Application of reagent for inhibiting expression of mitochondrial protein SFXN1 in preparation of medicine for improving cardiopulmonary function of hypoxic pulmonary hypertension patient

Abstract

The invention discloses application of a reagent for inhibiting expression of mitochondrial protein SFXN1 in preparation of a medicine for improving the cardiopulmonary function of a patient with hypoxic pulmonary hypertension, the mitochondrial targeted protein SFXN1 related to hypoxic pulmonary hypertension is successfully screened out, and the expression of the hypoxic increased SFXN1 in PASMCs is proved. After SFXN1 expression is interfered, PASMCs abnormal proliferation phenotypes caused by hypoxia can be inhibited, and pulmonary vascular remodeling and right heart functions of HPH model mice can be relieved by knocking out SFXN1. And a new theoretical support and an action target can be provided for effective prevention and treatment of HPH.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for improving the cardiopulmonary function of patients with hypoxic pulmonary hypertension. Background Art

[0002] Hypoxic pulmonary hypertension (HPH) is a fatal disease characterized by increased pulmonary artery pressure accompanied by progressive remodeling, which eventually leads to right heart failure. Abnormal proliferation of pulmonary artery smooth muscle cells (PASMCs) caused by hypoxia is a key link in its occurrence. In recent years, mitochondria, as the central hub for sensing oxygen content, have received extensive attention for their mechanisms of changing various functions and phenotypes to adapt to hypoxia and / or cause intracellular homeostasis imbalance, thereby affecting HPH. We found that the expression of the mitochondrial inner membrane transmembrane protein SFXN1 was significantly upregulated in patients with pulmonary hypertension and mice with hypoxic pulmonary hypertension model. SFXN1 (Sideroflexin 1) belongs to the SLC56 protein family and is a transmembrane protein on the inner membrane of mitochondria, which is highly conserved in eukaryotic cells. Previous studies have suggested that the main function of this protein is to participate in the process of iron transport from the cytoplasm to the mitochondria. In 2018, Kory et al. first discovered that SFXN1 is a mitochondrial serine transporter that can transfer serine from the cytoplasm into the mitochondria and participate in the mitochondrial one-carbon metabolism process. Recent studies in 2024 suggest that SFXN1, which is highly expressed in patients with lung adenocarcinoma, regulates a variety of immune cell biological functions and is positively correlated with multiple cellular pathways such as cell cycle and DNA repair. However, the role of SFXN1 in the proliferation of PASMCs induced by hypoxia is still unclear. Therefore, this project conducts mechanistic research on whether and how SFXN1 participates in the formation of HPH, providing new ideas for preventing hypoxia-induced pulmonary vascular remodeling. Summary of the invention

[0003] In view of this, the object of the present invention is to provide a reagent for inhibiting the expression of mitochondrial protein SFXN1 for use in the preparation of a drug for improving the cardiopulmonary function of patients with hypoxic pulmonary hypertension.

[0004] In order to achieve the above object, the present invention provides the following technical solutions: Use of an agent that inhibits the expression of mitochondrial protein SFXN1 in the preparation of a drug for improving cardiopulmonary function in patients with hypoxic pulmonary hypertension.

[0005] Preferably, the present invention uses an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for inhibiting abnormal proliferation of pulmonary arterial smooth muscle cells in patients with hypoxic pulmonary hypertension.

[0006] Preferably, the present invention uses an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for improving right ventricular function in patients with hypoxic pulmonary hypertension.

[0007] Preferably, the present invention uses an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for reducing the maximum systolic pressure of the right ventricle in patients with hypoxic pulmonary hypertension.

[0008] Preferably, the present invention uses an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for treating right ventricular hypertrophy in patients with hypoxic pulmonary hypertension.

[0009] Preferably, in the present invention, the agent for regulating the expression of the mitochondrial protein SFXN1 is an agent for knocking down the SFXN1 gene, an agent for silencing the SFXN1 gene, or an inhibitor of the SFXN1 gene.

[0010] Preferably, the reagent for knocking out the SFXN1 gene is transformed using the CRISPR / Cas9 expression system as a vector and the SFXN1 gene as a target gene.

