Application of ELAVL1 as attention deficit and hyperactivity disorder drug target or preparation of attention deficit and hyperactivity disorder animal model

Abstract

The invention relates to the technical field of gene engineering, in particular to application of ELAVL1 as an attention deficit and hyperactivity disorder drug target or preparation of an attention deficit and hyperactivity disorder animal model. The invention finds that ELAVL1 has significant correlation with occurrence and development of attention deficit and hyperactivity disorder, and can be used as a drug target for screening and developing drugs for treating attention deficit and hyperactivity disorder. The expression quantity of the ELAVL1 is reduced, so that the zebrafish has hyperactivity-like phenotype, the hyperactivity-like phenotype is relieved by giving the medicine for treating the attention deficit and hyperactivity disorder, and a zebrafish model of the attention deficit and hyperactivity disorder can be constructed by reducing the expression quantity of the ELAVL1. The method is used for pathological research of attention deficit and hyperactivity disorder and screening and development of treatment means such as drugs.

Description

Technical Field

[0001] The present invention relates to the field of gene engineering technology, and in particular to the application of ELAVL1 as a drug target for attention deficit hyperactivity disorder or the preparation of an attention deficit hyperactivity disorder animal model. Background Art

[0002] Attention deficit and hyperactivity disorder (ADHD) is a neurodevelopmental disorder that often develops in childhood and is characterized by inability to concentrate, hyperactivity, and impulsivity, which can persist throughout life. The pathogenesis of ADHD is still unclear, but it is generally believed to be caused by the interaction of multiple factors such as genetics, social psychology, and neuroimmunity. ADHD is a complex multi-gene disease that is regulated by multiple genes. Currently, most of the risk gene research on ADHD focuses on the function of the dopamine system.

[0003] In recent years, zebrafish (Danio rerio) has been widely used as a model organism in medical science research and can be used to construct a variety of disease models, including cardiovascular disease models, nervous system disease models, immune disease and infection models, tumor disease models, etc. At present, there are still few reports on ADHD zebrafish models. In order to promote the pathological research of ADHD and the development of treatment methods such as drugs, it is necessary to discover more genes related to the occurrence and development of ADHD and construct ADHD zebrafish models based on these related genes.

[0004] The RNA binding protein Elavl / Hu family includes four members, namely HuR / Elavl1, HuB / Hel-N1 / Elavl2, HuC / Elavl3 and HuD / Elavl4. Among them, HuB, HuC and HuD are mainly expressed in neurons. Current studies have found that they can induce neuronal differentiation and promote neuronal development and maturation, while HuR / Elavl1 is widely expressed in various tissues. So far, there has been no report on the association between HuR / Elavl1 and the occurrence and development of ADHD. Summary of the invention

[0005] The present invention provides the application of ELAVL1 as a drug target for attention deficit hyperactivity disorder or for preparing an attention deficit hyperactivity disorder animal model.

[0006] The present invention found in the research and development process that the ELAVL1 gene is significantly correlated with the occurrence of attention deficit and hyperactivity disorder, and is involved in the occurrence and development of attention deficit and hyperactivity disorder. Based on this discovery, the function of the elavl1a gene related to attention deficit and hyperactivity disorder is verified in zebrafish. According to the functional verification results, knocking out the elavl1a gene affects the behavioral performance of zebrafish, causing the zebrafish to exhibit hyperactive or impulsive behavior, thereby determining that the ELAVL1 gene plays a role in the occurrence and development of attention deficit and hyperactivity disorder, and an attention deficit and hyperactivity disorder animal model can be constructed by knocking out the ELAVL1 gene. Through clinical large-sample population testing, it was found that the expression level of ELAVL1 is significantly correlated with attention deficit and hyperactivity disorder, and reducing the level of ELAVL1 can cause a hyperactive-like phenotype; through drug rescue experiments, it is proved that drugs for the treatment of attention deficit and hyperactivity disorder can rescue the hyperactive-like phenotype caused by ELAVL1.

