A method for quickly constructing a single-plasmid T7 expression system
By predicting and adjusting the lethal upper limit of T7 RNAP in the single-plasmid T7 expression system, the problems of complexity and long construction time in the application of T7 expression system in non-model hosts are solved, realizing rapid and customized construction of single-plasmid T7 expression system, reducing host mortality risk and improving construction success rate.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- TSINGHUA UNIVERSITY
- Filing Date
- 2023-06-09
- Publication Date
- 2026-06-23
AI Technical Summary
In existing technologies, the application of T7 expression systems in non-model hosts is complex. The construction of single-plasmid T7 expression systems is time-consuming and has a low success rate. Furthermore, host bacteria are prone to death due to overexpression of T7 RNAP.
This paper presents a method for rapidly constructing a single-plasmid T7 expression system based on the modular concept of synthetic biology. By predicting the lethal upper limit of T7 RNAP in the host, the DNA structure of the T7 RNAP expression unit is adjusted, including changing the promoter, RBS, codon, terminator, plasmid copy number, etc., and inserting antisense RNA and transcription interference structures to achieve host-specific and customized construction.
This method enables the rapid construction of single-plasmid T7 expression systems in different hosts, reduces T7 RNAP expression levels and activity, improves construction success rate, simplifies the operation process, and provides a convenient method for applying T7 expression systems to non-model strains.
Smart Images

Figure BDA0004278596050000201 
Figure BDA0004278596050000211 
Figure BDA0004278596050000212
Abstract
Description
Technical Field
[0001] This application belongs to the field of genetic engineering and analytical detection, and relates to a method for constructing a single-plasmid T7 expression system. Specifically, it relates to a method for constructing a T7 RNAP expression unit, and a method for adjusting the DNA structure of the designed T7 RNAP expression unit to successfully construct the T7 RNAP expression unit. That is, this application provides: 1. A method for predicting the upper limit of T7 RNAP content (activity) that can be successfully constructed in *E. coli*; 2. A method for predicting the upper limit of T7 RNAP content (activity) that can be successfully constructed in a host bacterium (hereinafter referred to as the method for predicting the upper limit of T7 RNAP lethality); 3. A method for rapidly and customarily constructing a single-plasmid T7 expression system based on the upper limit of T7 RNAP activity in each host by detecting T7 RNAP activity. Background Technology
[0002] The T7 expression system is a highly efficient expression system based on bacteriophage T7 RNA polymerase (T7 RNAP) that enables high-level protein expression. It mainly consists of two elements: the T7 promoter and T7 RNAP. The most significant feature of this system is the extremely high activity of T7 RNAP and its high specificity for the T7 promoter, thereby guiding high-level transcription of downstream genes. Furthermore, this system is simple to genetically manipulate, allows for precise gene regulation, and is easy to operate, thus it is widely used in synthetic biology, metabolic engineering, biomedicine, enzyme engineering, RNA synthesis, and mRNA vaccines.
[0003] For a long time, researchers have hoped to place the T7 RNAP gene element (referred to as "T7 RNAP expression unit" in this patent) on the same plasmid as the T7 promoter and its downstream transcribed gene (referred to as "T7 promoter transcription unit" in this patent). This would not only allow the construction of an orthogonal transcription system that is universal to different hosts, but also eliminate the need to integrate the T7 RNAP gene into the host genome. Studies have shown that due to the high transcriptional activity of T7 RNAP, placing the T7 RNAP gene and the T7 promoter on the same plasmid often leads to the death of the host bacteria, and many attempts have failed because they cannot construct the correct plasmid (Davanloo, P., et al., cloning and expression of the gene for bacteriophage-t7 RNA-polymerase. Proceedings of the National Academy of Sciences of the United States of America-Biological Sciences, 1984. 81(7): p. 2035-2039; Ting, W.-W., S.-I. Tan, and ISNg, Development of chromosome-based T7 RNA polymerase and orthogonal T7 promoter circuit in Escherichia coli W3110 as a cellfactory. Bioresources and Bioprocessing, 2020. 7(1).). This is because compared with integration into the genome, the number of T7 RNAP gene copies located on the plasmid is greatly increased, and the expression level of T7 RNAP protein is also doubled, resulting in a large number of T7 RNA polymerases being generated. After RNAP recognizes the T7 promoter, it highly transcribes the target gene, over-consuming the host's resources for synthesizing mRNA and protein, leading to host death (Davanloo, 1984; Chen, ZHand TDSchneider, Comparative analysis of tandemT7-like promoter containing regions in enterobacterial genomes reveals a novel group of genetic islands. Nucleic Acids Research, 2006, 34(4): p. 1133-1147).
[0004] In order to construct a host-independent single plasmid T7 expression system and facilitate the application of the T7 expression system in different hosts, this patent develops a method for rapidly constructing a single plasmid T7 expression system based on the modular concept of synthetic biology. According to the different characteristics of various hosts, a single plasmid T7 expression system is rapidly constructed to realize the application of the T7 expression system in the host, greatly simplifying the operation process of constructing the single plasmid T7 expression system. Summary of the Invention
[0005] Based on this, in view of the problems that the application process of the T7 expression system in non-model hosts is relatively complex in the prior art, and the construction process of the single plasmid T7 expression system takes a long time and has a low success rate, this application provides a method for rapidly constructing a single plasmid T7 expression system in a host considering the characteristics of different hosts and targeting the personalized characteristics of the host. The method provided by this application can more rapidly construct a single plasmid T7 expression system in Gram-negative bacteria and Gram-positive bacteria to express foreign proteins. In addition, this application also provides a method for predicting the lethal upper limit value of T7 RNAP in a host. The lethal upper limit value prediction method provided by this application can effectively predict the upper limit value of the activity of T7 RNAP in each host cell that can enable the successful construction and survival of the T7 expression system, thereby guiding the rapid construction of the single plasmid T7 expression system therein.
[0006] Specifically, this application relates to the following content:
[0007] 1. A method for constructing a T7 RNAP expression unit, which includes the following steps:
[0008] a. Design a T7 RNAP expression unit;
[0009] b. Insert the designed T7 RNAP expression unit into a test plasmid;
[0010] c. Express T7 RNAP in the host cell with the test plasmid;
[0011] d. Measure the activity E of the T7 RNAP expressed by the test plasmid;
[0012] e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell;
[0013] f1. If E < E0, then the T7 RNAP expression unit is successfully constructed;
[0014] f2. If E ≥ E0, then adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed;
[0015] g. Select plasmids with T7 RNAP activity lower than the E0 value.
[0016] 2. The method according to item 1, wherein the T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7 RNAP encoding gene, and a terminator sequence.
[0017] 3. The method according to item 1, wherein, in step f2, the method for adjusting the DNA structure of the designed T7 RNAP expression unit is selected from any one or more of the following to reduce the expression level and activity of T7 RNAP:
[0018] Change the startup program.
[0019] Mutant promoter,
[0020] Design an RBS structure.
[0021] Change the distance from the start codon of the RBS to the T7 RNAP encoding gene.
[0022] Change the codons in the T7 RNAP encoding gene to rare codons.
[0023] Modify the terminator of the T7 RNAP encoding gene.
[0024] Change the plasmid copy number,
[0025] Design antisense RNAs to inhibit T7 RNAP expression.
[0026] Inserting a sequence downstream of the promoter of the T7 RNAP expression unit that weakens the transcriptional intensity of T7 RNAP
[0027] A transcriptional interference structure that interferes with the transcription of the T7 RNAP gene is inserted downstream of the T7 RNAP expression unit, or
[0028] Mutant T7 RNAP encoding gene.
