Application of CircDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury

Abstract

The present invention relates to the technical field of application of circRNADhx9 (circDhx9), and specifically, discloses the application of CircDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury, and relates to the use of circDhx9 as a molecular target for the treatment of myocardial ischemia-reperfusion injury, which belongs to the technical field of biomedicine. The present invention designs a shRNA that can knock down the expression of circDhx9, and constructs an adeno-associated virus vector HBAAV2 / 9‑circDhx9shRNA‑EGFP of shRNA. It has been detected that circDhx9 is significantly upregulated in the heart after myocardial ischemia-reperfusion. The shRNA adeno-associated virus vector prepared by the present invention can effectively reduce the expression of circDhx9 in the mouse heart, thereby reducing the myocardial infarction area of ​​myocardial ischemia-reperfusion mice, improving cardiac function, and realizing the use of circDhx9 to treat myocardial ischemia-reperfusion injury. The present invention provides an important supplement to the biological function of circDhx9, provides an effective treatment for myocardial ischemia-reperfusion injury, and also provides a theoretical basis for the application of circDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to application of circDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury. Background Art

[0002] Vascular stenosis caused by atherosclerotic lesions in the coronary arteries can lead to myocardial ischemia and hypoxia, thus causing ischemic heart disease, i.e., coronary heart disease. In clinical treatment, percutaneous coronary intervention, thrombolysis, and coronary artery bypass grafting are often used to restore myocardial blood supply (reperfusion), and these treatment measures have achieved certain results. However, reperfusion therapy may lead to cardiac dysfunction and myocardial tissue damage, manifested as reduced contraction and relaxation capacity, myocardial infarction, oxidative stress, etc. This phenomenon is called myocardial ischemia-reperfusion (IR) injury. Therefore, finding effective intervention measures has become a difficult problem that needs to be solved urgently in clinical practice.

[0003] Circular RNA (circRNA) is a special type of non-coding RNA molecule with a closed ring structure. It is widely present in eukaryotic organisms, is not affected by RNA exonucleases, is stably expressed and is not easily degraded. In recent years, with the development of high-throughput transcriptome sequencing technology, more and more circRNAs have been found to be associated with cardiovascular events, which predicts that they play an important role in the occurrence and development of diseases. Experimental studies have also shown that during myocardial ischemia-reperfusion injury, the expression of circRNAs has changed significantly and is associated with myocardial cell apoptosis and cardiac dysfunction. Therefore, circRNAs have broad development and application prospects in the treatment of myocardial ischemia-reperfusion injury.

[0004] CircDhx9 (circbaseID: mmu-Dhx9_0001) is located at chr1:153482742-153483872 in the genome, and the length of the cyclized sequence is 274bp. CircDhx9 is expressed in both human and mouse hearts. So far, there has been no research or report on the use of circDhx9 in the treatment of myocardial ischemia-reperfusion injury. Summary of the invention

[0005] In order to solve the above technical problems, the present invention aims to provide an application of circDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury. By designing shRNA of circDhx9 and constructing an adeno-associated virus vector HBAAV2 / 9-circDhx9 shRNA-EGFP of shRNA, myocardial infarction and cardiac dysfunction are intervened, thereby realizing the use of circDhx9 to treat myocardial ischemia-reperfusion injury.

[0006] To achieve the above objectives, the first aspect of the present invention constructs an isolated heart ischemia-reperfusion model, providing:

[0007] A use of circDhx9 as a molecular target in the treatment of myocardial ischemia-reperfusion injury, wherein the nucleotide sequence of circDhx9 is shown in SEQ ID NO. 1: GTGTGAAGAAGACACCTGAATCATGG GTGACATTAAAAATTTTCTGTATGCCTGGTGTGGCAAAAGGAAGATGACTCCAGCCTATGAAATTAGAGCAGTAGGAAACAAAAACAGACAGAAATTCATGTGTGAGGTTCGAGTAGAAGGGTTTAATTATGCTGGTATGGGCAATTCCACCAATAAAAAGGATGCACAGAGCAATGCTGCCAGAGACTTTGTTAACTATTTGGTTCGAATAAATGAAGTAAAGAGTGAAGAAGTTCCAGCTGTTGGG. The circDhx9 is significantly upregulated in the heart with myocardial ischemia-reperfusion, causing cardiac structural and functional damage.

