Activation response promoters and uses thereof

Abstract

Described herein are compositions and methods for modulating expression of effector molecules using engineered CCL3 promoters. Immune-responsive cells comprising the same are also described. Further wherein the engineered CCL3 promoter comprises an ablation of at least one nucleotide motif wherein the ablation increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal.

Description

[0001] Cross-reference to related applications

[0002] This application claims the benefit of and priority to U.S. Provisional Patent Application No. 63 / 289,983, filed on December 15, 2021, and U.S. Provisional Patent Application No. 63 / 352,995, filed on June 16, 2022, each of which is incorporated herein by reference in its entirety for all purposes.

[0003] Sequence Listing

[0004] This application includes a sequence listing, which has been submitted by EFS-Web and is hereby incorporated by reference in its entirety. The ASCII copy was created on XX / XX / 20XX, is named XXXXXUS_sequencelisting.txt, and is X,XXX,XXX bytes in size. Background Art

[0005] Cell-based therapy platforms offer promising avenues for treating a variety of diseases. One such promising platform is CAR-T-based therapy in cancer treatment. Given their promise, improvements in cell-based therapies are needed. An active area of ​​exploration is cell-based engineered therapies to produce and / or secrete effector molecules, such as cytokines, that can enhance cell-based therapies, a process known as arming. For example, unarmed CAR-T therapy has poor efficacy against solid tumors, and arming can affect the entire cancer immunity cycle and enhance the activity of CAR-T. However, uncontrolled or unregulated arming strategies can have negative effects on treatment, such as off-target effects and toxicity to subjects. Therefore, additional methods for controlling and regulating the arming of cell-based therapies (such as regulating the production and / or secretion of payload effector molecules) are needed. Summary of the invention

[0006] One embodiment of the present disclosure provides an engineered CCL3 promoter comprising ablation of at least one nucleotide motif, wherein the ablation increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal.

[0007] In one aspect, provided herein is an engineered CCL3 promoter comprising ablation of at least one nucleotide motif, wherein said ablation increases the inducibility of said engineered CCL3 promoter in the presence of an immune cell activation signal as compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal;

[0008] Optionally wherein the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132;

[0009] Optionally wherein the motif comprises a sequence selected from the group consisting of position 566 to position 576 of SEQ ID NO: 132, position 674 to position 695 of SEQ ID NO: 132, position 820 to position 832 of SEQ ID NO: 132, position 1089 to position 1105 of SEQ ID NO: 132, position 1127 to position 1141 of SEQ ID NO: 132, position 1184 to position 1199 of SEQ ID NO: 132, position 1475 to position 1500 of SEQ ID NO: 132, position 1534 to position 1544 of SEQ ID NO: 132, position 1553 to position 1595 of SEQ ID NO: 132, position 1634 to position 1674 of SEQ ID NO: 132, position 1681 to position 1692 of SEQ ID NO: 132, and position 1982 to position 1998 of SEQ ID NO: 132;

[0010] Optionally wherein the ablation comprises a substitution or deletion of one or more nucleotides of the at least one nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132;

[0011] Optionally, wherein the motif corresponds to position 566 to position 576 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution of the sequence GTACCAGAATA (SEQ ID NO: 191) comprising from position 566 to position 576 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 674 to position 695 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution of the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO: 193) comprising from position 674 to position 695 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132 NO:132, optionally wherein the motif corresponds to position 820 to position 832 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ACGAAGCAATACT (SEQ ID NO:195) from position 820 to position 832 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) from position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) from position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132 NO:132, position 1089 to position 1105 nucleotide deletion, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1127 to position 1141 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO:201) from position 1127 to position 1141 of SEQ ID NO:132,Optionally, wherein the ablation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1475 to position 1500 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132 NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution from position 1534 to position 1544 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO: 132 NO:132, position 1553 to position 1595, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATCTTCATATTACCTCCA (SEQ ID NO:221) from position 1553 to position 1595 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132,Optionally, wherein the motif corresponds to position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO: 223) from position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TATACCTTGGTT (SEQ ID NO: 225) from position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132 A motif of a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the engineered CCL3 promoter comprises the polynucleotide of SEQ ID NO: 4;

[0012] Optionally, wherein the ablation comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1982 to position 1998 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO: 241) from position 1982 to position 1998 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO: 132;

[0013] Optionally wherein the ablation comprises ablation of at least two nucleotide motifs, at least three nucleotide motifs, at least four nucleotide motifs, at least five nucleotide motifs, or at least six nucleotide motifs;

[0014] Optionally, wherein the at least six nucleotide motifs include: a nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132, and a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132,

[0015] Optionally, said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO: 132, optionally wherein said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO: 132, optionally wherein said ablation further comprises ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132, optionally wherein said ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said ablation further comprises ablation of a nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein said ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein said engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 2;

[0016] Optionally, wherein said ablation of the nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said ablation further comprises ablation of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132, optionally wherein said ablation of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 1,

[0017] Optionally, the ablation comprises ablation of at least nine nucleotide motifs, optionally wherein the at least nine nucleotide motifs comprise: a nucleotide motif corresponding to position 566-576 of SEQ ID NO: 132, a nucleotide motif corresponding to position 674-695 of SEQ ID NO: 132, a nucleotide motif corresponding to position 820-832 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1089-1105 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1127-1141 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1184-1199 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1475-1500 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1553-1595 of SEQ ID NO: 132 and a nucleotide motif corresponding to position 1564-1596 of SEQ ID NO: 132 NO:132, wherein the ablation comprises a deletion of each of the at least nine nucleotide motifs, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3,