[0029] 4. The method according to item 1, wherein the test plasmid is selected from: pUC type high copy plasmid, pET type medium copy plasmid, pBBRMCS type wide host plasmid, pBL type low copy plasmid, pYE plasmid, pYC plasmid, pRS plasmid or PGEX plasmid.
[0030] 5. The method according to item 1, wherein the host cell is selected from: Gram-negative bacteria or Gram-positive bacteria; preferably, Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pseudomonas, Bacillus licheniformis, Rhizobium sinense, Tatumella, or strictly halophilic bacteria.
[0031] 6. The method according to item 1, wherein the method for determining T7 RNAP activity is the TX-TL assay.
[0032] 7. The method according to claim 1, wherein the threshold E0 for T7 RNAP activity in the host cell is 2.1–5.1 U·OD in Gram-negative bacteria. 600 -1 ·μL -1 In Gram-positive bacteria, the concentration is 1.3–3.7 U·OD. 600 -1 ·μL -1 .
[0033] 8. According to the method described in item 3, changing the promoter means changing the original promoter to one of the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter.
[0034] 9. The method according to item 3, wherein a mutant promoter refers to the insertion, deletion or substitution of nucleotides in the original promoter sequence.
[0035] 10. According to the method described in item 3, designing the RBS structure means: predicting the RBS translation efficiency using RBS calculator software.
[0036] 11. The method according to item 3, wherein changing the distance between the RBS and the start codon of the T7 RNAP coding gene means adjusting the distance between the RBS and the start codon of the T7 RNAP coding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp.
[0037] 12. The method according to item 3, wherein changing the codons in the T7 RNAP encoding gene to rare codons means: changing the codons in the T7 RNAP encoding gene to rare codons whose usage frequency is in the range of 0% to 10%, preferably in the range of 0% to 2%.
[0038] 13. The method according to item 3, wherein changing the terminator of the T7 RNAP encoding gene means: changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency in the range of 40-99%.
[0039] 14. The method according to item 3, wherein changing the plasmid copy number means: reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, preferably reducing it to any integer between 700 and 1.
[0040] 15. According to the method described in item 3, designing antisense RNA to inhibit T7 RNAP expression means inserting a module expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid.
[0041] 16. The method according to item 3, wherein inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can reduce the transcriptional intensity of T7 RNAP means inserting the following DNA sequences that can bind to the repressor downstream of the promoter: lacO, TetO, terminator sequence, hairpin structure sequence or a Poly T sequence of 4 or more T.
[0042] 17. According to the method described in item 3, the insertion of a transcription interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene means: inserting a reverse promoter downstream of the T7 RNAP expression unit.
[0043] 18. According to the method described in item 3, the mutation of the T7 RNAP encoding gene refers to the insertion, deletion or substitution of nucleotides in the original T7 RNAP encoding gene.
[0044] 19. A method for adjusting the DNA structure of the T7 RNAP expression unit, comprising one or more of the following:
[0045] Change the startup program.
[0046] Mutant promoter,
[0047] Design an RBS structure.
[0048] Change the distance from the start codon of the RBS to the T7 RNAP encoding gene.
[0049] Change the codons in the T7 RNAP encoding gene to rare codons.
[0050] Modify the terminator of the T7 RNAP encoding gene.
[0051] Change the plasmid copy number,
[0052] Design antisense RNAs to inhibit T7 RNAP expression.
[0053] Inserting a sequence downstream of the promoter of the T7 RNAP expression unit that weakens the transcriptional intensity of T7 RNAP
[0054] A transcriptional interference structure that interferes with the transcription of the T7 RNAP gene is inserted downstream of the T7 RNAP expression unit, or
[0055] Mutant T7 RNAP encoding gene.
[0056] 20. The method according to item 19, wherein changing the promoter means changing the original promoter to one of the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter.
[0057] 21. The method according to item 19, wherein a mutant promoter refers to the insertion, deletion or substitution of nucleotides in an existing promoter sequence.
[0058] 22. According to the method described in item 19, designing the RBS structure means: predicting the RBS translation efficiency using RBS calculator software.
[0059] 23. The method according to item 19, wherein changing the distance between the RBS and the start codon of the T7 RNAP coding gene means adjusting the distance between the RBS and the start codon of the T7 RNAP coding gene within the following range: 0 to 60 bp, preferably 7 to 40 bp.
[0060] 24. The method according to item 19, wherein changing the codons in the T7 RNAP encoding gene to rare codons means: changing the codons in the T7 RNAP encoding gene to rare codons whose usage frequency is in the range of 0% to 10%, preferably in the range of 0% to 2%.
[0061] 25. The method according to item 19, wherein changing the terminator of the T7 RNAP encoding gene means: changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency in the range of 40-99%.
[0062] 26. The method according to item 19, wherein changing the plasmid copy number means: reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, preferably reducing it to any integer between 700 and 1.
[0063] 27. The method according to item 19, wherein designing antisense RNA to suppress T7 RNAP expression means: inserting a module expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid.
[0064] 28. The method according to item 19, wherein inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can reduce the transcriptional intensity of T7 RNAP means inserting a DNA sequence that can bind to the repressor downstream of the promoter: lacO, TetO, terminator sequence, hairpin structure sequence or a Poly T sequence of 4 or more T.
[0065] 29. The method according to item 19, wherein inserting a transcriptional interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene means inserting a reverse promoter downstream of the T7 RNAP expression unit.
[0066] 30. The method according to item 19, wherein mutating the T7 RNAP encoding gene means inserting, deleting or replacing nucleotides in the original T7 RNAP encoding gene.
[0067] Beneficial effects
[0068] By establishing a method to predict the upper limit of T7 RNAP activity, the upper limit of T7 RNAP activity that can be tolerated during the construction of single-plasmid T7 expression systems for each host was detected, providing guidance and basis for the next step of accurately constructing single-plasmid T7 expression systems. This method has a large adjustable range and can effectively detect the upper limit of T7 RNAP activity for different hosts.
[0069] This application provides a method for rapidly and customarily constructing a single-plasmid T7 expression system. This method is characterized by predictability, speed, and customization, thereby solving the problems of previous single-plasmid T7 expression systems being unable to be constructed, having a long construction cycle, and being prone to mutation. It provides a convenient method for non-model strains to utilize the T7 expression system. Attached Figure Description
[0070] Figure 1 This is a schematic diagram of the process for predicting the lethal upper limit of T7 RNAP activity in this application.
[0071] Figure 2 The results of detecting the upper limit of T7 RNAP activity in the single plasmid T7 expression system constructed for the Escherichia coli DH5α host of this application.
[0072] Figure 3 This is a schematic diagram of the construction process of the single plasmid T7 expression system of this application.
[0073] Figure 4 This is a logic diagram of the rapid construction of a single plasmid T7 expression system according to this application.
[0074] Figure 5 To regulate the ATG distance from the RBS to the T7 RNAP gene, an E. coli DH5α single plasmid T7 expression system was constructed.
[0075] Figure 6 To construct an Escherichia coli DH5α single plasmid T7 expression system using promoters of different strengths.
[0076] Figure 7To construct a single plasmid T7 expression system of Escherichia coli DH5α using a mutant promoter.
[0077] Figure 8 To construct a single plasmid T7 expression system of Escherichia coli DH5α by inserting a terminator sequence.
[0078] Figure 9 To construct a single plasmid T7 expression system of Escherichia coli DH5α using codon preference.