[0008] A second aspect of the present invention provides:

[0009] A shRNA targeting the expression level of circDhx9 is cloned into an interference vector (pHBAAV-U6-MCS-CMV-EGFP) to obtain an adeno-associated virus vector of shRNA (HBAAV2 / 9-circDhx9 shRNA-EGFP), wherein the shRNA sequence includes a Top Strand and a Bottom Strand, the Top Strand nucleotide sequence is shown in SEQ ID NO.6, and the Bottom Strand nucleotide sequence is shown in SEQ ID NO.7.

[0010] The construction method comprises the following steps: (1) preparation of shRNA adeno-associated virus vector, (2) shRNA adeno-associated virus packaging. The specific steps of constructing shRNA adeno-associated virus vector are as follows: (1) designing shRNA target and synthetic primers; (2) PCR amplification and product recovery; (3) vector enzyme digestion; (4) connecting interference fragments with vectors; (5) transformation of connected products; (6) bacterial liquid PCR identification; (7) sequencing identification; (8) plasmid extraction: bacterial liquid amplification, plasmid extraction and purification.

[0011] The specific steps of shRNA adeno-associated virus packaging are as follows: (1) Prepare packaging cell line 293T and strain Stbl3: 293T, adeno-associated virus packaging cells, Stbl3, used to amplify adeno-associated virus vectors and auxiliary packaging vector plasmids; (2) The three-plasmid adeno-associated virus system includes: a vector plasmid carrying shRNA, a pAAV-RC vector plasmid, and a pHelper vector plasmid; (3) Transfect 293T cells with the three-plasmid system; (4) Collect cell precipitates; (5) Purify adeno-associated viruses; (6) Detect the quality of adeno-associated viruses.

[0012] A third aspect of the present invention provides:

[0013] The invention discloses an application of a shRNA adeno-associated virus vector targeting circDhx9 in the treatment of myocardial ischemia-reperfusion injury. The shRNA adeno-associated virus vector has the effect of reducing myocardial ischemia-reperfusion injury and improving cardiac function. The tissue damage index is the myocardial infarction area, the oxidative stress index includes superoxide dismutase (SOD) and malondialdehyde (MDA), and the cardiac function index includes: left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), heart rate (HR), maximum rate of left ventricular pressure rise (+dP / dtmax), maximum rate of left ventricular pressure drop (-dP / dt max), and rate pressure product (RPP).

[0014] A fourth aspect of the present invention provides:

[0015] A drug for preventing and treating myocardial ischemia-reperfusion injury, characterized in that the drug contains the above-mentioned shRNA or the above-mentioned expression vector.

[0016] The present invention has the following beneficial effects:

[0017] The present invention proves that circDhx9 is highly expressed in myocardial tissue after ischemia-reperfusion, designs a shRNA that can target circDhx9 expression, and constructs an adeno-associated virus vector HBAAV2 / 9-circDhx9 shRNA-EGFP of shRNA. According to the test, the shRNA adeno-associated virus vector prepared by the present invention can knock down the expression of circDhx9, significantly reduce the area of ​​myocardial infarction in mice after ischemia-reperfusion, inhibit the occurrence of oxidative stress, and significantly improve cardiac function, which provides an important supplement for the biological function of circDhx9 and provides an effective treatment for myocardial ischemia-reperfusion injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is a comparison chart of the expression results of circDhx9 in ischemia-reperfusion myocardial tissue and non-ischemic myocardial tissue detected by qRT-PCR.

[0019] Figure 2 This is a comparison of the relative expression levels of RNA after digestion of circDhx9 and mDhx9 with RNase R.

[0020] Figure 3 This is the first-generation sequencing map of the splicing sites of the circDhx9 amplification product.

[0021] Figure 4 This is a diagram showing changes in cardiac function after ischemia-reperfusion in mice with circDhx9 knockdown.

[0022] Figure 5 This is a diagram of myocardial infarction area after ischemia-reperfusion in mice with circDhx9 knockdown.