[0018] Optionally, wherein the at least nine nucleotide motifs include: a nucleotide motif corresponding to position 566-576 of SEQ ID NO: 132, a nucleotide motif corresponding to position 674-695 of SEQ ID NO: 132, a nucleotide motif corresponding to position 820-832 of SEQ ID NO: 132, a nucleotide motif corresponding to position 911-926 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1089-1105 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1127-1141 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1184-1199 of SEQ ID NO: 132, a nucleotide motif corresponding to position 1211-1223 of SEQ ID NO: 132, and a nucleotide motif corresponding to position 1236-1248 of SEQ ID NO: 132, optionally wherein the ablation of the at least nine nucleotide motifs includes a nucleotide motif corresponding to SEQ ID NO: NO:132, optionally wherein said ablation of at least nine nucleotide motifs includes a deletion corresponding to position 550 to position 1250 of SEQ ID NO:132, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1425 to position 1445 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1425-1445 of SEQ ID NO:132 includes a deletion of said nucleotide motif, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1475-1500 of SEQ ID NO:132 includes a deletion of said nucleotide motif, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132 The ablation of the nucleotide motif at position 1553-1595 of NO:132 comprises a deletion of the nucleotide motif, optionally wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132, optionally wherein the ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO:132,Optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, Optionally wherein the CCL3 promoter comprises SEQ ID NO: 242,

[0019] Optionally, wherein the ablation comprises the deletion of at least two nucleotide motifs according to position 1425 to position 1500 of SEQ ID NO: 132, optionally wherein the ablation further comprises the ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132, optionally wherein the ablation of the nucleotide motif corresponding to position 1553-1595 of SEQ ID NO: 132 comprises the deletion of the nucleotide motif, optionally wherein the ablation further comprises the ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132, optionally wherein the ablation of the nucleotide motif corresponding to position 1663-1679 of SEQ ID NO: 132 comprises the deletion of the nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the ablation comprises a motif comprising from SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, optionally wherein the CCL3 promoter comprises SEQ ID NO:243, optionally wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, optionally wherein the CCL3 promoter comprises SEQ ID NO:244, optionally wherein the ablation further comprises a deletion corresponding to position 1663 to position 1692 of SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, or optionally wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:245.

[0020] In another aspect, the present invention provides an engineered CCL3 promoter comprising at least one nucleotide motif,

[0021] Optionally wherein the at least one nucleotide motif is selected from the group consisting of:

[0022] a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132,

[0023] b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132,

[0024] c) the nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132,

[0025] d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132,

[0026] e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132,

[0027] f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132,

[0028] g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132,

[0029] h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132,

[0030] i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132,

[0031] k) a nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132,

[0032] 1) a nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132,

[0033] m) a nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132,

[0034] n) a nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132,

[0035] o) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and

[0036] p) a nucleotide motif corresponding to positions 1840-1861 of SEQ ID NO: 132;

[0037] Optionally wherein the engineered CCL3 promoter comprises at least fifteen nucleotide motifs, the at least fifteen nucleotide motifs comprising:

[0038] a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132,

[0039] b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132,

[0040] c) the nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132,

[0041] d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132,

[0042] e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132,

[0043] f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132,

[0044] g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132,

[0045] h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132,

[0046] i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132,

[0047] j) a nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132,

[0048] k) a nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132,

[0049] 1) a nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132,

[0050] m) a nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132,

[0051] n) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and

[0052] o) a nucleotide motif corresponding to positions 1840-1861 of SEQ ID NO: 132;

[0053] Or optionally wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:246.

[0054] In another aspect, provided herein is an engineered CCL3 promoter comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-4 and 242-246.

[0055] In another aspect, provided herein is a heterologous construct comprising an engineered CCL3 promoter according to any one of the above aspects or embodiments operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide;

[0056] Optionally wherein the polypeptide comprises at least one effector molecule,

[0057] Optionally wherein the polypeptide comprises a first effector molecule and a second effector molecule,

[0058] Optionally wherein the polynucleotide comprises a polynucleotide sequence encoding the first effector molecule, a linker polynucleotide sequence and a polynucleotide sequence encoding the second effector molecule,

[0059] Optionally wherein the linker polynucleotide sequence encodes one or more 2A ribosomal jumping elements, Optionally wherein the one or more 2A ribosomal jumping elements comprise elements each selected from the group consisting of: P2A, T2A, E2A and F2A,

[0060] Optionally wherein the at least one effector molecule is selected from the class of therapeutic agents, wherein the class of therapeutic agents is selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides and enzymes,

[0061] Optionally wherein each effector molecule of the at least one effector molecule comprises:

[0062] a) cytokines, optionally wherein the cytokine is selected from the group consisting of IL1-β, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-γ and TNF-α;

[0063] b) a chemokine, optionally wherein the chemokine is selected from the group consisting of: CCL21a, CXCL10, CXCL11, CXCL13, a CXCL10-CXCL11 fusion protein, CCL19, CXCL9 and XCL1;

[0064] c) a homing molecule, optionally wherein the homing molecule is selected from the group consisting of: anti-integrin α4, β7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15;

[0065] d) a growth factor, optionally wherein the growth factor is selected from the group consisting of: FLT3L and GM-CSF;

[0066] e) a co-activator molecule, optionally wherein the co-activator molecule is selected from the group consisting of: c-Jun, 4-1BBL and CD40L;

[0067] f) a tumor microenvironment modifier, optionally wherein the tumor microenvironment modifier is selected from the group consisting of: an adenosine deaminase, a TGFβ inhibitor, an immune checkpoint inhibitor, a VEGF inhibitor, and HPGE2;

[0068] Optionally wherein each of said first effector molecule and said second effector molecule is from a separate therapeutic class;

[0069] And optionally wherein each effector molecule of the at least one effector molecule is a human-derived effector molecule.