[0079] Figure 10 To construct a single plasmid T7 expression system of Escherichia coli DH5α by mutating the T7 RNAP gene.
[0080] Figure 11 To construct a single plasmid T7 expression system of E. Coli DH5α by using transcriptional interference (inserting different strength reverse promoters).
[0081] Figure 12 To construct a single plasmid T7 expression system of B. subtilis 168 by promoter mutation and RBS distance.
[0082] Figure 13 To construct a single plasmid T7 expression system of B. subtilis 168 by promoter modification and inserting a terminator sequence downstream.
[0083] Figure 14 For the fluorescence protein expression of single plasmid T7 expression systems in different host bacteria. Specific implementation manners
[0084] On the one hand, the present application provides a method for constructing a T7 RNAP expression unit, which includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f1. If E < E0, then the T7 RNAP expression unit is successfully constructed; f2. If E ≥ E0, then adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with the T7 RNAP activity lower than the E0 value.
[0085] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value.
[0086] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the promoter to reduce the expression level and expression activity of T7 RNAP. Changing the promoter means changing the original promoter to the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter or J23112 promoter. The promoter may be a promoter for expressing proteins in an organism, but is not limited to the above promoters.
[0087] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Determine the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: mutating the promoter. The aim is to reduce the transcriptional strength of the promoter, thereby reducing the expression level and activity of T7 RNAP. Mutating the promoter means: inserting, deleting or substituting nucleotides in the original promoter sequence. Preferably, the lacUV5 promoter is mutated into the promoter shown in the following sequences: SEQ ID NO.1: TTTACACTTTATGCTTCCGGCTCGTAAAGTG, SEQ ID NO.2: TTTACACTTTATGCTTCCGGCTCGTAGTGTG or SEQ ID NO.3: TTTACACTTTATGCTTCCGGCTCGTAACGTG.
[0088] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit can be: designing an RBS structure to reduce the expression level and expression activity of T7 RNAP. Designing an RBS structure means: predicting the RBS translation efficiency through the RBS calculator software (Salis, H.M., Mirsky, E.A., & Voigt, C.A. (2009). Automated design of synthetic ribosome binding sites to control protein expression. Nature Biotechnology, 27(10), 946–950.). The software can use various software capable of predicting the RBS translation efficiency, but is not limited to this software.
[0089] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design the T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit can be: changing the distance from the RBS to the start codon of the T7RNAP coding gene. The purpose is to reduce the translation efficiency of the RBS, thereby reducing the expression level and expression activity of T7 RNAP. Changing the distance from the RBS to the start codon of the T7 RNAP coding gene means: adjusting the distance from the RBS to the start codon of the T7 RNAP coding gene within the following range: 0 - 60 bp, preferably 7 - 40 bp. For example, adjust the distance from the RBS to the start codon of the T7 RNAP coding gene to: distances of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 bp.
[0090] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the codons in the T7 RNAP coding gene to rare codons. The aim is to reduce the expression level and expression activity of T7 RNAP. Changing the codons in the T7 RNAP coding gene to rare codons means: changing the codons in the T7 RNAP coding gene to rare codons with a usage frequency in the range of 0% - 10%, preferably in the range of 0% - 2%. For example, the usage frequency of the rare codon may be 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%.
[0091] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in a host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: changing the terminator of the T7 RNAP coding gene. The aim is to reduce the expression level and expression activity of T7 RNAP. Changing the terminator of the T7 RNAP coding gene means: changing the terminator of the T7 RNAP coding gene to a terminator with a termination efficiency range of 40 - 99% for RNA polymerase. For example, changing it to a terminator with a termination efficiency range of 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% for RNA polymerase.
[0092] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit can be: changing the plasmid copy number. The purpose is to reduce the expression level and expression activity of T7 RNAP. Changing the plasmid copy number means: reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, preferably reducing to any integer between 700 and 1. For example, a pUC plasmid with a copy number of 500-700 will be changed to a pET or pBBRMCS plasmid with a copy number of 40-50, or a pBL plasmid with a copy number of 1-3.
[0093] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E ≥ E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit can be: designing an antisense RNA that inhibits the expression of T7 RNAP. The purpose is to reduce the expression level and expression activity of T7 RNAP. Designing an antisense RNA that inhibits the expression of T7 RNAP means: inserting a module that expresses the antisense gene of T7 RNAP into the T7 RNAP expression plasmid. The module that expresses the antisense gene of T7 RNAP can be composed of a promoter sequence, an antisense RNA sequence of the T7 RNAP gene, and a terminator sequence. The promoter sequence and the terminator sequence are any promoter that can express a protein in an organism or a terminator that terminates the expression of a protein. The antisense RNA sequence includes an RNA sequence that is antisense to the DNA sequence within 20 bases before and after the promoter sequence, or an antisense RNA sequence that is antisense to the T7 RNAP gene and the DNA sequence within 20 bases upstream of the N - terminal sequence. The module that expresses the antisense gene of T7 RNAP can be inserted at any position in the T7 RNAP expression plasmid.
[0094] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit comprises the following steps: a. Design a T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Determine the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: inserting a sequence that can cause a decrease in the transcriptional intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit. The purpose is to reduce the expression level and expression activity of T7 RNAP. Inserting a sequence that can cause a decrease in the transcriptional intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit means: inserting the following DNA sequences that can bind to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin structure sequence, or a Poly T sequence with 4 or more T's. For example, inserting a Poly T sequence with any one of 4, 5, 6, 7, 8, 9, 10 or more T's that can bind to a repressor downstream of the promoter.
[0095] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design the T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: introducing a transcriptional interference structure downstream of the T7 RNAP expression unit that interferes with the transcription process of the T7 RNAP gene. The purpose is to reduce the expression level and expression activity of T7 RNAP. Inserting a transcriptional interference structure downstream of the T7 RNAP expression unit that interferes with the transcription process of the T7 RNAP gene means: inserting a reverse promoter downstream of the T7 RNAP expression unit, that is, introducing a (reverse) promoter opposite to the promoter for expressing T7 RNAP to interfere with the expression level and expression activity of T7 RNAP.
[0096] In a specific embodiment of the present application, the method for constructing a T7 RNAP expression unit includes the following steps: a. Design the T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold E0 of the T7 RNAP activity in the host cell; f2. If E≥E0, adjust the DNA structure of the designed T7 RNAP expression unit and repeat steps b-e until it is determined that E<E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with a T7 RNAP activity lower than the E0 value. The method for adjusting the DNA structure of the designed T7 RNAP expression unit may be: mutating the T7 RNAP coding gene. The purpose is to reduce the expression level and expression activity of T7 RNAP. Mutating the T7 RNAP coding gene means: performing nucleotide insertion, deletion, or substitution on the original T7 RNAP coding gene.
[0097] In a specific embodiment of the present application, in the method for constructing a T7 RNAP expression unit, the method for adjusting the DNA structure of the designed T7 RNAP expression unit may be any one or more than two of the above specific embodiments.