[0023] Figure 6 This is a graph showing the levels of SOD and MDA after ischemia-reperfusion in mice with circDhx9 knockdown. DETAILED DESCRIPTION

[0024] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution will be clearly and completely described below in conjunction with specific embodiments. The described embodiments are only part of the embodiments of the present invention, not all embodiments. Specific conditions are not indicated in the following embodiments, and are usually implemented according to conventional conditions or according to the conditions recommended by the manufacturer.

[0025] The main materials and reagents used in the present invention are shown in Table 1:

[0026] Table 1 Main materials and reagents

[0027]

[0028] Example 1: Analysis of circDhx9 expression levels in myocardial tissue after ischemia-reperfusion injury

[0029] In this example, based on the previously screened human-mouse conserved circDhx9 from sequencing data, qRT-PCR was used to detect the expression of circDhx9 in ischemia-reperfusion and non-ischemic cardiac tissues, and the primer sequences of circDhx9 are shown in SEQ ID NO: 2 and SEQ ID NO: 3. The specific experimental scheme is as follows:

[0030] (1) Sample collection: Heart tissues were collected after perfusion, frozen in liquid nitrogen, and stored in a -80°C refrigerator.

[0031] (2) RNA extraction: Heart tissue was obtained, ground with liquid nitrogen, and 1 mL of TriZol reagent was added. After sufficient lysis by blowing, 200 mL of chloroform was added, and the mixture was mixed by vortexing. The mixture was allowed to stand at room temperature for 3 min. The mixture was centrifuged at 4°C, 12,000 rpm, and 15 min. The upper clear solution was transferred to a new EP tube, and an equal volume of isopropanol was added. The mixture was allowed to stand at room temperature for 10 min. The mixture was centrifuged at 4°C, 12,000 rpm, and the supernatant was discarded to obtain a white precipitate. The precipitate was washed twice with 75% alcohol (prepared with DEPC water), and centrifuged at 4°C, 7,500 rpm, and the supernatant was discarded. After the ethanol evaporated, the RNA was dissolved in 20-30 μL of DEPC water, and the RNA concentration was measured for quantification.

[0032] (3) gDNA genome removal

[0033] Take a 200 μL centrifuge tube and add the following reagents to prepare the reaction system:

[0034]

[0035] Reaction conditions: 42°C, 2 min, 4°C, storage.

[0036] (4) Reverse transcription reaction

[0037]

[0038] Reaction conditions: 25°C, 5 min; 42°C, 30 min; 85°C, 5 min.

[0039] (5) qRT-PCR was used to detect the expression level of circDhx9 in ischemia-reperfusion and non-ischemic myocardial tissues. The reaction system was as follows:

[0040]

[0041] Reaction conditions: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s, 40 cycles; 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0042] (6) Result analysis: The Ct values ​​of the target gene and the reference gene were recorded, and the 2^(-ΔΔCt) value was calculated to express the expression level of circDhx9.

[0043] Results Figure 1 Compared with the non-ischemic group, circDhx9 was significantly upregulated in myocardial tissue after ischemia-reperfusion.

[0044] Example 2: Identification of CircDhx9

[0045] In this example, the inventors used Primer-NCBI to design primers for circDhx9 across the cyclization site, and the primer sequences were as follows: F: 5'-TGCTGCCAGAGACTTTGTTAAC-3' (SEQ ID NO: 2), R: 5'-GAGTCATCTTCCTTTTGCCA-3' (SEQ ID NO: 3), qRT-PCR was used to amplify circDhx9, and Sanger sequencing was used to determine whether the cyclization site of circDhx9 was amplified, and then RNase R was used to treat total RNA to verify the molecular stability of circDhx9. The specific experimental method is as follows:

[0046] 1. Sanger sequencing

[0047] (1) Total RNA extraction from tissues was performed as in Example 1. Primers for circDhx9 across the circular site were designed using the Primer-NCBI online tool. The primer sequences were as shown in SEQ ID NO: 2 and SEQ ID NO: 3. The primer design principles were as follows: (1) The GC content of the primers was 50-60%; (2) The primer length was 18-24 bp; (3) The primer Tm was 55-65°C; (4) G or C base duplication was avoided; (5) The primer terminal base was avoided to be A; (6) The product length was between 100-150 bp. The designed primers were used to perform PCR amplification using mouse heart cDNA as a template. The qRT-PCR reaction system was as follows:

[0048]

[0049] Reaction conditions: 95°C, 30 s; 95°C, 5 s; 60°C, 34 s, 40 cycles; 95°C, 15 s; 60°C, 1 min; 95°C, 15 s.

