid molecule to the phosphorus element in the lipid carrier is preferably 1-10:1, and more preferably 3-6:1; after the incubation, an auxiliary molecule with a final concentration of 1-150 mmol / L is added, and the final concentration of the auxiliary molecule is preferably 50-100 mmol / L, and then the incubation is continued at 10-30°C, the incubation temperature is preferably 15-25°C, and the incubation time is preferably 30-50 minutes.

[0055] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0056] Example 1

[0057] Preparation of blank cationic liposomes

[0058] The medicinal synthetic phospholipids DLin-MC3-DMA, DOPE, DSPE-PEG2000 and medicinal DSP C were dissolved in 5 mL of chloroform and transferred into a 25 mL round-bottom flask, wherein the molar ratio of the medicinal synthetic phospholipids DLin-MC3-DMA:DOPE:DSPC was 1:1:0.6, and DSPE-PEG2000 accounted for 0.5% of the total lipid mass; the organic solvent (chloroform) was slowly removed by rotary evaporation at 0.08 MPa (gauge pressure) and 30°C, thereby forming a lipid film of uniform thickness at the bottom of the round-bottom flask, and vacuum dried for 2 h at -0.1 MPa (gauge pressure) and room temperature (the organic reagent and steam were completely removed); 10 mL of HEPES solution (20 mmo l / L), wash off the lipid film from the bottom of the round-bottom flask (wash the membrane), then place the round-bottom flask on an ultrasonic cleaner and perform ultrasonic treatment at 50°C in a water bath for 5 minutes, until the lipid film disappears (the lipid film is dissolved in the HEPES solution), move the round-bottom flask to a magnetic stirrer, continue stirring and hydrating at 50°C in a water bath at 900rpm; after stirring for 30 minutes, the solution shows a light blue opalescence and has no granular impurities (the blue opalescence represents the formation of cationic liposomes, and the liposomes are complete in morphology and high in quality), then filter through 0.22μm and 0.1μm microporous membranes in turn (to make the cationic liposomes uniform in particle size and sterilize them at the same time) for 5 times each, then fill with nitrogen and store at 4°C.

[0059] The laser particle size analyzer measured the solution sample after microporous membrane filtration and found that the average particle size of the dissolved cationic liposomes was 100-150nm ( Figure 2 ), the average Zeta potential was measured by a Zeta potential meter at 55-60 mV ( Figure 3 ).

[0060] Example 2

[0061] Stability of blank cationic liposomes

[0062] The blank liposomes prepared in Example 1 were sterile filtered and dispensed into sterile tubes, stored in a 4°C refrigerator for 28 days, and then left at room temperature for 3 months. The liposomes were still stable, with a white color and good uniformity, and no precipitation was observed. Figure 4 ).

[0063] Example 3

[0064] pH Sensitive Properties of Blank Cationic Liposomes

[0065] The blank liposomes prepared in Example 1 and PB solutions of different pH values ​​were co-incubated at 37°C for 30 minutes, and the potential value of the mixture was measured using a Zeta potential meter. By measuring the surface potential of liposomes under different pH conditions, the results showed that the surface charge of liposomes increased sharply with the decrease of pH value (the cell endosome is acidic, and its pH value is about 5.0). Figure 5 ).

[0066] Example 4

[0067] Base editing system for targeted correction of PAH variants in human hepatocytes

[0068] See also Figure 6 The directional recognition and cutting of the gene by the base editing system is achieved by sgRNA and nuclease ABE8.8. The sgRNA determines the targeting and also determines the editing activity of the base editing system. The sgRNA is SEQ ID NO.1, etc., which can specifically correct and edit the phenylalanine hydroxylase (PAH) gene and specifically target the c.835T>C phenylalanine hydroxylase (PAH) gene. The expression vector of sg RNA is specifically PAH. PAH is obtained by connecting the oligonucleotide double strand of the sgRNA with the sequence shown in SEQ ID NO.1 with the linearized ABE8.8 plasmid. The sequence shown in SEQ.ID.NO.1 is inserted into the multiple cloning site of the ABE8.8 plasmid (the full name of the plasmid is ABE8.8-m; Addgene plasmid #136294; RRID: Addgene_136294). The mass ratio of the expression vector of the nuclease ABE8.8: the expression vector of the sgRNA is (1-4): (1-3).

[0069] Example 5

[0070] Preparation of pH-sensitive cationic liposome-DNA complex

[0071] The base editing system (DNA) for transfecting cells and the blank cationic liposome solution prepared in Example 1 were mixed at a nitrogen-phosphorus molar ratio of 6:1 (the solution after adding PAH prepared in Example 4 to the filter membrane for filtration), and then incubated at room temperature for 20 minutes. Sodium citrate was added to the mixed solution to make the concentration of sodium citrate in the system 60 mmol / L, and incubated at room temperature for 20 minutes to form a uniform solution without granular impurities. The solution was the pH-sensitive cationic liposome-DNA complex solution.