[0007] Specifically, the present invention provides the following technical solutions: In a first aspect, the present invention provides the use of ELAVL1 protein or its encoding gene as a drug target in screening drugs for treating attention deficit hyperactivity disorder.

[0008] In the present invention, ELAVL1 protein is embryonic lethal abnormal vision like 1 (ELAVL1), also known as human antigen R (HuR), which is a typical RNA binding protein (RBP) that plays an important role in mRNA transcription and translation by binding to the AU-rich element (ARE) in the 3' untranslated region (3' untranslated element, 3'UTR).

[0009] The ELAVL1 protein described above is an animal ELAVL1 protein. Those skilled in the art can obtain ELAVL1 proteins of different animals through public databases. For example, the amino acid sequence of human ELAVL1 protein is shown in SEQ ID NO.1 (accession number is NP_001410.2).

[0010] Based on the significant correlation between the ELAVL1 protein and its encoding gene and the occurrence and development of attention deficit and hyperactivity disorder discovered in the present invention, the protein or its encoding gene can be used as a drug target in screening drugs for treating attention deficit and hyperactivity disorder.

[0011] The above-mentioned drugs include one or more selected from the group consisting of ELAVL1 protein expression promoters, ELAVL1 protein encoding gene expression promoters, and ELAVL1 protein activity promoters.

[0012] In the present invention, the ELAVL1 protein expression promoter is a substance that can promote the expression of ELAVL1 protein and increase the expression amount of ELAVL1 protein, including but not limited to compounds, compositions, nucleic acids, peptides or proteins.

[0013] The expression promoter of the gene encoding the ELAVL1 protein is a substance that can promote the expression of the gene encoding the ELAVL1 protein and increase the expression level of the gene encoding the ELAVL1 protein, including but not limited to compounds, compositions, nucleic acids, peptides or proteins.

[0014] The ELAVL1 protein activity promoter is a substance that can increase the activity of the ELAVL1 protein, including but not limited to compounds, compositions, nucleic acids, peptides or proteins.

[0015] In a second aspect, the present invention provides the use of one or more selected from ELAVL1 protein expression promoters, ELAVL1 protein encoding gene expression promoters, and ELAVL1 protein activity promoters in the preparation of a drug for treating attention deficit and hyperactivity disorder.

[0016] In the above application, the drug comprises one or more selected from ELAVL1 protein expression promoter, ELAVL1 protein encoding gene expression promoter, ELAVL1 protein activity promoter, and may also contain excipients permitted in the pharmaceutical field, such as carriers, fillers, lubricants, wetting agents, diluents, adhesives, colorants, coating agents, etc.

[0017] The dosage form of the drug can be selected from any one of tablets, capsules, granules, pills, suspensions, dispersants, syrups and injections.

[0018] In a third aspect, the present invention provides the use of ELAVL1 protein or its encoding gene in preparing an attention deficit hyperactivity disorder animal model.

[0019] Specifically, the application includes: reducing the expression level of ELAVL1 protein in an animal and / or reducing the activity of ELAVL1 protein in an animal.

[0020] In the present invention, the reduction of the expression level and / or activity of the protein can be achieved by a combination of any one or more of the following (1) to (3): (1) Mutating the nucleotide sequence of a gene to reduce the expression of the gene; (2) Mutating the amino acid sequence of a protein to reduce the expression and / or activity of a gene or protein; (3) Replacing the transcriptional and / or translational regulatory elements of a gene with elements with weaker activity to reduce the expression of the gene or protein.

[0021] The mutation of the nucleotide sequence of the gene described above includes deletion, insertion or replacement of one or more nucleotides, including but not limited to insertion inactivation, knockout and the like.

[0022] The mutation of the amino acid sequence described above includes deletion, insertion or substitution of one or more amino acids.

[0023] The transcription and translation regulatory elements mentioned above include promoters, Kozak sequences, and the like.