[0098] In the above specific embodiments, T7 RNA polymerase (T7 RNAP) is a DNA-dependent 5'→3' RNA polymerase that specifically recognizes the T7 promoter sequence. The T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7 RNAP encoding gene, and a terminator sequence. A plasmid is a small, autonomously replicating DNA molecule attached to non-cellular chromosomal or nuclear DNA regions of a cell. Most plasmids, although circular, exist in many bacteria and yeasts. The test plasmid is selected from: pUC-type high-copy plasmids, pET-type medium-copy plasmids, pBBRMCS-type broad-host plasmids, pBL-type low-copy plasmids, pYE plasmids, pYC plasmids, pRS plasmids, or PGEX plasmids. The test plasmid can also be any plasmid known in the art suitable for use as a test plasmid. It can also be a plasmid used for transformation into Gram-negative or Gram-positive bacteria, but is not limited to the above plasmids. The host cells are selected from Gram-negative or Gram-positive bacteria; preferably, *Escherichia coli*, *Corynebacterium glutamicum*, *Bacillus subtilis*, *Pseudomonas*, *Bacillus licheniformis*, *Rhizobium sinense*, *Tatum*, or strictly halophilic bacteria. Gram-negative bacteria include, but are not limited to, *Campylobacter*, *Escherichia coli*, *Flavobacterium*, *Fusobacterium*, *Helicobacter*, *Selenobacter*, *Neisseria*, *Pseudomonas*, *Salmonella*, and *Ureaplasma*. Gram-positive bacteria include, but are not limited to, *Bacillus*, *Clostridium*, *Enterococcus*, *Bacillus aeruginosa*, *Lactobacillus*, *Lactococcus*, *Bacillus cereus*, *Staphylococcus*, *Streptococcus*, and *Streptomyces*. The method for determining T7 RNAP activity is the TX-TL assay. The threshold E0 for T7 RNAP activity in the host cells is 2.1–5.1 U·OD in Gram-negative bacteria. 600 -1 ·μL -1 In Gram-positive bacteria, the concentration is 1.3–3.7 U·OD. 600 -1 ·μL -1A promoter is a DNA sequence located upstream of the 5' end of a structural gene. It activates RNA polymerase, enabling it to bind accurately to the template DNA and possessing the specificity for transcription initiation. The ribosome-binding site (RBS) is the 5' (upstream) region of the mRNA molecule. It binds to ribosomes and precisely locates them to the translation initiation site, controlling the accuracy and efficiency of mRNA translation initiation. In prokaryotic mRNA, the RBS is located 8-13 nucleotides upstream of the start codon (the first AUG). Transcribed mRNA is recruited and bound to ribosomes via the 5' RBS sequence, further enabling gene translation. Therefore, the strength of the RBS directly affects the ribosome binding efficiency and, to a certain extent, determines the translation efficiency. A terminator is a DNA sequence that provides a transcription termination signal to RNA polymerase. One type terminates transcription without relying on protein cofactors, while the other relies on protein cofactors. A coding gene refers to the coding region of a structural gene. A coding gene is the portion that transcribes messenger RNA, which synthesizes the corresponding protein. Gene mutation refers to changes in certain bases or sequences of the genomic DNA molecule. Substitution refers to the replacement of one base in a DNA molecule with another different base. Base substitution leads to changes in codons in mRNA, affecting amino acids in the polypeptide chain, and may produce several different effects. Insertion or deletion refers to the insertion (addition) or deletion of one or more bases in the DNA coding sequence, altering the downstream reading frame and causing abnormalities or inactivity in the protein, or causing the polypeptide chain to add or remove one or more amino acids, but the amino acids after the insertion or deletion point remain unchanged. Rare codons are those where, due to codon degeneracy, each amino acid corresponds to at least one codon, and at most one amino acid can correspond to six codons. However, the frequency of use of these different codons encoding the same amino acid is not completely evenly distributed in different species and organisms; that is, most organisms tend to use only a portion of these codons, a phenomenon also known as codon bias. The most frequently used codons are called optimal codons, while those not frequently used are called rare codons or low-usage codons.
[0099] On the one hand, this application provides a method for adjusting the DNA structure of the T7 RNAP expression unit, which includes: changing the promoter, mutating the promoter, designing an RBS structure, changing the distance from the RBS to the start codon of the T7 RNAP coding gene, adjusting the frequency of rare codon usage in the T7 RNAP coding gene, adjusting the structure and / or position of the terminator of the T7 RNAP coding gene, changing the plasmid copy number, designing an antisense RNA that inhibits T7 RNAP expression, inserting a repressor sequence that can weaken the transcriptional intensity of T7 RNAP downstream of the promoter of the T7 RNAP expression unit, introducing a transcription interference structure that interferes with the transcription process of the T7 RNAP gene downstream of the T7 RNAP expression unit, or mutating the T7 RNAP coding gene.
[0100] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: changing the promoter to reduce the expression level and activity of T7 RNAP. Changing the promoter means replacing the original promoter with one of the following promoters: lacUV5 promoter, lac promoter, tac promoter, Trc promoter, Trp promoter, Pc promoter, or J23112 promoter. The promoter may be a promoter that expresses a protein in a biological organism, but is not limited to the promoters mentioned above.
[0101] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: mutating the promoter. The purpose is to reduce the promoter transcription strength, thereby reducing the expression level and activity of T7 RNAP. A mutated promoter refers to the insertion, deletion, or substitution of nucleotides in the original promoter sequence. Preferably, the lacUV5 promoter is mutated to the promoter shown in the following sequence: SEQ ID NO.1: TTTACACTTTATGCTTCCGGCTCGTAAAGTG, SEQ ID NO.2: TTTACACTTTATGCTTCCGGCTCGTAGTGTG, or SEQ ID NO.3: TTTACACTTTATGCTTCCGGCTCGTAACGTG.
[0102] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: designing an RBS structure to reduce the expression level and activity of T7 RNAP. Designing an RBS structure refers to predicting RBS translation efficiency using RBS calculator software. The software may include various software capable of predicting RBS translation efficiency, but is not limited to this specific software.
[0103] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: changing the distance from the RBS to the start codon of the T7 RNAP coding gene. The purpose is to reduce the translation efficiency of RBS, thereby reducing the expression level and activity of T7 RNAP. Changing the distance from the RBS to the start codon of the T7 RNAP coding gene means adjusting the distance from the RBS to the start codon of the T7 RNAP coding gene within the following range: 0–60 bp, preferably 7–40 bp. For example, the distance from the RBS to the start codon of the T7 RNAP coding gene may be adjusted to distances of 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 15, 20, 25, 30, 35, 40, 45, 50, 55, and 60 bp.
[0104] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: replacing the codons in the T7 RNAP encoding gene with rare codons. The purpose is to reduce the expression level and activity of T7 RNAP. Changing the codons in the T7 RNAP encoding gene to rare codons means changing the codons in the T7 RNAP encoding gene to rare codons with a usage frequency in the range of 0% to 10%, preferably in the range of 0% to 2%. For example, the usage frequency of rare codons may be 0%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, or 10%.
[0105] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: changing the terminator of the T7 RNAP encoding gene. The purpose is to reduce the expression level and activity of T7 RNAP. Changing the terminator of the T7 RNAP encoding gene means changing the terminator of the T7 RNAP encoding gene to a terminator with an RNA polymerase termination efficiency in the range of 40-99%. For example, changing it to a terminator with an RNA polymerase termination efficiency in the range of 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0106] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: changing the plasmid copy number. The purpose is to reduce the expression level and activity of T7 RNAP. Changing the plasmid copy number means reducing the plasmid copy number, for example, reducing the copy number by 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, preferably to any integer between 700 and 1. For example, a pUC-type plasmid with a copy number of 500 to 700 may be changed to a pET or pBBRMCS-type plasmid with a copy number of 40 to 50, or a pBL-type plasmid with a copy number of 1 to 3.