[0072] The prepared pH-sensitive cationic liposome-DNA complex was dissolved in 1 mL PBS (pH 7.4) and incubated at 37°C with gentle shaking. At each sampling time (5 min, 10 min, 20 min, 30 min, 1 h, 2 h, 3 h, 4 h, 5 h, 6 h, 7 h, 8 h, 10 h, 12 h, 24 h, 36 h), the pH-sensitive cationic liposome-DNA complex suspension was centrifuged at 15000 rpm for 15 min. A certain amount of supernatant sample was measured to quantify DNA and replaced with an equal volume of PBS to continue monitoring release. The release rate was detected using the Pico-Green assay.

[0073] Experimental results: The release curve of pH-sensitive cationic liposome-DNA complex is as follows Figure 7 As shown in the figure, the in vitro release rate of the complex conforms to the law of the Higuchi equation and has the characteristics of a sustained-release preparation. At the same time, the release amount of the complex in 3 hours is 37.74%, which meets the requirement of the liposome preparation guideline in the pharmacopoeia that the release amount of liposomes within 0.5 hours is less than 40%.

[0074] The cationic liposome-DNA complex was resuspended in a culture medium containing 10% fetal bovine serum, and the particle size change of the complex was measured by a laser particle size / Zeta potential instrument. Existing cationic liposome complexes and proteins in the blood are prone to nonspecific adsorption, which seriously affects its application as a base editing drug delivery system. The present invention measured the change in particle size of the cationic liposome-DNA complex in a culture medium containing 10% fetal bovine serum and found that the complex was stable in serum ( Figure 8 ).

[0075] Example 6

[0076] Efficacy of a non-viral vector that specifically corrects PAH variants in human hepatocytes against c.835T>C homozygous HuH-7 cells

[0077] The non-viral vector in the present invention is a cationic liposome-nucleic acid complex constructed by encapsulating the base editing system in liposomes. The c.835T>C homozygous HuH-7 cells and humanized PKU mouse models are used as research objects, and delivery and intervention are simultaneously performed on the main molecular targets of the disease to achieve effective editing of PAH variants in human hepatocytes. The level of phenylalanine hydroxylase can be significantly restored, thereby providing an effective way for genetic correction of PAH variants in human hepatocytes and effective treatment of phenylketonuria.

[0078] 1. Cell experiments

[0079] 1. Generation of PAH homozygous HuH-7 cells

[0080] Use 9 μL TransIT- Transfection reagent, 1.5 μg PEmax plasmid, 0.75 μg epegRNA expression plasmid and 0.75 μg cut gRNA plasmid were transfected into HuH-7 cells (from the Chinese Academy of Sciences Cell Bank) in 6-well plates. 48 hours after transfection, cells were dissociated with trypsin and re-inoculated on 10 cm plates (5000 cells / plate) with conditioned medium to promote recovery, and genomic DNA was isolated from the remaining cells as a pool to perform PCR and Sanger sequencing of PAH P281L sites. Single cell amplification was allowed for 7-14 days to establish a clonal population. Artificial colonies were selected and re-inoculated into each well of a 96-well plate. Genomic DNA was isolated from a single clone, PCR and Sanger sequencing were performed to identify P281L homozygous HuH-7 clones. A representative clone was amplified for subsequent studies.

[0081] 2. HuH-7 cell culture and transfection

[0082] HuH-7 cells were maintained in Dulbecco's modified Eagle's medium (containing 4 mM L-glutamine and 1 g / L glucose) containing 10% fetal bovine serum and 1% penicillin / streptomycin. HuH-7 cells were cultured at 3.5 × 10 7 16-24 hours after seeding, 9 μL of TransIT- Transfection reagent (MIR2300, Mirus), 2 μg base editor plasmid (ABE8.8) and 1 μg PAH sgRNA plasmid were transfected into cells at a confluence of about 80-90%; alternatively, the pH-sensitive cationic liposome-DNA complex prepared in Example 5 (quantified by the total amount of DNA in LNP) was directly added to the culture medium. Cells were cultured for 72 hours after transfection, and then the culture medium was removed, the cells were washed with 1×DPBS (Corning), and genomic DNA was isolated using DNeasy Blood and Tissue Kit (QIAGEN) according to the manufacturer's instructions.