[0024] In some embodiments of the present invention, an attention deficit hyperactivity disorder animal model is prepared by knocking out the ELAVL1 gene.

[0025] In other embodiments of the present invention, an attention deficit hyperactivity disorder animal model is prepared by administering an inhibitor of ELAVL1 protein to an animal.

[0026] The ELAVL1 gene can be knocked out by using the gene knockout methods commonly used in the art, including but not limited to CRISPR / Cas9 technology, etc. It should be understood that in the specific embodiments of the present invention, knocking out the ELAVL1 gene and administering an inhibitor of the ELAVL1 protein to an animal are used as examples of technical means for reducing the expression of the ELAVL1 protein in an animal, but the method for reducing the expression of the ELAVL1 protein in an animal is not limited thereto, and all methods that can achieve the purpose of reducing the expression and / or activity of the ELAVL1 protein in an animal are within the protection scope of the present invention.

[0027] Preferably, the ELAVL1 protein is zebrafish elavl1a protein.

[0028] Regarding the ELAVL1 gene, there are both the elavl1a gene and the elavl1b gene in zebrafish; the ELAVL1 protein described in the present invention is a protein encoded by the elavl1a gene in zebrafish.

[0029] Preferably, the animal is a zebrafish.

[0030] In the present invention, the sequence of the zebrafish elavl1a gene and its encoded protein can be obtained by a person skilled in the art through a public database. Specifically, the amino acid sequence of the zebrafish elavl1a protein is shown in SEQ ID NO.2 (accession number is NP_571527.1).

[0031] In a fourth aspect, the present invention provides the use of reducing the expression level and / or activity of ELAVL1 protein in preparing an attention deficit and hyperactivity disorder animal model.

[0032] Preferably, the ELAVL1 protein is zebrafish elavl1a protein. The gene encoding the elavl1a protein is the elavl1a gene.

[0033] Preferably, the animal is a zebrafish.

[0034] In some specific embodiments of the present invention, the reduction in expression level and / or activity of the ELAVL1 protein is achieved by knocking out the elavl1a gene.

[0035] In some specific embodiments of the present invention, the present invention provides the use of knocking out the elavl1a gene in preparing an attention deficit and hyperactivity disorder animal model.

[0036] In other embodiments of the present invention, an attention deficit hyperactivity disorder animal model is prepared by administering an inhibitor of ELAVL1 protein to an animal.

[0037] In a fifth aspect, the present invention provides the use of zebrafish with reduced expression and / or activity of ELAVL1 protein in preparing an attention deficit hyperactivity disorder animal model.

[0038] Zebrafish with reduced expression and / or activity of ELAVL1 protein show hyperactivity and / or impulsive phenotypes, and can be used to prepare or serve as an animal model of attention deficit hyperactivity disorder.

[0039] In a sixth aspect, the present invention provides a method for constructing an attention deficit and hyperactivity disorder animal model, the method comprising: reducing the expression level and / or activity of ELAVL1 protein in the animal.

[0040] Preferably, the reduction of the expression level and / or activity of the ELAVL1 protein is achieved by knocking out the ELAVL1 gene or administering an inhibitor of the ELAVL1 protein.

[0041] Preferably, the animal is a zebrafish.

[0042] In some specific embodiments of the present invention, the reduction in the expression level of the ELAVL1 protein is achieved by knocking out the elavl1a gene.

[0043] In some specific embodiments of the present invention, the reduction of the expression level of the ELAVL1 protein is achieved by administering an inhibitor of the ELAVL1 protein.

[0044] In some specific embodiments of the present invention, the construction method includes: knocking out the zebrafish elavl1a gene by CRISPR / Cas9 technology to construct a homozygous mutant of the elavl1a gene knockout.

[0045] Preferably, the targeting site sequence of the sgRNA used to knock out the elavl1a gene using CRISPR / Cas9 technology is as shown in SEQ ID NO.3.