[0050] (2) Identification of amplified fragments by agarose gel electrophoresis: 2% agarose gel was prepared, the PCR product was mixed with 10× loading buffer, and then added to the wells in the loading order. Electrophoresis was performed at 110 V for 30 min. The correct position and specificity of the electrophoresis bands were observed using the Gel Doc XR System analysis system. The amplified products were then sequenced to determine whether the cyclization site of circDhx9 was amplified.

[0051] 2. RNase R Digestion

[0052] RNase R is an RNase that can digest linear RNA but has little effect on circRNA. Therefore, RNase R was used to treat mouse heart total RNA to verify the molecular stability of circDhx9. The reaction system is as follows:

[0053]

[0054] Reaction conditions: 37°C, 30 min; 4°C, storage. The treated RNA was reverse transcribed into cDNA and the abundance changes were detected by PCR.

[0055] Results Figure 2-3 , circDhx9 originates from the exon of the Dhx9 gene. The first-generation sequencing results show that circDhx9 is a head-to-tail circRNA. The red arrow indicates the cyclization site of the amplified product, indicating that the formation of circDhx9 is not due to genomic recombination mismatch. The comparison of RNase R digestion of circDhx9 and mDhx9 showed that the abundance of linear RNADhx9 was significantly reduced after RNase R digestion, and its expression level was almost undetectable, while the abundance of circDhx9 remained basically unchanged, indicating that RNase R can digest linear RNA, while circDhx9 tolerates RNase R digestion.

[0056] Example 3: Construction of CircDhx9 shRNA adeno-associated virus vector and viral packaging

[0057] 1. Construction of adeno-associated virus vector for shRNA

[0058] (1) Vector information: The interference vector selected is pHBAAV-U6-MCS-CMV-EGFP

[0059] (2) shRNA target design and primer synthesis:

[0060] Control viral vector shRNA sequence:

[0061] Top strand:GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC(SEQ ID NO:4)

[0062] Bottom strand: AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG (SEQ ID NO: 5)

[0063] Target gene shRNA sequence:

[0064] Top strand: AATTCGCCAGCTGTTGGGGTGTGAAGAAGACTTCAAGAGA GTCTTCTTCACACCCCAACAGCTGGTTTTTTG (SEQ ID NO: 6)

[0065] Bottom strand: GATCCAAAAAACCAGCTGTTGGGGTGTGAAGAAGACTC TCTTGAAGTCTTCTTCACACCCCAACAGCTGGCG (SEQ ID NO: 7)

[0066] (3) Primers anneal to form double-stranded fragments with sticky ends. The system is as follows:

[0067]

[0068] Reaction conditions: 95°C, 10 min; 75°C, 10 min; 55°C, 10 min; 35°C, 10 min; 15°C, 10 min.

[0069] (4) Enzyme digestion of the vector, the enzyme digestion system is as follows:

[0070]

[0071] Reaction conditions: 37°C, 1-2h.

[0072] (5) The interference fragment is connected to the vector, and the reaction system is as follows:

[0073]

[0074] Reaction conditions: 22°C, 2h.

[0075] (6) Transformation: After taking out the DH5α competent cells from the -80℃ refrigerator, immediately place them on ice to thaw; after the competent cells thaw, dispense them into 50μL volumes per tube, add 5μL of the ligation product after dispensing, and place them on ice for 20-30min; heat shock them at 42℃ for 90s, and then incubate them on ice for 2-3min; add 500μL LB medium, and gently turn them upside down 3-5 times; shake and incubate them at 37℃ and 230rpm for 45-60min; apply the bacterial solution to the solid plate of the corresponding resistance, spread it evenly, and incubate the plate upside down at 37℃ incubator for 12-16h.

[0076] (7) Bacterial liquid PCR identification, the identification system is as follows:

[0077]

[0078] Reaction conditions: 94°C, 5 min; 94°C, 30 s; 56°C, 30 s; 72°C, 30-60 sec / Kb, 25 cycles; 72°C, 10 min; 12°C, 0 min.