[0070] In another aspect, provided herein is a vector comprising the heterologous construct according to any one of the above aspects or embodiments.

[0071] In another aspect, a dual expression vector is provided herein, comprising a heterologous construct according to the above aspect and a second construct comprising a polynucleotide sequence encoding an activating immune receptor, optionally wherein the activating immune receptor comprises an antigen recognition receptor,

[0072] Optionally wherein the antigen recognition receptor comprises a T cell receptor (TCR), optionally wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and

[0073] Optionally wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR).

[0074] In another aspect, an immune response cell is provided herein, comprising the heterologous construct, vector or dual expression vector according to any one of the above aspects or embodiments,

[0075] Optionally wherein the immune response cells are selected from the group consisting of: T cells, CD8+T cells, CD4+T cells, gamma-delta T cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells;

[0076] Optionally wherein the immune response cell expresses an activating immune receptor, optionally wherein the activating immune receptor comprises an antigen recognition receptor, optionally wherein the antigen recognition receptor comprises a T cell receptor (TCR), optionally wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and optionally wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR);

[0077] Optionally wherein the antigen recognition receptor comprises an activating NK cell receptor, optionally wherein the activating NK cell receptor is selected from the group consisting of: NKG2D, NKp30, NKp44, NKp46, and ITAM-containing killer cell Ig-like receptor (KIR);

[0078] Optionally wherein the immune response cell comprises a heterologous construct encoding the antigen recognition receptor; and

[0079] Optionally wherein the immune response cells are autologous, or optionally wherein the immune response cells are allogeneic.

[0080] On the other hand, provided herein is a pharmaceutical composition comprising the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

[0081] In another aspect, provided herein is a method for increasing the expression of a target gene, the method comprising using the engineered CCL3 promoter, the heterologous construct, the vector or the dual expression vector to increase the expression of the target gene, optionally wherein the target gene is an immunomodulatory gene.

[0082] In another aspect, provided herein is a method for treating a subject in need thereof, the method comprising administering the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments.

[0083] In another aspect, provided herein is a method for stimulating a cell-mediated immune response in a subject, the method comprising administering to the subject the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments.

[0084] On the other hand, provided herein is a method for reducing tumor volume in a subject, the method comprising administering to a subject having a tumor a composition comprising the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments.

[0085] On the other hand, provided herein is a method for providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments.

[0086] In another aspect, provided herein is a method for treating a subject having cancer, the method comprising administering to a subject in need thereof the engineered CCL3 promoter, the heterologous construct, the vector, the dual expression vector, the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments.

[0087] On the other hand, the present invention provides a kit for treating and / or preventing tumors, the kit comprising the immune response cell or the pharmaceutical composition according to any one of the above aspects or embodiments, optionally wherein the kit further comprises written instructions for using the immune response cell or the pharmaceutical composition to treat and / or prevent the tumor in a subject. BRIEF DESCRIPTION OF THE DRAWINGS

[0088] Figure 1 Fold changes in geometric mean fluorescence intensity (gMFI) of mKate and YFP-expressing T cells driven by CCL3 promoter ablation variants are depicted.

[0089] Figure 2ADepicted are mCherry (mKate) fluorescence expression of stimulated and unstimulated NK cells determined by flow cytometry at 24 hours. Fluorescence is driven by CCL3 promoter ablation variants. Figure 2B Depicted are mCherry fluorescence expression of stimulated and unstimulated NK cells determined by flow cytometry at 48 hours. Fluorescence was driven by CCL3 promoter ablation variants.

[0090] Figure 3A Depicted are gMFI of stimulated and unstimulated NK cells at 24 hours, in which mCherry expression was driven by the CCL3 promoter ablation variant. Figure 3B Fold changes in gMFI after stimulation of NK cells are depicted. Figure 3C Depicted are the gMFI of stimulated NK cells plotted relative to unstimulated NK cells. Figure 3D Depicted are the gMFI of stimulated NK cells plotted relative to unstimulated NK cells, with 1682 outliers removed.

[0091] Figure 4A Depicted are gMFI of stimulated and unstimulated NK cells at 48 hours, in which mCherry expression was driven by the CCL3 promoter ablation variant. Figure 4B Fold changes in gMFI after stimulation of NK cells are depicted. Figure 4C Depicted are the gMFI of stimulated NK cells plotted relative to unstimulated NK cells. Figure 4D Depicted are the gMFI of stimulated NK cells plotted relative to unstimulated NK cells, with 1682 outliers removed.

[0092] Figure 5A Depicted are the gMFI of stimulated and unstimulated T cells in which BFP expression was driven by various CCL3 promoter variants. Figure 5B Fold changes in gMFI after stimulation of T cells are depicted.

[0093] Fig. 6A Depicted are the gMFI of stimulated and unstimulated T cells in which BFP expression was driven by various CCL3 promoter variants. Figure 6B Fold changes in gMFI after stimulation of T cells are depicted. DETAILED DESCRIPTION

[0094] definition

[0095] Unless otherwise stated, the terms used in the claims and specification are defined as follows.

[0096] The term "amelioration" refers to any therapeutically beneficial result in the treatment of a disease state (eg, a cancer disease state), including prevention, lessening of its severity or progression, remission, or cure.