[0046] The target site for knocking out the elavl1a gene using CRISPR / Cas9 technology is located on the third exon of the elavl1a gene.

[0047] Preferably, the construction method comprises: microinjecting sgRNA and Cas9 mRNA into zebrafish embryos at the single-cell stage, culturing with embryo culture medium after injection, and obtaining zebrafish fry with elavl1a gene knockout after identification. Cultivating zebrafish fry with elavl1a gene knockout, which is the F0 generation; testing the F0 generation of zebrafish with good elavl1a gene knockout effect with wild-type zebrafish to obtain the F1 generation, screening the F1 generation zebrafish with the same mutation site for self-pollination to obtain the F2 generation, and screening the F2 generation to obtain homozygous mutants with elavl1a gene knockout.

[0048] In a seventh aspect, the present invention provides the use of the attention deficit and hyperactivity disorder animal model constructed using the method described above in drug screening for the treatment of attention deficit and hyperactivity disorder.

[0049] The beneficial effects of the present invention include at least: the present invention found that ELAVL1 is significantly correlated with the occurrence and development of attention deficit hyperactivity disorder, and can be used as a drug target for the screening and development of drugs for the treatment of attention deficit hyperactivity disorder. Knocking out elavl1a can cause zebrafish to have a hyperactive-like phenotype, and administering drugs for the treatment of attention deficit hyperactivity disorder can alleviate the hyperactive-like phenotype caused by the loss of elavl1a. By knocking out ELAVL1, a zebrafish model of attention deficit hyperactivity disorder can be constructed, which is used for pathological research of attention deficit hyperactivity disorder and the screening and development of therapeutic methods such as drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the technical solutions in the present invention or the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0051] Figure 1This is a schematic diagram of the sgRNA targeting site constructed for the elavl1a gene knockout zebrafish mutant in Example 1 of the present invention, as well as the PCR amplification and enzyme digestion product electrophoresis detection results and sequencing results of the zebrafish mutant.

[0052] Figure 2 This is the detection result of the elavl1a protein level in the elavl1a gene knockout zebrafish mutant in Example 2 of the present invention.

[0053] Figure 3 and Figure 4 This is the result of detecting the hyperactive phenotype of the elavl1a gene knockout zebrafish mutant fry in Example 3 of the present invention.

[0054] Figure 5 The ELAVL1 gene SNP site in Example 4 of the present invention is significantly correlated with ADHD; wherein het represents a heterozygous genotype, and hom represents a homozygous genotype.

[0055] Figure 6 The SNP site mutation of the ELAVL1 gene in Example 4 of the present invention leads to a decrease in the expression of ELAVL1; wherein, the upper figure is the qRT-PCR test result, WT is the unmutated ELAVL1 gene, and rs14394 is the ELAVL1 gene carrying the rs14394 site mutation; the lower figure is the Western blot test result, HIS represents His-ELAVL1, Vinculin represents the actin filament (F-actin) binding protein, and the bottom is marked as the loading amount of His-ELAVL1 (rs14394) and His-ELAVL1 (WT) in each lane.

[0056] Figure 7 This is the treatment result of methylphenidate on the hyperactive behavior phenotype of elavl1a gene knockout zebrafish mutant larvae in Example 5 of the present invention.

[0057] Figure 8 This is the result of treating wild-type zebrafish fry with dihydrotanshinone in Example 6 of the present invention. DETAILED DESCRIPTION

[0058] In order to make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be clearly and completely described below in conjunction with the drawings of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0059] Example 1 Knockout of the elavl1a gene in zebrafish

[0060] In this example, a zebrafish mutant with elavl1a gene knockout was constructed, and the specific method is as follows: 1. Analyze the elavl1a gene and design gene knockout sites

[0061] The zebrafish elavl1a gene sequence was obtained through the NCBI and ensembl online databases, and the amino acid sequence of the protein encoded by the elavl1a gene is shown in SEQ ID NO. 2. In order to ensure that the knockout has a significant effect on the gene function and its specificity, the gene knockout site was designed in the exon region avoiding the presence of multiple homologous genes or homologous sequences. Based on the elavl1a gene sequence analysis results, the knockout site was designed on the third exon of the elavl1a gene.