[0079] (8) Sequencing: Identification of positive clones indicates the successful construction of HBAAV2 / 9-circDhx9 shRNA-EGFP

[0080] (9) Plasmid extraction: After successful sequencing, arrange for bacterial culture amplification and perform plasmid extraction and purification.

[0081] 2. Adeno-associated virus packaging and quality testing

[0082] (1) AAV-293 cells were subcultured and cultured at 37°C, 5% CO2, and 95% relative humidity.

[0083] (2) Transfection: Transfection was performed when the cell density reached 80-90% confluence. The components of the transfection complex were as follows:

[0084]

[0085] (3) Medium change: 6 hours after transfection, replace the medium with complete medium containing 10% fetal bovine serum.

[0086] (4) Cell collection: 72 h after transfection, cells containing AAV particles were scraped off and centrifuged at 150 × g for 3 min to collect the cells. The culture supernatant was removed and the cells were resuspended in 300 μL PBS.

[0087] (5) Cell disruption: The cells were repeatedly frozen and thawed three times in liquid nitrogen and 37°C water bath, centrifuged at 2000×g for 5 min, the cell debris were removed, and the lysis supernatant containing AVV particles was collected.

[0088] (6) Adeno-associated virus purification: Add 0.1 μL Benonase enzyme to each 1 mL of crude virus extract, incubate in a 37°C water bath for 1 h to remove the cell genome and residual plasmid DNA in the virus solution, centrifuge at 600 rpm and 4°C for 10 min, and take the supernatant. Purify using Biomiga Adeno-associated Virus Purification Kit V1469-01, add the purified virus sample liquid to an ultrafiltration tube, and centrifuge at 1400 rpm for 30 min to obtain the purified virus.

[0089] (7) Take the purified virus for sterility test, mycoplasma test and virus titer test.

[0090] The results showed that the shRNA adeno-associated virus vector HBAAV2 / 9-circDhx9shRNA-EGFP of circDhx9 and the control virus vector HBAAV2 / 9-EGFP (NC control) were successfully constructed, and the virus packaging was completed.

[0091] Example 4.: HBAAV2 / 9-circDhx9 shRNA-EGFP reduces myocardial ischemia-reperfusion injury

[0092] 1. Construction of Myocardial Ischemia-Reperfusion Model

[0093] The present invention designed shRNA for knocking down circDhx9, and used adeno-associated virus serotype AAV9 as a vector, which was injected into C57 BL / 6J mice through the tail vein at 2 months of age. One month later, a control and myocardial ischemia-reperfusion model was established, and the mice were divided into a control group (Con group), an ischemia-reperfusion group (IR group), a virus control group (shRNA-Con, injected with HBAAV2 / 9-circDhx9 shRNA-EGFP), a virus ischemia-reperfusion group (shRNA-IR, injected with HBAAV2 / 9-circDhx9 shRNA-EGFP), and a control virus vector ischemia-reperfusion group (NC-IR, injected with HBAAV2 / 9-EGFP). After the mouse spine was dislocated, the heart was quickly separated and placed in precooled perfusion fluid to pump out the blood in the coronary circulation. The aorta of the heart was connected to the perfusion needle of the Langendorff perfusion instrument and the perfusion fluid was reversely perfused. The left atrial appendage was cut off, and the pressure balloon was placed in the left ventricle. Water was injected into the balloon to maintain the diastolic pressure at 1-10 mmHg. Subsequent experiments were carried out after the heart beat was stable and the left ventricular systolic pressure was greater than 80 mmHg. The hearts of the control group were continuously perfused for 110 minutes, and the hearts of the ischemia-reperfusion group were perfused for 30 minutes and then stopped for 20 minutes, followed by reperfusion for 120 minutes. After the experiment, heart tissue samples were collected and frozen for later use.

[0094] 2. Mouse Cardiac Function Monitoring

[0095] After the pressure measuring balloon was placed into the left ventricle, it was connected to a multichannel physiological recorder to record the entire LVDP, LVEDP, HR, +dP / dt max, -dP / dt max, and RPP.