[0097] The term "in situ" refers to a process occurring in living cells grown separately from a living organism (eg, grown in tissue culture).

[0098] The term "in vivo" refers to processes that occur in a living organism.

[0099] As used herein, the term "mammal" encompasses both human and non-human animals, and includes, but is not limited to, humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0100] The term percent "identity", in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that, when compared and aligned for maximum correspondence, have a specified percentage of identical nucleotides or amino acid residues, as measured using one of the following sequence comparison algorithms (e.g., BLASTP and BLASTN or other algorithms available to the skilled person) or by visual inspection. Depending on the application, the "identity" percentage can exist over a region of the sequences being compared, e.g., over a functional domain, or alternatively, over the full length of the two sequences to be compared.

[0101] For sequence comparison, usually one sequence is used as a reference sequence to which a test sequence is compared. When using a sequence comparison algorithm, the test sequence and the reference sequence are input into a computer, subsequence coordinates are specified if necessary, and sequence algorithm program parameters are specified. The sequence comparison algorithm then calculates the percent sequence identity of the test sequence relative to the reference sequence based on the specified program parameters.

[0102] Optimal alignment of sequences for comparison can be performed, for example, by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the similarity search method of Pearson and Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988); by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Avenue, Madison, Wisconsin); or by visual inspection (see generally Ausubel et al., below).

[0103] An example of an algorithm suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., Journal of Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0104] The term "sufficient amount" means an amount sufficient to produce a desired effect, for example, an amount sufficient to modulate protein aggregation in a cell.

[0105] The term "therapeutically effective amount" is an amount effective to ameliorate symptoms of a disease. A therapeutically effective amount can be a "prophylactically effective amount" since prevention can be considered treatment.

[0106] It must be noted that, as used in this specification and the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0107] Engineered Nucleic Acids and Peptides

[0108] Regulation of drug expression in cell therapy is necessary to hit the therapeutic efficacy window. Such methods are described herein, which use adjustable transcription factors that can drive the expression of any desired effector molecule or combination of effector molecules. This system is universal because the system can regulate intracellular or membrane-bound proteins by using, for example, a modular protease system that can be turned on or off. It can use protease conversion drugs approved by the FDA and can be administered by oral delivery with a favorable pharmacokinetic profile. In addition, the methods and compositions described herein can be used, for example, to regulate the expression of immunomodulatory effectors in cells or gene therapies. The adjustable transcription factor can be used in combination with, for example, CAR T cells, CAR NK cells, TCR T cells, TIL therapy, virus-specific T cells, or any other suitable immune cell therapy.

[0109] CCL3 inducible promoter and ablation variants

[0110] CCL3 (also known in the art as CC motif chemokine ligand, MIP-1-α, G0S19, LD78ALPHA, SCYA3, small inducible cytokine A3 (homologous to mouse Mip-1a), macrophage inflammatory protein 1-α, tonsillar lymphocyte LD78α protein, G0 / G1 transition regulatory protein 19-1, CC motif chemokine 3, PAT 464.1, SIS-β, MIP1A, chemokine (CC motif) ligand 3 and small inducible cytokine A3) is a small inducible cytokine. Since the CCL3 promoter is inducible when stimulated with an immune cell activation signal, it can be a tool for regulating the expression of effector molecules. As used herein, "immune cell activation signal" refers to the engagement of proteins and / or protein complexes sufficient to stimulate an immune response, as determined by activation of the CCL3 promoter, and includes, for example, but not limited to, CD3 and 4-1BB, CD3 and CD28, etc. In certain embodiments, the immune cell activation signal comprises CD3 and CD28. In certain embodiments, the immune cell activation signal comprises CD3 and 4-1BB. In certain embodiments, the immune cell activation signal comprises a cell comprising a protein, e.g., Huh7 cell.

[0111] The length of the CCL3 promoter is greater than about 2000 base pairs. In some embodiments, the CCL3 promoter includes a series of continuous nucleotides (referred to as "nucleotide motifs") ablated within the promoter. As used herein, "ablation" may refer to the deletion of any method known in the art for nucleotide deletion (e.g., molecular cloning, CRISPR, etc.), or may refer to substitution (i.e., nucleotide substitution) such that at least one nucleotide is replaced by at least one other nucleotide. In some embodiments, the ablation of the nucleotide motif increases the inducibility of the CCL3 promoter (e.g., the transcription level downstream of the promoter after stimulation), wherein the increased inducibility is relative to the wild-type CCL3 promoter. Methods for quantitative transcription levels are known in the art, and include, for example, but not limited to, mRNA analysis performed by reverse transcriptase quantitative polymerase chain reaction (RT-qPCR), fluorescent reporter genes, colorimetric reporter genes, etc. In some embodiments, ablation increases inducibility by at least 0.5 times, at least 1 times, at least 2 times, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, or at least 8 times. It is contemplated herein that variations in the inducibility of the CCL3 promoter may depend on the test system, for example, the cell type comprising the promoter.

[0112] In some embodiments, the ablation comprises a substitution of a second nucleotide motif at the ablation site. In some embodiments, the introduction of the second nucleotide motif in the ablation site does not introduce a new regulatory site (e.g., a transcription factor binding site) in the CCL3 promoter. Such CCL3 promoters comprising a deletion or substitution of a nucleotide motif at the ablation site are referred to herein as "ablation variants."

[0113] Sequences of exemplary CCL3 promoter ablation variants are provided below in Table 1. Table 2 provides the sequences of the wild-type ablation motif and the second nucleotide motif used to substitute for the same ablation variant.