[0062] 2. Design and synthesize sgRNA for the elavl1a gene

[0063] The sgRNA (single-guide RNA) targeting the target sequence can guide the Cas9 protein to bind to a specific gene site for cutting. The sgRNA targeting site designed in the present invention is located in the third exon of the elavl1a gene and contains the PAM region (NGG). The sgRNA targeting site sequence is as follows: TCTTCAGCAGCATTGG (SEQ ID NO.3), and is confirmed and verified by the NCBI online tool.

[0064] 3. Microinjection

[0065] (1) Transcription and purification to obtain sgRNA and Cas9 mRNA: Linearize the plasmid containing the above sgRNA site sequence as template DNA. After purifying the template DNA with phenol-chloroform, prepare the transcription reaction system as follows: 1 μL NTP (10 mM), 2 μL 10× reaction buffer, 0.2-1 μg template DNA, 2 μL T7 RNA Polymerase-Plus™ Enzyme Mix, 1 μL RNaseinhibitor, add DEPC water to 20 μL, and react at 37°C for 3 hours. After the reaction is completed, precipitate and purify sgRNA and Cas9 mRNA. After the concentration is detected, dilute with DECP water and store in aliquots at -80°C.

[0066] (2) Microinjection: The sgRNA and Cas9 mRNA obtained by transcription were diluted to 100 ng / μL and 150 ng / μL, respectively. Microinjection of sgRNA and Cas9 mRNA was performed when zebrafish embryos were in the single-cell stage, and the injection volume for each embryo was 2 nL. After injection, embryo culture medium was used to culture in an incubator at 28.5°C. On the fourth day, 10 embryos were randomly selected for lysis, and PCR amplification was performed using the upstream and downstream primers of the elavl1a gene gRNA to amplify the target sequence. The PCR reaction conditions were: 95°C, 30 seconds; 95°C, 30 seconds, 55°C, 20 seconds, 72°C, 20 seconds, 35 cycles; 72°C, 5 minutes; 4°C storage. 2% agarose gel electrophoresis for 30 minutes to observe the PCR results. The PCR amplification product was sent to a biological company for sequencing. The working condition of sgRNA and the microinjection results were analyzed according to the sequencing peak graph, and corresponding adjustments were made. After screening, heterozygous zebrafish larvae with elavl1a gene knockout were obtained.

[0067] 4. Screening and confirmation of homozygous mutants of elavl1a gene knockout in zebrafish

[0068] (1) Breed the elavl1a gene knockout heterozygous zebrafish fry obtained above (it takes about 2 months for the body shape to be identifiable) and record them as the F0 generation.

[0069] (2) The tail fins of 2-month-old F0 generation zebrafish were cut to lyse the genomic DNA, and the upstream and downstream primers of the elavl1a gene were used for PCR amplification and then sent to a biological company for sequencing. Zebrafish with better knockout effects were selected based on the sequencing peak graph and tested with wild-type AB strain zebrafish to obtain the F1 generation. The F1 generation was screened by sequencing to identify zebrafish with the same mutation site and self-crossed to obtain the F2 generation. The F2 generation was also screened by sequencing or using NEBcutter to query the restriction site (http: / / nc2.neb.com / NEBcutter2 / ).

[0070] (3) The above screening resulted in the F2 generation of zebrafish homozygous mutants with elavl1a gene knockout. The homozygous mutants were amplified by PCR using the upstream and downstream primers of the elavl1a gene gRNA to obtain the PCR products and the gel electrophoresis results of the products digested by MFeI as well as the sequencing results as shown in the following figure: Figure 1 shown.