[0107] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit can be: designing antisense RNA that inhibits T7 RNAP expression. The aim is to reduce the expression level and activity of T7 RNAP. Designing antisense RNA that inhibits T7 RNAP expression means inserting a module expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid. The module expressing the T7 RNAP antisense gene can consist of a promoter sequence, an antisense RNA sequence of the T7 RNAP gene, and a terminator sequence. The promoter sequence and terminator sequence can be any promoter that can express a protein in an organism or a terminator that terminates protein expression. The antisense RNA sequence includes an RNA sequence that is antisense to the promoter sequence and the DNA sequence within 20 bases before and after it, or an antisense RNA sequence within 20 bases upstream of the T7 RNAP gene and its N-terminal sequence. The module expressing the T7 RNAP antisense gene can be inserted at any position in the T7 RNAP expression plasmid.
[0108] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be as follows: inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can weaken the transcriptional intensity of T7 RNAP. The purpose is to reduce the expression level and activity of T7 RNAP. Inserting a sequence downstream of the promoter of the T7 RNAP expression unit that can weaken the transcriptional intensity of T7 RNAP refers to inserting a DNA sequence capable of binding to a repressor downstream of the promoter: lacO, TetO, a terminator sequence, a hairpin sequence, or a Poly T sequence with 4 or more T atoms. For example, inserting a Poly T sequence with any of 4, 5, 6, 7, 8, 9, 10, or more T atoms downstream of the promoter that can bind to a repressor.
[0109] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be as follows: inserting a transcriptional interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene. The purpose is to reduce the expression level and activity of T7 RNAP. Inserting a transcriptional interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene means inserting a reverse promoter downstream of the T7 RNAP expression unit, that is, introducing a (reverse) promoter that is opposite to the T7 RNAP expression promoter to interfere with the expression level and activity of T7 RNAP.
[0110] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be: mutating the T7 RNAP encoding gene. The purpose is to reduce the expression level and activity of T7 RNAP. Mutating the T7 RNAP encoding gene refers to inserting, deleting, or replacing nucleotides in the original T7 RNAP encoding gene.
[0111] In one specific embodiment of this application, the method for adjusting the DNA structure of the T7 RNAP expression unit may be any one or more of the methods described in any of the above specific embodiments.
[0112] In the above specific embodiments, T7 RNA polymerase (T7 RNAP) is a DNA-dependent 5'→3' RNA polymerase that specifically recognizes the T7 promoter sequence. The T7 RNAP expression unit comprises: a promoter sequence, an RBS sequence, a T7 RNAP encoding gene, and a terminator sequence. A plasmid is a small, autonomously replicating DNA molecule attached to a cell's non-cellular chromosomal or nuclear DNA region. Most plasmids, although circular, exist in many bacteria and yeasts. A promoter is a DNA sequence located upstream of the 5' end of a structural gene that activates RNA polymerase, enabling it to accurately bind to the template DNA and possessing transcription initiation specificity. The ribosome-binding site (RBS) is the 5' (upstream) region of the mRNA molecule, capable of binding ribosomes and correctly locating to the translation initiation site, and also controlling the accuracy and efficiency of mRNA translation initiation. In prokaryotic mRNA, the RBS is located 8-13 nucleotides upstream of the start codon (i.e., the first AUG). The transcribed mRNA is recruited and bound to ribosomes via the 5' RBS sequence, further enabling gene translation. Therefore, the strength of the RBS directly affects ribosome binding efficiency and, to some extent, determines translation efficiency. Terminators are DNA sequences that provide a termination signal to RNA polymerase. One type terminates transcription without the need for protein cofactors, while the other relies on them. A coding gene is the coding region of a structural gene. A coding gene is the portion that transcribes messenger RNA, which then synthesizes the corresponding protein. Gene mutation refers to changes in certain bases or sequences of the genomic DNA molecule. Substitution refers to the replacement of one base in a DNA molecule with a different base. Base substitution leads to changes in the codons in mRNA, affecting the amino acids in the polypeptide chain, and may produce several different effects. Insertion or deletion refers to the insertion (addition) or deletion of one or more bases in the coding sequence of DNA. This alters the downstream reading frame, leading to abnormal amino acid sequence and protein inactivity, or it may result in the addition or deletion of one or more amino acids in the polypeptide chain, while the amino acids after the insertion or deletion remain unchanged. Rare codons are those that, due to codon degeneracy, each amino acid corresponds to at least one codon, and at most one amino acid can correspond to six codons. However, the frequency of use of these different codons encoding the same amino acid is not completely evenly distributed across different species and organisms. That is, most organisms tend to use only a subset of these codons; this phenomenon is also known as codon bias. The most frequently used codons are called optimal codons, while those that are not frequently used are called rare codons or low-usage codons.
[0113] Unless otherwise defined, the technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described below. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not restrictive.
[0114] While various aspects and embodiments of this application have been disclosed herein, other aspects and embodiments will be apparent to those skilled in the art. Other methods for altering T7 RNAP expression levels and activity, as well as other methods for reducing T7 RNAP expression levels and activity by altering the DNA structure of the T7 RNAP expression unit, are also covered within the scope of this application. The various aspects and embodiments disclosed herein are for illustrative purposes only and are not intended to be limiting. The scope and spirit of this application are determined solely by the appended claims.
[0115] The present application will be further explained below with reference to the accompanying drawings and specific examples.
[0116] Example
[0117] T7 RNAP activity is crucial for the successful construction of a single-plasmid T7 expression system. If high-activity T7 RNAP is present in the host cell, the constructed single-plasmid T7 expression system will easily deplete host resources, preventing host cell growth. Therefore, if the T7 RNAP activity in the host is very high, the single-plasmid T7 expression system cannot be successfully constructed. To improve the system construction efficiency and solve the problems of complex, long, and unpredictable construction processes in the past, it is necessary to predict the amount of T7 RNAP (activity) that each host bacterium can tolerate during the construction of a single-plasmid T7 expression system. Therefore, this patent establishes a method for predicting the T7 RNAP activity threshold (lethal upper limit). Figure 1 Taking Escherichia coli DH5α as an example, design the experimental procedure ( Figure 1 (1) Design a test procedure for the upper limit of lethality of T7 RNAP in a single plasmid T7 expression system. Figure 1), in which the mCherry (red fluorescent protein) gene is used as the reporter gene in the T7 promoter transcription unit, and the lacI-lacO system is introduced upstream of the T7 RNAP gene to regulate the expression level of T7 RNAP on a larger scale so that it can be applied to other host bacteria. (2) By designing a promoter library, the mixed promoter fragments are inserted upstream of the lacO gene of the test plasmid through DNA ligase to start the transcription of the downstream T7 RNAP gene. The resulting ligation sample is transformed into E. coli DH5α host cells. If the T7 RNAP is higher than the upper limit, the correct single plasmid T7 expression system cannot be constructed. Therefore, strains with red fluorescent protein expression are selected, and after shaking culture, sequencing is performed to detect the red fluorescence intensity of mCherry in the host bacteria ( Figure 2 Simultaneously, the T7 RNAP activity expressed by strains containing plasmids lacking the "T7 promoter transcription unit" was detected, and the highest T7 RNAP activity (4.67 U·OD) detected in the selected strains was taken. 600 -1 ·μL -1 The upper limit of lethal T7 RNAP in E. coli DH5α cells is ( ) Figure 2 Further plasmids were extracted to obtain a single-plasmid T7 expression system test plasmid library, which was used to predict the upper limit of T7 RNAP activity in other host bacteria. For different host systems, appropriate host plasmids were used, and the lethal upper limit of T7 RNAP activity in the host was determined according to the above steps.