[0083] 3. Total RNA extraction and qRT-PCR:

[0084] Total RNA of cells was extracted by TRIzol reagent according to the manufacturer's protocol, and the concentration was determined by Nanodro p spectrophotometer 2000 (Thermo Fisher Scientific). 0.5 μg of total RNA was used for reverse transcription and detected by SYBR Green (Vazyme) fluorescence quantitative PCR. The qPCR reaction system was: 0.5 μL PAH-F / GAPDH-F (10 μM), 0.5 μL PAH-R / GAPDH-R (10 μM), 10 μL SYBR Green, 7 μL ddH2O and 2 μL cDNA. Repeat three times, and the relative expression of genes was analyzed by the ΔΔCt method. The qPCR primer sequences are as follows:

[0085] hPAH-F (SEQ ID NO:2):TCCTGTGTACCGTGCAAGAC;

[0086] hPAH-R (SEQ ID NO:3): GTGCAGTGGAAGACTCGGAA;

[0087] GAPDH-F (SEQ ID NO: 4): GGACGAGATCCCTCCAAAAT;

[0088] GAPDH-R (SEQ ID NO: 5): GGCTGTTGTCATACTTCTCATGG;

[0089] Statistical analysis:

[0090] Data are presented as mean ± SEM and analyzed using GraphPad Prism software. Unpaired t-test was used to determine the differences between two groups; one-way ANOVA was used to determine the differences among multiple groups. P < 0.05 was considered statistically significant.

[0091] Experimental results: Fig. 9 Treatment with pH-sensitive cationic liposome-DNA complexes almost completely restored the expression of PAH mRNA in cells, while plasmid transfection (ABE8.8 / PAH group) only partially restored the expression of PAH mRNA in cells.

[0092] 4. Grouping

[0093] Blank cationic liposome encapsulated ABE8.8 / PAH group (ABE8.8 / PAH+LNP): 40 μg ABE8.8+40 μg PAHsg were added to 200 μL of the blank cationic liposome solution prepared in Example 1 (conforming to the nitrogen-phosphorus molar ratio of 6:1);

[0094] Blank cationic liposome group (LNP): 200 μL of the blank cationic liposome solution prepared in Example 1;

[0095] Blank cationic liposome-encapsulated ABE8.8 / empty vector group (ABE8.8 / empty vector+LNP): 40 μg ABE8.8+40 μg gRNA empty vector sg were added to 200 μL of the blank cationic liposome solution prepared in Example 1.

[0096] Experimental results: The P281L variant was introduced into HuH-7 human liver cancer cells, and then transferred into nanoliposomes to encapsulate ABE8.8 / PAH1, and the gene editing was observed. Single-cell cloning was used to identify and amplify the P281L homozygous HuH-7 cell line. Fig.10 Top, sequence from wild-type HuH-7 cells. Fig.10 Middle, sequencing from a pool of HuH-7 cells after primary editing. Fig.10 Bottom, isolated clones from the P281L variant (HuH-7P281L cells) are homozygous. The red arrow indicates the P281L site. This indicates that nanoliposome encapsulation of ABE8.8 / PAH1 achieves efficient editing.

[0097] 2. Comparison of delivery efficiency of different cationic liposomes

[0098] In order to verify the difference in delivery efficiency between the non-viral vector of the present invention and the delivery vector using DOTAP as a cationic lipid, three groups were designed in the experiment, namely

[0099] ABE8.8 / PAH group: 40 μg ABE8.8 + 40 μg PAH sg;

[0100] ABE8.8 / PAH+DOTAP cationic lipid nano-delivery carrier group: 40 μg ABE8.8+40 μg PAH sg, added to 200 μL DOTAP cationic lipid nano-delivery carrier solution (in accordance with the nitrogen-phosphorus molar ratio of 6:1);

[0101] ABE8.8 / PAH+LNP group: 40 μg ABE8.8+40 μg PAH sg were added to 200 μL of the blank cationic liposome solution prepared in Example 1 (conforming to the nitrogen-phosphorus molar ratio of 6:1).

[0102] The three groups of cells were transfected and observed for 6 hours using a fluorescence microscope to observe the cell entry effect (the constructed ABE 8.8 / PAH was fluorescently labeled). The delivery efficiency was observed by fluorescence.

[0103] Experimental results: Fig.11As shown, it can be found that the cell entry effect of the naked ABE8.8 / PAH group without liposome delivery is much lower than that of the liposome delivery group. The intracellular fluorescence intensity of the ABE8.8 / PAH+LNP group is the highest, and the delivery efficiency is the highest, indicating that the liposomes constructed by the present invention can significantly improve the cell entry efficiency.