[0071] Example 2 Detection of ELAVL1 protein levels in elavl1a gene knockout zebrafish mutants

[0072] The elavl1a protein level in the elavl1a gene knockout zebrafish mutant was detected by the following method: 1. Protein sample preparation

[0073] (1) Take the wild type of elavl1a gene (elavl1a + / + ) and the elavl1a gene knockout heterozygous type (elavl1a + / - ) and elavl1a knockout homozygous mutant (elavl1a - / - ) Adult zebrafish fins were added to RIPA lysis buffer (containing PMSF) and ground and lysed on ice for 30 minutes.

[0074] (2) Centrifuge at 15,000 rpm in a 4°C precooled centrifuge for 30 minutes and collect the supernatant.

[0075] (3) The protein concentration was detected by the BCA method. After adding an appropriate amount of loading buffer, the protein sample was denatured at 95°C for 5 minutes to obtain the protein sample.

[0076] 2. Western blot detection

[0077] (1) Use 5% stacking gel and 10% separating gel SDS-PAGE electrophoresis to separate the proteins in the sample.

[0078] (2) Perform electrophoresis at a constant current of 200 mA for 90 min and transfer the protein to a PVDF membrane by wet transfer.

[0079] (3) Use specific primary and secondary antibodies to identify and detect elavl1a protein.

[0080] (4) Finally, the relative expression level of elavl1a protein was analyzed by DAB colorimetry.

[0081] The results are as follows Figure 2 As shown, targeted mutation of the elavl1a gene significantly reduced the expression level of ELAVL1 protein in mutant zebrafish.

[0082] Example 3 Detection of hyperactive phenotype of elavl1a gene knockout zebrafish mutant

[0083] The phenotype of the elavl1a gene knockout zebrafish mutant was detected as follows: 1. Wild-type zebrafish embryos and elavl1a knockout homozygous mutant zebrafish embryos were cultured in embryo culture medium (E3: 0.5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl, 0.33 mM MgCl) at 28.5°C.

[0084] 2. 5 dpf zebrafish larvae were selected for behavioral testing using a high-throughput monitoring system (behavioral instrument, ViewPoint Life Sciences Lissieu, Calvados, Lower Normandy, France).

[0085] 3. Place 5 dpf fry in a 96-well plate and add 300 μL embryo culture medium to each well.

[0086] 4. Before the experiment begins, place the fry in the behavior instrument to adapt to the environment for 20 minutes.

[0087] 5. Perform behavioral monitoring according to the set program and record data every 30 seconds; the set program is as follows: 2 hours of darkness, 20 minutes of light stimulation (1 minute of light, 1 minute of darkness, 10 cycles), 2 hours of darkness, 20 minutes of sound stimulation (1 minute of sound, 1 minute of keystroke, 10 cycles), 2 hours of darkness, 7 hours and 20 minutes of light, 10 hours of darkness, all light intensity settings that require light are 100% (8000 Lux), and the sound stimulation intensity is 440Hz.

[0088] The results are as follows Figure 3 and Figure 4 As shown, elavl1a + / - ,elavl1a - / - With elavl1a + / + Compared with juvenile fish, the swimming distance increased, and the swimming distance increased under light conditions, dark conditions, and stimulation conditions (light stimulation, sound stimulation), indicating that the elavl1a gene knockout zebrafish mutant showed a hyperactive phenotype.

[0089] Example 4: ELAVL1 gene is associated with ADHD

[0090] The association between the ELAVL1 gene and human ADHD was tested as follows: 1. Detect the association between single nucleotide polymorphism (SNP) site mutation of ELAVL1 gene and ADHD

[0091] (1) Collect blood samples using EDTA anticoagulant tubes and store them at 4°C to ensure that there is no contamination during the collection process.

[0092] (2) To obtain reliable test results, blood samples should be centrifuged at 3000 g for 15 minutes within 3 hours to separate plasma, white blood cells and red blood cells, and then frozen at -80°C.