[0114] Table 1. DNA sequences of CCL3 promoter ablation variants

[0115]

[0116]

[0117]

[0118]

[0119]

[0120]

[0121]

[0122]

[0123]

[0124]

[0125]

[0126]

[0127]

[0128]

[0129]

[0130]

[0131]

[0132]

[0133]

[0134]

[0135]

[0136]

[0137]

[0138]

[0139]

[0140]

[0141]

[0142]

[0143]

[0144]

[0145]

[0146]

[0147]

[0148]

[0149]

[0150]

[0151]

[0152]

[0153]

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163]

[0164]

[0165]

[0166]

[0167]

[0168]

[0169]

[0170]

[0171]

[0172]

[0173]

[0174]

[0175]

[0176]

[0177]

[0178]

[0179]

[0180]

[0181]

[0182]

[0183]

[0184]

[0185]

[0186]

[0187]

[0188]

[0189]

[0190]

[0191]

[0192]

[0193]

[0194]

[0195]

[0196] Table 2. DNA sequences of the wild-type ablation motif and second nucleotide motif of CCL3 ablation variants with the substitutions described in Table 1 above.

[0197]

[0198]

[0199]

[0200]

[0201]

[0202] In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least two nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least three nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least four nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least five nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least six nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least seven nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least eight nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of at least nine nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of ten or more nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the nucleotide motifs are selected from Table 2. In certain embodiments, the CCL3 promoter of the present disclosure includes ablations and substitutions of all nucleotide motifs from Table 2 (e.g., SEQ ID NO: 169).

[0203] In some embodiments, the CCL3 promoter of the present disclosure may include ablations of two nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of three nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of four nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of five nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of six nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of seven nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of eight nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of nine nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of ten nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of eleven nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of twelve nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of thirteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of fourteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of fifteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of sixteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablation of seventeen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of eighteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of nineteen nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the CCL3 promoter of the present disclosure may include ablations of twenty nucleotide motifs relative to SEQ ID NO: 132.In some embodiments, the CCL3 promoter of the present disclosure may include ablation of greater than twenty nucleotide motifs relative to SEQ ID NO: 132. In some embodiments, the nucleotide motif is selected from Table 2.

[0204] In some embodiments, the CCL3 promoter includes at least one nucleotide motif. In some embodiments, the CCL3 promoter includes at least two nucleotide motifs. In some embodiments, the CCL3 promoter includes at least three nucleotide motifs. In some embodiments, the CCL3 promoter includes at least four nucleotide motifs. In some embodiments, the CCL3 promoter includes at least five nucleotide motifs. In some embodiments, the CCL3 promoter includes at least six nucleotide motifs. In some embodiments, the CCL3 promoter includes at least seven nucleotide motifs. In some embodiments, the CCL3 promoter includes at least eight nucleotide motifs. In some embodiments, the CCL3 promoter includes at least nine nucleotide motifs. In some embodiments, the CCL3 promoter includes at least ten nucleotide motifs. In some embodiments, the CCL3 promoter includes at least eleven nucleotide motifs. In some embodiments, the CCL3 promoter includes at least twelve nucleotide motifs. In some embodiments, the CCL3 promoter includes at least thirteen nucleotide motifs. In some embodiments, the CCL3 promoter includes at least fourteen nucleotide motifs. In some embodiments, the CCL3 promoter includes at least fifteen nucleotide motifs. In some embodiments, the CCL3 promoter includes at least sixteen nucleotide motifs. In some embodiments, the CCL3 promoter includes at least seventeen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least eighteen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least nineteen nucleotide motifs. In some embodiments, the CCL3 promoter comprises at least twenty nucleotide motifs. In some embodiments, the nucleotide motifs are selected from Table 2.

[0205] In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 133. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 134. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 135. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 136. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 137. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 138. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 139. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 140. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 141. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 142. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 143. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 144. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 145. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 146. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 147. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 148. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 149. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 150. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 151. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 152. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 153. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 154.In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 155. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 156. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 157. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 158. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 159. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 160. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 161. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 162. In some embodiments, the CCL3 promoter ablation variants disclosed herein include the nucleotide sequence of SEQ ID NO: 163. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 164. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 165. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 166. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 167. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 168. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include the nucleotide sequence of SEQ ID NO: 169. In certain embodiments, the engineered CCL3 promoter of the present disclosure further includes at the 5' end.

[0206] GGACAGAATTCCAAAGGCATGGTCGCACTTGGCTTCTGTCCTCTGTTAT TCTCCAGCATCAAATGTATCAACTCTAACCCCTTTG (SEQ ID NO: 5).

[0207] In some embodiments, the CCL3 promoter ablation variants disclosed herein do not include a substitution at the ablation site. In some embodiments, the CCL3 promoter ablation variants include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 1. In some embodiments, the CCL3 promoter ablation variants disclosed herein include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 4. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 242. In some embodiments, the CCL3 promoter ablation variants of the present disclosure include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 243. In some embodiments, the CCL3 promoter ablation variants of the present disclosure comprise a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO:244.In some embodiments, the CCL3 promoter ablation variants disclosed herein include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 245. In some embodiments, the CCL3 promoter ablation variants disclosed herein include a polynucleotide sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NO: 246.

[0208] In some embodiments, a CCL3 promoter or a CCL3 promoter ablation variant as described above can be operably linked to a nucleotide sequence encoding a polypeptide, eg, an effector molecule described herein.