[0118] Compared to previous methods for constructing single-plasmid T7 expression systems, this patent's single-plasmid T7 expression system features quantification of T7 RNAP activity, customizable design and construction for various hosts, rapid construction speed, and strong system stability. In contrast, the single-plasmid T7 expression system constructed in patent CN 201810175644 primarily uses antisense RNA as a regulatory mechanism to control T7 RNAP levels. This method of regulating T7 RNAP expression is singular, lacking a corresponding T7 RNAP activity range; it only qualitatively and speculatively suggests that T7 RNAP activity should be controlled within a suitable value, without specifying what that suitable value is. The novel approach of this application is to design and construct DNA structures (e.g., distance from RBS to ATG, promoter alteration or mutation, terminator structure or position, RBS structure, introduction of rare codons, alteration of plasmid copy number, introduction of antisense RNA units, introduction of transcriptional interference structures, mutation of the T7 RNAP gene, etc.) that affect T7 RNAP expression activity in the "T7 RNAP expression unit" on the plasmid, and to quantitatively determine the T7 RNAP activity. If the T7 RNAP activity E is in the range of 0 to E0 (E0 values for different host bacteria are shown in Table 1), the "T7 promoter transcription unit" can be directly introduced into the plasmid, thus directly constructing a single-plasmid T7 expression system in the corresponding host. If T7 RNAP activity is not within the 0–E0 range, then the DNA structure in the “T7 RNAP expression unit” (e.g., distance from RBS to ATG, promoter alteration or mutation, terminator structure or position, RBS structure, introduction of rare codons, alteration of plasmid copy number, introduction of antisense RNA units, introduction of transcriptional interference structures, mutation of the T7 RNAP gene, etc.) is targeted for adjustment. Figure 4 (Table 2) The plasmid was rapidly constructed so that the T7 RNAP expression activity in the host fell within the 0-E0 range. Then, the "T7 promoter unit" was introduced to directly construct a single-plasmid T7 expression system. The above construction process is as follows: Figure 3 As shown, the single-plasmid T7 expression system plasmid consists of two parts: a "T7 RNAP expression unit" and a "T7 promoter transcription unit." The "T7 RNAP expression unit" contains the promoter sequence, RBS sequence, T7 RNAP gene sequence, and terminator sequence. The "T7 promoter transcription unit" contains the T7 promoter sequence, RBS sequence, target gene sequence, and terminator sequence.
[0119] Table 1 E0 values of strains from different host species
[0120]
[0121]
[0122] Note: The activity of T7 RNAP is defined as: under conditions of 37°C and pH = 8.0, the activity per unit volume of OD0.0. 600 The bacterial solution can produce 1 nmol of [ ] within 1 hour. 3 The amount of enzyme required for H]GMP to be incorporated into oligonucleotide fragments is defined as one activity concentration (U·OD). 600 -1 ·μL -1 ). [Reference for activity definition: Reisbig, RR, Woody, AY, & Woody, RW (1979). Spectroscopic analysis of the interaction of Escherichia coli DNA-dependentRNA polymerase with T7 DNA and synthetic polynucleotides. Journal of Biological Chemistry, 254(22),11208–11217. https: / / doi.org / 10.1016 / S0021-9258(19)86471-2].
[0123] Table 2. Methods for adjusting the DNA structure of the test plasmid "T7 RNAP expression unit"
[0124]
[0125]
[0126] Note: One or more of the methods for adjusting the DNA structure of the "T7 RNAP expression unit" can be used in combination.
[0127] Example 1. Constructing a single-plasmid T7 expression system by changing the distance from RBS to the start codon ATG in the "T7 RNAP expression unit".
[0128] Taking the pUC-19 vector as an example, the T7 RNAP expression unit (lacUV5 promoter sequence, RBS sequence, T7 RNAP gene, and T0 terminator sequence) was inserted into the pUC-19 plasmid (Takara Code No: 3219) via Gibson ligation, resulting in the following structure: Figure 5 The pUC-19-test plasmid was used to modify the distance between RBS and the ATG of the T7 RNAP encoding gene, resulting in a series of recombinant plasmids with different T7 RNAP expression intensities. Figure 5RN (where N represents the number of bases from the start codon ATG of the T7 RNAP encoding gene) was expressed in E. coli DH5α cells. The expression of T7 RNAP in E. coli DH5α cells was determined by the T7 RNAP enzyme activity assay (TX-TL system assay, reference: Mingxin Cui, Okei Wong, Qiang Li, Wenya Wang, An Assay Method for Characterizing Bacteriophage T7 RNA Polymerase Activity by Transcription–Translation (TX-TL) System, The Journal of Biochemistry, 2023, mvad002, https: / / doi.org / 10.1093 / jb / mvad002.). Plasmids R7, R31, and R55, whose T7 RNApase activity is lower than that of E. coli DH5α (E0), were selected. T7 promoter transcription units (T7 promoter sequence, target gene sequence, and T7 terminator sequence) were introduced via Gibson ligation. Using the sfGFP protein gene as the target gene, a single-plasmid T7 expression system plasmid was constructed. Figure 5 The cells were transformed into E. coli DH5α cells and cultured in shake flasks (grown at 37℃ and 200 rpm for 12 h). All cells expressed green fluorescent protein. Figure 5 This indicates that by adjusting the distance from RBS to ATG in the "T7 RNAP expression unit" and reducing the host T7 RNAP expression activity to below E0, an E. coli DH5α single plasmid T7 expression system can be successfully constructed in E. coli DH5α cells.
[0129] Example 2. Constructing a single-plasmid T7 expression system by changing promoters of different strengths in the "T7 RNAP expression unit".
[0130] By screening promoter elements, a batch of promoters with different transcriptional intensities were selected: lacUV5 (SEQ ID NO.4: TTTACACTTTATGCTTCCGGCTCGTATAATG), J23103 (SEQ ID NO.5: CTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGC), J23109 (SEQ ID NO.6: TTTCAGCTAGCTCAGTCCTAGGGACTGTGCTAGC), J23112 (SEQ ID NO.7: CTGATAGCTAGCTCAGTCCTAGGGATTATGCTAGC), and J23117 (SEQ ID NO.8: TTTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGC). The promoter in the T7 RNAP expression unit was altered using Gibson linker to regulate the expression level of the T7 RNAP gene in the pUC-19 test plasmid, resulting in a series of recombinant plasmids with different T7 RNAP expression intensities. These plasmids were then transformed into E. coli DH5α cells and the expression levels in E. coli were measured. T7 RNAP enzyme activity in DH5α cells ( Figure 6 Plasmids with promoter J23112 and enzyme activity lower than that of E. coli DH5α (E0) were selected and introduced into the T7 promoter transcription unit via Gibson ligation. Using the sfGFP protein gene as the target gene, a single-plasmid T7 expression system plasmid was constructed and transformed into E. coli DH5α cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), strong green fluorescent protein expression was observed. Figure 6 This indicates that a single E. coli DH5α plasmid T7 expression system can be successfully constructed by regulating T7 RNAP through different promoters.
[0131] Example 3. Constructing a single-plasmid T7 expression system by promoter mutation of the "T7 RNAP expression unit".
[0132] Taking the *E. coli* lacUV5 promoter as an example, the TAA base in the -10 region of the promoter was mutated, and the mutated promoter was linked upstream of the T7RNAP gene in the pUC-19-test plasmid via Gibson ligation. This yielded a series of recombinant plasmids with different T7RNAP expression intensities, which were then transformed into *E. coli* DH5α cells to express T7RNAP. The T7RNAP enzyme activity in the cells was then measured. Figure 7Plasmids lacUV5-2 (-10 region TAA mutation to GTG), lacUV5-4 (-10 region TAA mutation to ACG), and lacUV5-6 (-10 region TAA mutation to TCT) with enzyme activity lower than E. coli DH5α at E0 were selected. These plasmids were introduced into the T7 promoter transcription unit via Gibson ligation. Using the sfGFP protein gene as the target gene, a single-plasmid T7 expression system was constructed and transformed into E. coli DH5α cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), all strains expressed green fluorescent protein, indicating that the E. coli DH5α single-plasmid T7 expression system could be successfully constructed by regulating the T7 RNAP gene through promoter mutation.