[0093] (3) White blood cells are extracted to obtain genomic DNA. After PCR amplification using specific primers, the nucleic acid sequence of the target region is obtained using the Sanger sequencing method, and the SNP sites are compared to determine whether there are any mutation sites.

[0094] In this example, 204 blood samples from healthy people and 314 blood samples from ADHD patients were tested, and the results were as follows: Figure 5 It shows that the ELAVL1 gene is correlated with ADHD, and its SNP site rs14394 shows a significant correlation with ADHD.

[0095] Figure 5 The specific information of SNP sites such as rs14394 involved is described as follows.

[0096] rs14394, this SNP site is located at position 7963660 of human chromosome 19 (reference genome is GRCh38.p14), and the polymorphism is A>G / A>T. The sequences of the two detection primers (5'-3') of this SNP site are: gcggatcactttcacattgg; gccccaggttgtagatgaaa.

[0097] rs2042920, this SNP site is located at position 7959800 of human chromosome 19 (reference genome is GRCh38.p14), and the polymorphism is A>C. The sequences of the two detection primers (5'-3') of this SNP site are: ttgcgaagtttggggacag; agtaggtgaggtaggtctg.

[0098] rs12983784, this SNP site is located at position 7960607 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is T>A / T>C, and the sequences of the two detection primers (5'-3') of this SNP site are: acactgaaaacgaaataatggc; ggaagttacacacgggtcaa.

[0099] rs10402477, this SNP site is located at position 7961562 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is C>T, and the sequences of the two detection primers (5'-3') of this SNP site are: gagcagggaccctctttt; tctgggattctgtgggag.

[0100] rs74369359, this SNP site is located at position 7962719 of human chromosome 19 (the reference genome is GRCh38.p14), the polymorphism is G>A / G>T, and the sequences of the two detection primers (5'-3') of this SNP site are: ttatcgtgaacaacagtatcc; ctgactctggaatatactgga.

[0101] 2. The mutation of SNP site rs14394 of ELAVL1 gene will cause the change of ELAVL1 expression level: (1) Design and synthesize the ELAVL1 expression vector His-ELAVL1(WT) and the ELAVL1 mutant expression vector His-ELAVL1(rs14394).

[0102] (2) Transfect the plasmids into cells and harvest the cells after expression. Use RIPA method to extract protein and Trizol method to extract RNA.

[0103] (3) Detection of ELAVL1 RNA expression level by qRT-PCR: RNA was first reverse transcribed into cDNA by a one-step method. The reaction mixture was prepared according to the manufacturer's protocol using a QuantStudio™ Dx real-time fluorescence quantitative PCR instrument and ChamQ Universal SYBR qPCR Master Mix. Each sample was repeated three times to detect the expression level of the ELAVL1 gene by q-PCR.

[0104] (4) Western blot was used to detect the expression level of ELAVL1 protein (refer to Example 2 for the method).

[0105] The results show that ( Figure 6 ), mutation of SNP site rs14394 of ELAVL1 gene will cause decreased expression of ELAVL1.

[0106] Example 5 MPH treatment of elavl1a gene knockout zebrafish larvae can rescue the hyperactive phenotype

[0107] The elavl1a gene knockout zebrafish larvae were treated with methylphenidate (MPH), a current clinical drug for the treatment of ADHD, as follows: 1. Select zebrafish embryos at 6 hours post fertilization (6 hpf) and place 30 per well in a 6-well plate.

[0108] 2. The control group was immersed in E3 culture medium containing DMSO, and the treated group was immersed in E3 culture medium containing 20 μM MPH (dissolved in DMSO).

[0109] 3. Replace the culture medium every 24 hours.

[0110] 4. After 5 days of treatment, the behavior of the zebrafish fry was monitored (refer to Example 3 for the method).