[0209] Non-CCL3 engineered nucleic acids

[0210] In another aspect, provided herein is an engineered nucleic acid comprising: a first expression cassette comprising a first promoter and a first exogenous polynucleotide sequence encoding an activation conditional control polypeptide (ACP) and / or an antigen recognition receptor, wherein the first promoter is operably linked to the first exogenous polynucleotide; and a second expression cassette comprising an activation conditional control polypeptide responsive (ACP responsive) promoter and a second exogenous polynucleotide sequence having the formula: (LE) X , wherein E comprises a polynucleotide sequence encoding an effector molecule, L comprises a linker polynucleotide sequence, X=1 to 20, wherein the ACP response promoter is operably linked to the second exogenous polynucleotide, wherein for the first iteration of the (LE) unit, L does not exist, and optionally wherein the ACP is capable of inducing expression of the first expression cassette by binding to the ACP response promoter. In some embodiments, the ACP comprises a drug-inducible domain, such as a tetracycline-responsive domain (e.g., a TetR domain) or a repressor protease domain (e.g., an NS3 protease). In some embodiments, the ACP is a transcriptional regulator, such as a zinc finger protein. In some embodiments, the ACP is a small molecule (e.g., a drug) inducible peptide. In certain embodiments, the ACP is coupled to a promoter, for example, an alternative promoter of a CCL3 variant described herein. Exemplary promoters are known in the art.

[0211] Polycistronic and multi-promoter systems

[0212] In some embodiments, the engineered nucleic acid is configured to produce multiple effector molecules. For example, the nucleic acid can be configured to produce 2-20 different effector molecules. In some embodiments, the nucleic acids are configured to produce 2-20, 2-19, 2-18, 2-17, 2-16, 2-15, 2-14, 2-13, 2-12, 2-11, 2-10, 2-9, 2-8, 2-7, 2-6, 2-5, 2-4, 2-3, 3-20, 3-19, 3-18, 3-17, 3-16, 3-15, 3-14, 3-13, 3-12, 3-11, 3-10, 3-9, 3-8, 3-7, 3-6, 3-5, 3-4, 4-20, 4-19, 4-18, 4-17 , 4-16, 4-15, 4-14, 4-13, 4-12, 4-11, 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-20, 5-19, 5-18, 5-17, 5-16, 5-15, 5-14, 5-13, 5-12, 5-11, 5-10, 5-9, 5-8, 5-7, 5-6, 6-20, 6-19, 6-18, 6-17, 6-16, 6-15, 6-14, 6-13, 6-12, 6-11, 6-10, 6-9, 6-8, 6-7, 7-20, 7-19, 7-18, 7-17, 7-16, 7-15, 7-14, 7-13, 7-12, 7-11, 7-10, 7-9, 7-8, 8-20, 8-19, 8-18, 8-17, 8-16, 8-15, 8-14, 8-13, 8-12, 8-11, 8-10, 8-9, 9-20, 9-19, 9-18, 9-17, 9-16, 9-15, 9-14, 9-13, 9-12, 9-11, 9-10, 10-20, 10-19, 10-18, 10 -17, 10-16, 10-15, 10-14, 10-13, 10-12, 10-11, 11-20, 11-19, 11-18, 11-17, 11-16, 11-15, 11-14, 11-13, 11-12, 12-20, 12-19, 12-18, 12-17, 12-16, 12-15, 12-14, 12-13, 13-20, 13-19, 13-18, 13-17, 13-16, 13-15, 13-14, 14-20, 14-19, 14-18,In some embodiments, the nucleic acid is configured to produce 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 effector molecules.

[0213] In some embodiments, the engineered nucleic acid can be a polycistronic, that is, more than one separate polypeptide (e.g., multiple exogenous polynucleotides or effector molecules) can be produced from a single mRNA transcript. By using various linkers, the engineered nucleic acid can be a polycistronic, for example, a polynucleotide sequence encoding a first exogenous polynucleotide or effector molecule can be connected to a nucleotide sequence encoding a second exogenous polynucleotide or effector molecule, such as in the first gene: linker: second gene 5' to 3' direction. The linker polynucleotide sequence can encode a 2A ribosomal skipping element, such as T2A. Other 2A ribosomal skipping elements include but are not limited to E2A, P2A and F2A. The 2A ribosomal skipping element allows the production of separate polypeptides encoded by the first gene and the second gene during translation. The linker can encode a cleavable linker polypeptide sequence, such as a furin cleavage site or a TEV cleavage site, wherein the cleavable linker polypeptide is cleaved after expression, thereby producing a separate polypeptide encoded by the first gene and the second gene. The cleavable linker can include a polypeptide sequence that further promotes cleavage, such as such a flexible linker (e.g., a Gly-Ser-Gly sequence).

[0214] In some embodiments, when the second expression cassette comprises two or more (L1-E) X When the L1 linker polynucleotide sequence is expressed as a single polypeptide, it is operably associated with the translation of each effector molecule.

[0215] The linker may encode an internal ribosome entry site (IRES) so that separate polypeptides encoded by the first gene and the second gene are produced during translation. The linker may encode a splice acceptor, such as a viral splice acceptor.

[0216] The joint can be a combination of joints, such as furin-2A joints, which can jump through the 2A ribosome, and then further cut the furin site to allow the 2A residue to be completely removed to produce a single polypeptide. In certain embodiments, the combination of joints can include a furin sequence, a flexible joint and a 2A joint. Therefore, in certain embodiments, the joint is a furin-Gly-Ser-Gly-2A fusion polypeptide. In certain embodiments, the joint is a furin-Gly-Ser-Gly-T2A fusion polypeptide.