[0133] Example 4. Constructing a single-plasmid T7 expression system by inserting a transcription-blocking terminator downstream of the promoter of the "T7 RNAP expression unit".
[0134] Based on the pUC-19 test plasmid, different terminator sequences were inserted downstream of the promoter using Gibson ligation to obtain a series of plasmids with different T7 RNAP expression intensities. These plasmids were then transformed into E. coli DH5α cells, and the T7 RNAP enzyme activity in E. coli DH5α cells was measured. Figure 8 Plasmids with enzyme activities lower than E0 of E. coli DH5α, namely RBS-7 (with inserted terminator sequence SEQ ID NO. 9: CTAGCAGGGCCTCTAAACGGGCCTTGAGGGGTTTTTTG), RBS-9 (with inserted terminator sequence SEQ ID NO. 10: ATAACCCCTTGGGGCCTCTAAACGGGCCTTGAGGGGTTTTTT), and RBS-10 (with inserted terminator sequence SEQ ID NO. 11: AAAAAACGCCCGGCGGCAACCGAGCGTTCTG), were selected. These plasmids were introduced into the T7 promoter transcription unit via Gibson ligation. Using the sfGFP protein gene as the target gene, a single-plasmid T7 expression system was constructed and transformed into E. coli DH5α cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), all strains showed green fluorescent protein expression, indicating that inserting a terminator sequence downstream of the promoter to regulate the T7 RNAP gene can successfully construct a T7 expression system in E. coli. DH5α single plasmid T7 expression system.
[0135] Example 5. Constructing a single-plasmid T7 expression system by changing the codons in the T7 RNAP encoding gene to less frequently used rare codons.
[0136] Based on E. coli codon bias, less frequently used rare codons are selected to replace codons in the T7RNAP gene. Figure 9 Then, T7 RNAP genes containing different amounts of rare codons were synthesized (from Genewiz Sequencing). These genes were then replaced in the pUC-19-test plasmid using Gibson ligation, resulting in a series of T7 RNAP expression plasmids containing different rare codons. These plasmids were then transformed into E. coli DH5α cells, and the T7 RNAP enzyme activity in the cells was measured. Figure 9 A T7 RNAP-3 test plasmid with an enzyme activity lower than that of E. coli DH5α was selected (T7 RNAP gene: the start codon ATG was replaced with TTG, i.e., SEQ ID NO.12: GAACAGTTGGCCCTTGAGCATGAGTCTTAC was replaced with SEQ ID NO.13: GAGCAACTAGCTCTAGAGCACGAGTCCTAC). The T7 promoter transcription unit was then introduced via Gibson ligation. Using the sfGFP protein gene as the target gene, a single-plasmid T7 expression system plasmid was constructed and transformed into E. coli DH5α cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), the strain showed strong green fluorescent protein expression, indicating that the E. coli DH5α single-plasmid T7 expression system can be successfully constructed by using codons with lower frequency to replace the T7 RNAP gene codons to regulate T7 RNAP gene expression activity.
[0137] Example 6. Construction of a single-plasmid T7 expression system by mutating the T7 RNAP encoding gene.
[0138] By analyzing the structure of the T7 RNAP protein, primers were designed, and different amino acid mutations in the T7 RNAP gene were performed using PCR. The T7 RNAP gene in the pUC-19-test plasmid was then replaced using Gibson ligation to construct a series of T7 RNAP gene test plasmids with different mutation sites. These plasmids were then transformed into E. coli DH5α cells for culture, and the T7 RNAP enzyme activity was measured. Figure 10The T7 RNAP-M2 (arginine at position 627 mutated to alanine) and T7 RNAP-M3 (serine at position 539 mutated to alanine) test plasmids with lower enzyme activity than E. coli DH5α were selected from E0. The T7 promoter transcription unit was introduced, and the sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid. This plasmid was then transformed into E. coli DH5α cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), all strains showed strong green fluorescent protein expression, indicating that by mutating the T7 RNAP gene to alter T7 RNAP activity, a single-plasmid T7 expression system for E. coli DH5α could be successfully constructed.
[0139] Example 7. Constructing a single-plasmid T7 expression system by inserting a transcriptional interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene.
[0140] A reverse promoter was inserted downstream of T7 RNAP to reduce T7 RNAP expression through transcriptional interference. Different inverse promoters, P1 (SEQ ID NO.14: TTGACATAAGCCTGTTCGGTTCGTAAACT), P2 (SEQ ID NO.15: TTGACAGCTAGCTCAGTCCTAGGTATTGTGCTAGC), P3 (SEQ ID NO.16: TTTACACTTTATGCTTCCGGCTCGTATGATG), and P4 (SEQ ID NO.17: TTTACACTTTATGCTTCCGGCTCGTATGTTG), were inserted downstream of the T7 RNAP gene in the pUC-19-test plasmid using Gibson ligation to construct a series of test plasmids with different T7 RNAP expression levels. These plasmids were then transformed into E. coli DH5α cells, and T7 RNAP enzyme activity was measured. Figure 11 P3 and P4 test plasmids of E0 with enzyme activity lower than that of E. coli DH5α were selected, and the T7 promoter transcription unit was introduced. The sfGFP protein gene was used as the target gene to construct a single plasmid T7 expression system plasmid. The plasmid was transformed into E. coli DH5α cells. After shaking culture (grown at 37℃ and 200rpm for 12h), all strains showed green fluorescent protein expression, indicating that the single plasmid T7 expression system of E. coli DH5α could be successfully constructed by regulating the expression of T7 RNAP through transcriptional interference.
[0141] Example 8. Simultaneously constructing a single-plasmid T7 expression system by promoter mutation and adjusting the distance from RBS to the start codon ATG.
[0142] For some strains, simply changing the promoter or the ATG distance from RBS to the T7 RNAP gene alone cannot reduce T7 RNAP activity to its E0 value, thus failing to successfully construct a single-plasmid independent expression system. However, a combination of promoter mutation and adjustment of the RBS-ATG distance can reduce T7 RNAP activity below the E0 value of the strain. Taking B. subtilis168 strain as an example, using the pHT01 plasmid as the basic backbone, the T7 RNAP expression unit (P43 promoter sequence, RBS sequence, T7 RNAP coding gene, and T0 terminator sequence) was inserted into the pHT01 plasmid via Gibson ligation, constructing a single-plasmid independent expression system as shown below. Figure 12 Test plasmids were obtained, and the P43 promoter was mutated (AAA in the -10 region) to adjust the ATG distance from RBS to the T7 RNAP gene, thereby regulating the expression level of T7 RNAP. Test plasmids with different T7 RNAP expression intensities were obtained, transformed into B. subtilis 168 cells, and the T7 RNAP enzyme activity of the strain was measured. Figure 12 A test plasmid with enzyme activity lower than that of B. subtilis 168 at E0, named P43-5-R40 (promoter -10 region mutated to GCG, RBS to T7 RNAP gene ATG distance 40bp), was selected. A T7 promoter transcription unit was introduced, and the sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid. This plasmid was transformed into B. subtilis 168 cells. After shake-flask culture (grown at 37℃, 200rpm for 12h), the strain showed green fluorescent protein expression, indicating that the expression level of T7 RNAP can be regulated by simultaneously mutagenesis of the promoter and adjustment of the RBS to start codon ATG distance. The single-plasmid T7 expression system of B. subtilis 168 was successfully constructed and the target protein was expressed.