[0096] Results Figure 4 Compared with the control group, the cardiac function in the ischemia-reperfusion group was significantly reduced, and knockdown of circDhx9 improved cardiac function, indicating that inhibition of circDhx9 can alleviate cardiac function damage after ischemia-reperfusion.

[0097] 3. TTC staining of mouse heart

[0098] After the experiment, the mouse hearts were collected and stored in a -20℃ refrigerator. After the hearts were frozen, they were taken out and cut into layers from the root of the aorta to the apex with a blade. Each slice was about 1 mm thick, and 5 to 6 slices were cut. The cut heart tissue slices were placed in 2% TTC dye solution and stained in the dark for about 10 minutes. After being taken out, they were scanned and photographed. Finally, ImageJ software was used for statistical analysis of infarct area.

[0099] Results Figure 5 Compared with the control group, the myocardial infarction area in the ischemia-reperfusion group was significantly increased, and knockdown of circDhx9 could significantly reduce the infarction area, proving that knockdown of circDhx9 can alleviate tissue damage caused by myocardial ischemia-reperfusion.

[0100] 4.SOD and MDA content detection

[0101] After the experiment, the mouse hearts were collected, the tissues were homogenized, the supernatant was taken to measure the absorbance, and the superoxide dismutase (SOD) and malondialdehyde (MDA) contents were calculated by the formula.

[0102] Results Figure 6 Compared with the control group, the SOD content in the heart of the ischemia-reperfusion group was significantly decreased, and the MDA content was significantly increased. Knockdown of circDhx9 could significantly increase the SOD content and reduce the MDA content, which proved that knockdown of circDhx9 could reduce myocardial oxidative stress and thus avoid myocardial ischemia-reperfusion injury.

[0103] In summary, the shRNA adeno-associated virus vector designed in the present invention can target circDhx9, downregulate the expression level of this circular RNA, significantly reduce the myocardial infarction area after myocardial ischemia-reperfusion, reduce oxidative stress, and improve cardiac function. That is, circDhx9 can be used as an intervention target for reducing myocardial infarction area, reducing oxidative stress and improving cardiac function after ischemia-reperfusion injury, providing a new strategy for the treatment of myocardial ischemia-reperfusion injury.

[0104] The above description is only a preferred specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical solutions and concepts of the present invention within the technical scope disclosed by the present invention, and they should be covered by the protection scope of the present invention.

Claims

1. A shRNA for knocking down the expression of circDhx9, the shRNA comprising a Top Strand and a Bottom Strand, wherein the Top Strand nucleotide sequence is shown in SEQ ID NO.6, and the Bottom Strand nucleotide sequence is shown in SEQ ID NO.

7.

2. The shRNA according to claim 1, characterized in that The shRNA can be packaged into an AAV9 adeno-associated virus vector.

3. An expression vector comprising the shRNA according to claim 2, characterized in that: The expression vector is pHBAAV-U6-MCS-CMV-EGFP.

4. The expression vector according to claim 3, characterized in that The expression vector is HBAAV2 / 9-circDhx9shRNA-EGFP.

5. Use of the shRNA according to claim 1 or 2 or the expression vector according to claim 3 or 4 in the preparation of a drug for preventing and treating myocardial ischemia-reperfusion injury in mice.

6. The use according to claim 5, characterized in that: The prevention and treatment indicators of myocardial ischemia-reperfusion injury include myocardial infarction area, superoxide dismutase content, malondialdehyde content, left ventricular developed pressure (LVDP), left ventricular end-diastolic pressure (LVEDP), heart rate (HR), maximum rate of increase of left ventricular pressure (+dP / dt max), maximum rate of decrease of left ventricular pressure (-dP / dt max), and rate-pressure product (RPP).

7. A drug for preventing and treating myocardial ischemia-reperfusion injury, characterized in that: The drug comprises the shRNA according to claim 1 or 2 or the expression vector according to claim 3 or 4.

8. The drug according to claim 7, characterized in that The drug can be injected intravenously into mice, and significantly reduces the area of ​​myocardial infarction after myocardial ischemia-reperfusion by inhibiting the level of circDhx9, alleviates oxidative stress response, and improves cardiac function.

Images