[0011] Preferably, the target site of the vector is located in exons 4 to 7 of the SFXN1 gene.

[0012] The beneficial effects of the present invention are as follows: the present invention successfully screened out the mitochondrial targeting protein SFXN1 related to hypoxic pulmonary hypertension, hypoxia increased the expression of SFXN1 in PASMCs, and interference with SFXN1 expression could inhibit the abnormal proliferation phenotype of PASMCs caused by hypoxia, and alleviate the pulmonary vascular remodeling and right heart function of HPH model mice. It can provide new theoretical support and action targets for the effective prevention and treatment of HPH. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration: Figure 1 The SFXN1 gene expression levels in lung tissues of PAH patients and PASMCs after hypoxia treatment; A: Changes in mRNA levels of one-carbon metabolism-related genes in the lungs of PAH patients, data source: GEO database: GSE113439; B: Changes in mRNA levels of SFXN1 gene in the lungs of PAH patients, CTRL is normoxic control, **: P<0.01; C: Changes in mRNA levels of one-carbon metabolism-related genes in hypoxic human PASMCs, 1% O2 for 48h; D: Immunohistochemistry of lung tissues of HPH model mice; E: Changes in protein levels of SFXN1 gene in normoxic control (C24, C48) and hypoxic (1% O2 for 48 hours; H24, H48) MPASMCs; F: Immunofluorescence of lung tissues of HPH model mice.

[0014] Figure 2 To investigate the inhibition of PASMCs proliferation under hypoxia by knocking down SFXN1; A: qPCR to verify the SFXN1 interference effect; B: CCK8 method to detect cell proliferation; C: EDU method to detect cell proliferation; D: Western Blot to detect the expression of proliferation-related protein Cyclin D1.

[0015] Figure 3 To investigate the improvement of right heart function and pulmonary vascular remodeling in HPH model mice by knocking down SFXN1. A:SFXN1 - / - Mouse PCR verification, detection primers: F1: 5'-CTGTAGATGCAGAAGTGTTTAGGC-3' (SEQ ID No. 1); R1: 5'-CTGGACATTCTCAAAGGGTCTTACT-3' (SEQ ID No. 2); R2: 5'-CTCGGGGTTCGTAAAGAGATGTTA-3' (SEQ ID No. 3); F1+R1 band size: wild type: 4495 bp, SFXN1 - / - : 802bp, F1+R2 band size: wild type: 735bp, SFXN1 - / - : No band; B: SFXN1 - / - Maximum systolic pressure of right ventricle in mice; C: SFXN1 - / - Immunohistochemistry of paraffin sections of mouse lung tissue. DETAILED DESCRIPTION

[0016] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0017] Example 1. Characteristics of SFXN1 expression changes in pulmonary artery smooth muscle cells of HPH model mice HPH animal model was established by using a hypobaric hypoxic chamber to simulate an altitude of 5800m and C57BL / 6 mice were hypoxic for 28 days. The whole lungs of mice were immediately removed after being killed by cervical dislocation. The expression characteristics of SFXN1 were verified by immunohistochemistry, RT-qPCR, and Western blot, and it was found that SFXN1 expression in mouse pulmonary artery smooth muscle cells increased significantly after 48 hours of hypoxia ( Figure 1 ).

[0018] Example 2: Detection of the effect of silencing SFXN1 on the abnormal proliferation phenotype of PASMCs under hypoxia Pulmonary vascular remodeling is a key link in the occurrence of hypoxic pulmonary hypertension, and abnormal proliferation of PASMCs is the main cause of pulmonary vascular remodeling. In order to study the role of SFXN1 in the proliferation of PASMCs, we interfered with the expression of SFXN1 in PASMCs by transfecting siRNA (siRNA-F: GCUGCUGCUAACUGCAUUATT'(SEQ ID No.4), siRNA-R: UAAUGCAGUUAGCAGCAGC TT'(SEQ IDNo.5), Shanghai Jima Pharmaceutical Technology Co., Ltd.). qPCR verification showed that this method can significantly reduce the expression of SFXN1. Combined with CCK8 and WB experiments, we found that interfering with the expression of SFXN1 significantly inhibited the excessive proliferation of PASMCs caused by hypoxia ( Figure 2 ).