[0217] In general, polycistronic systems can use any number of linkers or combinations of linkers to express any number of genes or portions thereof (e.g., an engineered nucleic acid can encode a first effector molecule, a second effector molecule, and a third effector molecule, each separated by a linker, such that separate polypeptides encoded by the first effector molecule, the second effector molecule, and the third effector molecule are produced).

[0218] As used herein, a "linker" may refer to a polypeptide connecting a first polypeptide sequence and a second polypeptide sequence or the above-mentioned multicistronic linker.

[0219] Effector molecules

[0220] Any suitable effector molecule known in the art can be encoded by an engineered nucleic acid or expressed by an engineered cell. Suitable effector molecules can be grouped into therapeutic categories based on structural similarity, sequence similarity, or function. Effector molecule therapeutic categories include, but are not limited to, cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, polynucleotides, peptides, and enzymes.

[0221] In some embodiments, each effector molecule is independently selected from a therapeutic class, wherein the therapeutic class is selected from: cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, polynucleotides, peptides and enzymes.

[0222] In some embodiments, each effector molecule is independently selected from a therapeutic class, wherein the therapeutic class is selected from: cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides, and enzymes.

[0223] In certain embodiments, the effector molecule is a chemokine.Chemokines are small molecule cytokines or signal transduction proteins secreted by cells, which can induce directional chemotaxis in cells.Chemokines can be divided into four main subfamilies: CXC, CC, CX3C and XC, all of which play biological roles by selectively binding to chemokine receptors located on the surface of target cells.Non-limiting examples of chemokines that can be encoded by the engineered nucleic acids of the present disclosure include: CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion proteins, CCL19, CXCL9 and XCL1 or any combination thereof.In certain embodiments, chemokines are selected from: CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion proteins, CCL19, CXCL9 and XCL1.

[0224] In some embodiments, the effector molecule is a cytokine. Non-limiting examples of cytokines that can be encoded by the engineered nucleic acids of the present disclosure include: IL1-β, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-γ and TNF-α or any combination thereof. In some embodiments, the cytokine is selected from: IL1-β, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-γ and TNF-α.

[0225] In some embodiments, engineered nucleic acids are configured to produce at least one homing molecule. "Homing" refers to active navigation (migration) of cells to a target site (e.g., cells, tissues (e.g., tumors) or organs). "Homing molecules" refer to molecules that guide cells to a target site. In some embodiments, the function of a homing molecule is to identify and / or trigger the interaction of engineered cells with a target site. Non-limiting examples of homing molecules include CXCR1, CCR9, CXCR2, CXCR3, CXCR4, CCR2, CCR4, FPR2, VEGFR, IL6R, CXCR1, CSCR7, PDGFR, anti-integrin α4, β7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15, or any combination thereof. In some embodiments, the homing molecule is selected from: anti-integrin α4, β7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15.

[0226] In some embodiments, the engineered nucleic acid is configured to produce at least one growth factor. Suitable growth factors for use as effector molecules include, but are not limited to, FLT3L and GM-CSF, or any combination thereof. In some embodiments, the growth factor is selected from: FLT3L and GM-CSF.

[0227] In some embodiments, the engineered nucleic acid is configured to produce at least one co-activator molecule. Suitable co-activator molecules used as effector molecules include but are not limited to c-Jun, 4-1BBL and CD40L, or any combination thereof. In some embodiments, the co-activator molecule is selected from: c-Jun, 4-1BBL and CD40L.

[0228] The "tumor microenvironment" is the cellular environment in which the tumor exists, including surrounding blood vessels, immune cells, fibroblasts, bone marrow-derived inflammatory cells, lymphocytes, signaling molecules and extracellular matrix (ECM) (see, for example, Pattabiraman, DR and Weinberg, RA Nature Reviews Drug Discovery 13, 497–512 (2014); Balkwill, FR et al. J Cell Sci 125, 5591-5596, 2012; and Li, H. et al. J Cell Biochem 101 (4), 805-15, 2007). Suitable tumor microenvironment modifiers used as effector molecules include but are not limited to adenosine deaminase, TGFβ inhibitors, immune checkpoint inhibitors, VEGF inhibitors and HPGE2, or any combination thereof. In some embodiments, the tumor microenvironment modifier is selected from: adenosine deaminase, TGFβ inhibitors, immune checkpoint inhibitors, VEGF inhibitors and HPGE2.

[0229] In some embodiments, the engineered nucleic acid is configured to produce at least one TGFβ inhibitor. Suitable TGFβ inhibitors used as effector molecules include but are not limited to anti-TGFβ peptides, anti-TGFβ antibodies, TGFb-TRAP or a combination thereof. In some embodiments, the TGFβ inhibitor is selected from: anti-TGFβ peptides, anti-TGFβ antibodies, TGFb-TRAP and a combination thereof.

[0230] In some embodiments, the engineered nucleic acid is configured to produce at least one immune checkpoint inhibitor. Suitable immune checkpoint inhibitors used as effector molecules include but are not limited to anti-PD-1 antibodies, anti-PD-L1 antibodies, anti-PD-L2 antibodies, anti-CTLA-4 antibodies, anti-LAG-3 antibodies, anti-TIM-3 antibodies, anti-TIGIT antibodies, anti-VISTA antibodies, anti-KIR antibodies, anti-B7-H3 antibodies, anti-B7-H4 antibodies, anti-HVEM antibodies, anti-BTLA antibodies, anti-GAL9 antibodies, anti-A2AR antibodies, anti-phosphatidylserine antibodies, anti-CD27 antibodies, anti-TNFa antibodies, anti-TREM1 antibodies and anti-TREM2 antibodies or any combination thereof. In some embodiments, the immune checkpoint inhibitor is selected from: anti-PD-1 antibody, anti-PD-L1 antibody, anti-PD-L2 antibody, anti-CTLA-4 antibody, anti-LAG-3 antibody, anti-TIM-3 antibody, anti-TIGIT antibody, anti-VISTA antibody, anti-KIR antibody, anti-B7-H3 antibody, anti-B7-H4 antibody, anti-HVEM antibody, anti-BTLA antibody, anti-GAL9 antibody, anti-A2AR antibody, anti-phosphatidylserine antibody, anti-CD27 antibody, anti-TNFa antibody, anti-TREM1 antibody and anti-TREM2 antibody.