[0111] The results are as follows Figure 7 It was shown that the control group (containing DMSO) elavl1a - / - Zebrafish larvae swim farther than elavl1a + / +The expression of elavl1a in zebrafish larvae increased significantly, indicating that DMSO did not affect the original phenotype of zebrafish larvae, while after MPH treatment, - / - The swimming distance of zebrafish larvae was significantly shortened, indicating that MPH could alleviate the hyperactive behavior caused by elavl1a deficiency.

[0112] Example 6 Treatment of zebrafish larvae with dihydrotanshinone can induce a hyperactive phenotype

[0113] Dihydrotanshinone I (DHT), a known inhibitor of ELAVL1 protein expression, was used to treat wild-type zebrafish (AB) embryos to reduce the level of ELAVL1 as described below.

[0114] 1. Select zebrafish larvae 5 days after fertilization and place 25 per well in a 6-well plate; 2. The control group was immersed in E3 culture medium containing DMSO, and the treatment group was immersed in E3 culture medium containing gradient concentrations of DHT (dissolved in DMSO, 10 nM, 100 nM, 1000 nM); 3. After immersion for 5 minutes, the behavior of the zebrafish fry was monitored (the method is as in Example 3).

[0115] The results are as follows Figure 8 As shown in the figure, the swimming distance of wild-type zebrafish larvae increased after DHT treatment, and significantly increased at a concentration of 1000 nM, further proving that reduced ELAVL1 protein expression will lead to a hyperactive phenotype in zebrafish larvae.

[0116] Example 7 Construction of ADHD zebrafish model

[0117] This embodiment provides a method for constructing an ADHD zebrafish model, and the steps are as follows: 1. When the zebrafish embryo is in the single-cell stage, the sgRNA targeting the elavl1a gene (the targeting site sequence is as follows: TCTTCAGCAGCATTGG) and Cas9 mRNA are microinjected, and the heterozygous zebrafish fry with elavl1a gene knockout are obtained through cultivation and screening. The fry obtained above are cultivated to obtain the F0 generation.

[0118] 2. The heterozygous F0 generation zebrafish with elavl1a gene knockout were test-crossed with wild-type zebrafish to obtain the F1 generation, and the F1 generation was self-crossed to obtain the F2 generation. After screening, the homozygous mutant of the F2 generation zebrafish with elavl1a gene knockout was obtained, which is the ADHD zebrafish model.

[0119] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of ELAVL1 protein or its encoding gene as a drug target in screening drugs for the treatment of attention deficit and hyperactivity disorder.

2. The use according to claim 1, characterized in that: The drug comprises one or more selected from the group consisting of an ELAVL1 protein expression promoter, an ELAVL1 protein encoding gene expression promoter, and an ELAVL1 protein activity promoter.

3. Use of one or more selected from ELAVL1 protein expression promoters, ELAVL1 protein encoding gene expression promoters, and ELAVL1 protein activity promoters in the preparation of a drug for treating attention deficit and hyperactivity disorder.

4. Application of ELAVL1 protein or its encoding gene in the preparation of attention deficit hyperactivity disorder animal model.

5. The use according to claim 4, characterized in that: The application includes: reducing the expression level of ELAVL1 protein in an animal and / or reducing the activity of ELAVL1 protein in an animal.

6. The use according to claim 4 or 5, characterized in that: The ELAVL1 protein is zebrafish elavl1a protein, and / or the animal is zebrafish.

7. Application of zebrafish with reduced expression and / or activity of ELAVL1 protein in the preparation of animal models of attention deficit and hyperactivity disorder.

8. A method for constructing an attention deficit hyperactivity disorder animal model, characterized in that: The method comprises: reducing the expression level and / or activity of ELAVL1 in an animal.

9. The method according to claim 8, characterized in that The reduction of the expression level and / or activity of ELAVL1 is achieved by knocking out the elavl1 gene or administering an inhibitor of the ELAVL1 protein; Preferably, the animal is a zebrafish.

10. Use of the attention deficit hyperactivity disorder animal model constructed by the method according to claim 8 or 9 in drug screening for the treatment of attention deficit hyperactivity disorder.

Images