[0019] Example 3: Preparation of SFXN1 knockout animal model and detection of pulmonary vascular remodeling and right heart function The SFXN1 gene knockout mouse model was constructed by CRISPR / Cas-mediated genome engineering technology. The SFXN1 gene is located in chromosome 13 in mice. A total of 11 exons were identified, of which the ATG start codon is located in exon 2 and the TGA stop codon is located in exon 11 (transcript SFXN1-201, NCBI accession number: CCDS26525). Exons 4 to 7 were selected as target sites. This region contains 389 bp of coding sequence. Cas9 / guide RNA ribonucleoprotein was injected into fertilized eggs for the production of KO mice (gRNA-F: GGTAATGCCACCCCTGCGCTGGG (SEQ ID No.6), gRNA-R: GCCTCCCCGCTGATGCCCGCTGG (SEQ ID No.7)). The pups were genetically identified by PCR and sequencing analysis. The effective knockout region size: ~3.7 kb (Saiye (Suzhou) Biotechnology Co., Ltd.). The SFXN1 knockout mice were placed in a hypobaric hypoxic chamber to simulate hypoxia at an altitude of 5800m for 28 days. Ultrasound was used to detect the hemodynamic changes and right heart function of the mice, and the right heart hypertrophy index of the mice was calculated by weighing (right ventricular hypertrophy index (RVHI): RVHI = right heart mass / (left heart mass + ventricular septum mass)). The pulmonary vascular remodeling was detected by immunofluorescence of paraffin sections of lung tissue. It was found that knockout of SFXN1 could significantly improve the right heart function of HPH mice, alleviate right ventricular hypertrophy caused by hypoxia, and inhibit the abnormal proliferation of pulmonary vascular smooth muscle cells ( Figure 3 ).

[0020] The above-described embodiments are only preferred embodiments for fully illustrating the present invention, and the protection scope of the present invention is not limited thereto. Equivalent substitutions or changes made by those skilled in the art based on the present invention are within the protection scope of the present invention. The protection scope of the present invention shall be subject to the claims.

Claims

1. Use of an agent that inhibits the expression of mitochondrial protein SFXN1 in the preparation of a drug for improving the cardiopulmonary function of patients with hypoxic pulmonary hypertension.

2. The use according to claim 1, characterized in that: Use of an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for inhibiting abnormal proliferation of pulmonary arterial smooth muscle cells in patients with hypoxic pulmonary hypertension.

3. The use according to claim 1, characterized in that: Use of an agent that inhibits the expression of mitochondrial protein SFXN1 in the preparation of a drug for promoting pulmonary vascular remodeling in patients with hypoxic pulmonary hypertension.

4. The use according to claim 1, characterized in that: Use of an agent that inhibits the expression of mitochondrial protein SFXN1 in the preparation of a drug for improving right ventricular function in patients with hypoxic pulmonary hypertension.

5. The use according to claim 4, characterized in that: Use of an agent that inhibits the expression of mitochondrial protein SFXN1 in the preparation of a drug for reducing the maximum systolic pressure of the right ventricle in patients with hypoxic pulmonary hypertension.

6. The use according to claim 5, characterized in that: Use of an agent for inhibiting the expression of mitochondrial protein SFXN1 in the preparation of a drug for treating right ventricular hypertrophy in patients with hypoxic pulmonary hypertension.

7. The use according to any one of claims 1 to 6, characterized in that: The agent for inhibiting the expression of mitochondrial protein SFXN1 is an agent for knocking down the SFXN1 gene, an agent for silencing the SFXN1 gene, or an inhibitor of the SFXN1 gene.

8. The use according to claim 7, characterized in that: The reagent for knocking out the SFXN1 gene is transformed using the CRISPR / Cas9 expression system as a vector and the SFXN1 gene as a target gene.

9. The use according to claim 8, characterized in that: The target site of the vector is located at exons 4 to 7 of the SFXN1 gene.

Images