[0104] 3. In vivo experiments

[0105] Based on the PAH-deficient PKU model mice (purchased from Shanghai Model Organisms Center, Inc.), treatment and control groups were set up, with 3 mice (8 weeks old) in each group. Before the injection of adeno-associated virus gene therapy vectors, body weight, coat color, and orbital blood were recorded to prepare dry blood films, and the blood phenylalanine level before treatment was determined by mass spectrometry. The dosages for each group were:

[0106] Nanoliposome encapsulated ABE8.8 / PAH group (ABE8.8 / PAH+LNP): 40 μg ABE8.8+40 μg PAH sg was added to 200 μL of the blank cationic liposome solution prepared in Example 1 (conforming to the nitrogen-phosphorus molar ratio of 6:1);

[0107] Nanoliposome group (LNP): 200 μL of the blank cationic liposome solution prepared in Example 1;

[0108] Nanoliposome-encapsulated ABE8.8 / empty vector group (ABE8.8 / empty vector+LNP): 40 μg ABE8.8+40 μg gRNA empty vector sg were added to 200 μL of the blank cationic liposome solution prepared in Example 1.

[0109] Observe the activity of PAH enzyme, the results are as follows Fig.12 As shown, compared with the control group, base editing gene drugs delivered by liposomes can more effectively increase the activity of PAH enzyme.

[0110] It can be seen from the above embodiments that the non-viral vector prepared by the present invention has uniform particle size and a stable system. It can encapsulate or load gene editing drugs, and has a high drug encapsulation rate. It has a high drug delivery efficiency for hepatocytes, can significantly restore the level of phenylalanine hydroxylase, and achieve the effect of treating phenylketonuria.

[0111] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A non-viral vector for treating phenylketonuria, characterized in that: The non-viral vector includes a lipid vector and a nucleic acid molecule for editing the expression of the PAH gene; The lipid carrier includes cationic lipids and auxiliary lipids, and the auxiliary lipids include pH-sensitive lipid components and immune escape-promoting lipid components; The nucleic acid molecule for editing PAH gene expression includes DNA, siRNA, mRNA or sgRNA, and the sequence of the sgRNA is shown in SEQ ID NO.

1.

2. The non-viral vector according to claim 1, characterized in that The cationic lipids include one or more of DLin-MC3-DMA, ALC-0315, SM-102 and ATX-126.

3. The non-viral vector according to claim 1, characterized in that The pH sensitive lipid component is dioleoylphosphatidylethanolamine, and the immune escape promoting lipid component is distearoylphosphatidylcholine and / or DSPE-PEG2000.

4. The non-viral vector according to claim 1, characterized in that The molar ratio of the cationic lipid to the pH sensitive lipid component is 1:(0.1-10), and the amount of the immune escape promoting lipid component does not exceed 20% of the mass of the lipid carrier.

5. The non-viral vector according to claim 1, characterized in that The auxiliary lipid also includes a membrane fluidity regulating lipid component, the membrane fluidity regulating lipid component is DSPC and / or cholesterol, and the molar ratio of the cationic lipid to the membrane fluidity regulating lipid component is 1:(0.1-5).

6. The non-viral vector according to claim 1, characterized in that The non-viral vector also includes auxiliary molecules, which include one or more of sodium citrate, disodium hydrogen phosphate, sodium dihydrogen phosphate and sodium chloride.

7. The method for preparing a non-viral vector for treating phenylketonuria according to any one of claims 1 to 6, characterized in that: The following steps are involved: 1) dissolving the cationic lipid and the auxiliary lipid in a solvent to obtain a carrier material solution; 2) evaporating the solvent of the carrier material solution to obtain a lipid film; 3) drying the lipid film, hydrating it with water or a non-ionic buffer, and then sequentially dispersing it by ultrasonication, stirring it, and filtering it with a microporous membrane to obtain a lipid carrier solution; 4) After mixing the nucleic acid molecule for editing PAH gene expression with the lipid carrier solution, the mixture is incubated at 10-30° C. for 20-60 min, so that the lipid carrier can encapsulate or load the nucleic acid molecule for editing PAH gene expression to obtain a non-viral vector for treating phenylketonuria.

8. The preparation method according to claim 7, characterized in that: The solvent is chloroform; the non-ionic buffer is a HEPES solution with a concentration of 10 to 40 mmol / L; The ultrasonic dispersion condition is ultrasonic treatment in a water bath at 40-60° C. for 1-20 min; the stirring condition is magnetic stirring in a water bath at 40-60° C.; the pore size of the microporous filter membrane is ≤0.22 μm.

9. The preparation method according to claim 7, characterized in that: Step 4) during mixing, the molar ratio of nitrogen in the nucleic acid molecule to phosphorus in the lipid carrier is 1 to 10:1; Step 4) After the incubation, an auxiliary molecule is added at a final concentration of 1 to 150 mmol / L, and then the incubation is continued at 10 to 30°C.

10. Use of the non-viral vector according to any one of claims 1 to 6 or the non-viral vector prepared by the preparation method according to any one of claims 7 to 9 in the preparation of a drug for treating phenylketonuria.

Images