[0143] Example 9. A single-plasmid expression system was constructed by simultaneously modifying the promoter, inserting a terminator sequence downstream of the promoter, and inserting a transcriptional interference structure downstream of the T7RNAP expression unit.
[0144] Promoter elements PB1 (SEQ ID NO.18: TTGACAAATTGCAGTAGGCATGACAAAATGGACTCA) and PB2 (SEQ ID NO.19: ) with different transcription intensities were selected.
[0145] CAAAAATCAGACCAGACAAAAGCGGCAAATGAATAAGCGGAACGGGGAAGGATTTGCGGTCAAGTCCTTCCCTTCCGCACGTATCAATTCGCAAGCTTTTCCTTTATAATAGAATGAATGA), PB3 (SEQ ID NO.20: GGAGTTCTGAGAATTGGTATGCCTTATAAGTCCAATTAACAGTTGAAAACCTGCATAGGAGAGCTATGCGGGTTTTTTATTTTACATAATGATACATAATTTACCGAAACTTGCGGAACATAATTGAGGAATCATAGAATTTTGTCAAAATAATTTTATTGACAACGTCTTATTAACGTTGATATAATTTAAATTTTATTTGACAAAAATGGGCTCGTGTTGTACAATAAATGTAGT), and simultaneously insert a terminator sequence (SEQ ID NO.21: TTGGGGCCTCTAAACGGGCCTTGAGGGGTTTTTT) downstream of the promoter, thereby weakening the expression of T7 RNAP and obtaining different T7 RNAPs. A plasmid for testing RNAP expression intensity was transformed into B. subtilis 168 cells, and the activity of expressed T7 RNAP enzyme was measured. Figure 13 The PB2-RBS-5 test plasmid with an enzyme activity lower than that of B. subtilis 168 at E0 was selected. Then, the T7 promoter transcription unit was introduced, and the sfGFP protein gene was used as the target gene to construct a single-plasmid T7 expression system plasmid. This plasmid was transformed into B. subtilis 168 cells. After shake-flask culture (grown at 37℃ and 200 rpm for 12 h), the strain showed green fluorescent protein expression, indicating that the expression of T7 RNAP could be successfully constructed by simultaneously modifying the promoter and downstream insertion terminator sequences, as well as transcriptional interference.
[0146] Example 10. Construction of a single-plasmid T7 expression system for non-Escherichia coli hosts
[0147] Further, plasmids suitable for the host bacteria were selected as vectors for constructing the T7 single-plasmid expression system. The sfGFP protein gene was used as the target gene. Figure 3The construction process shown was also successfully used to construct single-plasmid T7 expression systems in E. coli BL21, E. coli JM109, E. coli Top10, E. coli S17, E. coli Nissle 1917, Tatumella morbirosei THVC01, C. glutamicum 13032, C. glutamicum RES167, B. subtilis 168, Sinorhizobium TH572, P. putida KT2440, Halomonas sp. THY01, Lactococcus lactis NZ9000, Bacillus licheniformis BL01, and Bacillus megaterium BM01. Figure 14 As shown, all strains expressed green fluorescent protein.
[0148] sequence list
[0149]
Claims
1. A method for constructing a T7 RNAP expression unit, which comprises the following steps: a. Design the T7 RNAP expression unit; b. Insert the designed T7 RNAP expression unit into a test plasmid; c. Express T7 RNAP in the host cell using the test plasmid; d. Measure the activity E of the T7 RNAP expressed by the test plasmid; e. Determine whether the T7 RNAP activity E is less than the threshold value E0 of the T7 RNAP activity in the host cell; f1. If E < E0, the T7 RNAP expression unit is successfully constructed; f2. If E ≥ E0, adjust the DNA structure of the designed T7 RNAP expression unit, and repeat steps b - e until it is determined that E < E0, then the T7 RNAP expression unit is successfully constructed; g. Select the plasmid with T7 RNAP activity lower than the E0 value, wherein, The E0 value for different host strains is: the upper limit value of the T7 RNAP activity that can be tolerated during the construction of each host single plasmid T7 expression system.
2. The method according to claim 1, wherein, The T7 RNAP expression unit contains: a promoter sequence, an RBS sequence, a T7 RNAP coding gene, and a terminator sequence.
3. The method according to claim 1, wherein, In step f2, the method for adjusting the DNA structure of the designed T7 RNAP expression unit is selected from any one or more of the following to reduce the expression level and expression activity of T7 RNAP: Changing the promoter, Mutating the promoter, Designing the RBS structure, Changing the distance from the RBS to the start codon of the T7 RNAP coding gene, Changing the codons in the T7 RNAP coding gene to rare codons, Changing the terminator of the T7 RNAP coding gene, Changing the plasmid copy number, Designing an antisense RNA that inhibits T7 RNAP expression, Inserting a sequence that can weaken the T7 RNAP transcription intensity downstream of the promoter of the T7 RNAP expression unit, Inserting a transcriptional interference structure downstream of the T7 RNAP expression unit that interferes with the T7 RNAP gene transcription process, or Mutating the T7 RNAP coding gene.
4. The method according to claim 1, wherein, The test plasmid is selected from: pUC - type high - copy plasmids, pET - type medium - copy plasmids, pBBRMCS - type broad - host plasmids, pBL - type low - copy plasmids, pYE plasmids, pYC plasmids, pRS plasmids or PGEX plasmids.
5. The method according to claim 1, wherein, The host cell is selected from: Gram - negative bacteria or Gram - positive bacteria.
6. The method according to claim 5, wherein, The host cell is selected from: Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pseudomonas, Bacillus licheniformis, Sinorhizobium, Tatumella or Halomonas.
7. The method according to claim 1, wherein, The method for measuring the T7 RNAP activity is the TX - TL detection method.
8. The method according to claim 3, wherein changing the promoter means changing the original promoter to the following promoter: J23112 promoter.
9. The method according to claim 3, wherein mutating the promoter means performing nucleotide insertion, deletion or substitution on the original promoter sequence.
10. The method according to claim 3, wherein designing the RBS structure means: predicting the RBS translation efficiency using RBS calculator software.
11. The method of claim 10, wherein the distance from the start codon of the RBS to the T7 RNAP encoding gene is adjusted within the range of 7 to 40 bp.
12. The method according to claim 3, wherein designing antisense RNA to inhibit T7 RNAP expression means inserting a module expressing the T7 RNAP antisense gene into the T7 RNAP expression plasmid.
13. The method of claim 3, wherein inserting a sequence downstream of the promoter of the T7 RNAP expression unit that causes a reduction in the transcriptional intensity of T7 RNAP means inserting the following DNA sequence that can bind to the repressor downstream of the promoter: a terminator sequence.
14. The method according to claim 13, wherein, The termination subsequence is SEQ ID NO.
21.
15. The method according to claim 3, wherein inserting a transcription interference structure downstream of the T7 RNAP expression unit to interfere with the transcription process of the T7 RNAP gene means inserting a reverse promoter downstream of the T7 RNAP expression unit.
16. The method according to claim 3, wherein mutating the T7 RNAP encoding gene means inserting, deleting, or replacing nucleotides in the original T7 RNAP encoding gene.
Citation Information
Patent Citations
CN110218734A