[0231] Illustrative immune checkpoint inhibitors include pembrolizumab (anti-PD-1; MK-3475 / -Merck), nivolumab (anti-PD-1; -BMS), pidilizumab (anti-PD-1 antibody; CT-011–Teva / CureTech), AMP224 (anti-PD-1; NCI), avelumab (anti-PD-L1; -Pfizer), durvalumab (anti-PD-L1; MEDI4736 / -Medimmune / AstraZeneca), atezolizumab (anti-PD-L1; -Roche / Genentech), BMS-936559 (anti-PD-L1-BMS), tremelimumab (anti-CTLA-4; Medimmune / AstraZeneca), ipilimumab (anti-CTLA-4; -BMS), lirelumab (anti-KIR; BMS), and monalizumab (anti-NKG2A; Innate Pharma / AstraZeneca).

[0232] In some embodiments, the engineered nucleic acid is configured to produce at least one VEGF inhibitor. Suitable VEGF inhibitors for use as effector molecules include, but are not limited to, anti-VEGF antibodies, anti-VEGF peptides, or combinations thereof. In some embodiments, the VEGF inhibitors include anti-VEGF antibodies, anti-VEGF peptides, or combinations thereof.

[0233] In some embodiments, each effector molecule is a human-derived effector molecule.

[0234] secretion signal

[0235] In general, one or more effector molecules include a secretion signal peptide (also referred to as a signal peptide or signal sequence) at the N-terminus of the effector molecule that directs newly synthesized proteins destined for secretion or membrane insertion to the appropriate protein processing pathway. In embodiments utilizing two or more effector molecules, each effector molecule may include a secretion signal (S). In embodiments utilizing two or more effector molecules, each effector molecule may include a secretion signal that causes each effector molecule to be secreted from the engineered cell. In embodiments comprising one or more (LE) X The second expression cassette of the unit further comprises a polynucleotide sequence encoding a secretion signal peptide (S). In embodiments, for each X, the corresponding secretion signal peptide is operably associated with an effector molecule. In embodiments, the second expression cassette comprises an ACP-responsive promoter and a second exogenous polynucleotide sequence having the formula: (LSE) X .

[0236] The secretion signal peptide operably associated with the effector molecule can be a natural secretion signal peptide natural secretion signal peptide (e.g., a secretion signal peptide that is generally endogenously associated with a given effector molecule). The secretion signal peptide operably associated with the effector molecule can be a non-natural secretion signal peptide natural secretion signal peptide. Non-natural secretion signal peptides can promote improved expression and function, such as maintaining secretion in a specific environment (such as a tumor microenvironment). Non-limiting examples of non-natural secretion signal peptides are shown in Table 3.

[0237] Table 3. Exemplary signal secretion peptides

[0238]

[0239]

[0240]

[0241] Antigen recognition receptor

[0242] Certain aspects of the present disclosure relate to an engineered nucleic acid comprising an antigen recognition receptor. In some embodiments, the engineered nucleic acid of the present disclosure comprises a first expression cassette, which further comprises an antigen recognition receptor. In some embodiments, the first expression cassette comprises a polynucleotide sequence encoding an antigen recognition receptor operably connected to a first exogenous polynucleotide sequence encoding an ACP and a first promoter. Suitable antigen recognition receptors used as effector molecules to recognize antigens include but are not limited to 5T4, ADAM9, AFP, AXL, B7-H3, B7-H4, B7-H6, C4.4, CA6, Cadherin 3, Cadherin 6, CCR4, CD123, CD133, CD138, CD142, CD166, CD25, CD30, CD352, CD37, CD38, CD44, CD56, CD66e, CD70, CD71, CD74, CD79b, CD80, CEA, CEACAM5, Claud in18.2, cMet, CSPG4, CTLA, DLK1, DLL3, DR5, EGFR, ENPP3, EpCAM, EphA2, ephrin A4, ETBR, FGFR2, FGFR3, FRα, FRb, GCC, GD2, GFRa4, gpA33, GPC3, gpNBM, GPRC5, HER2, IL-13R, IL-13Ra, IL-13Ra2, IL-8, IL-15, IL1RAP, integrin aV, KIT, L1CAM, LAMP1, Lewis Y, LeY, LIV-1, LRRC, LY6E, MCSP, mesothelin (MSLN), MUC1, MUC16, MUC1C, NaPi2B, adhesion protein 4, NKG2D, NOTCH3, NY ESO 1, ovarian hormone, P-cadherin, pan-Erb2, PSCA, PSMA, PTK7, ROR1, Staphylococcus aureus (S Aures), SCT, SLAMF7, SLITRK6, SSTR2, STEAP1, survivin, TDGF1, TIM1, TROP2 and WT1, or any combination thereof.

[0243] In some embodiments, the antigen recognition receptor recognizes an antigen selected from the group consisting of: 5T4, ADAM9, AFP, AXL, B7-H3, B7-H4, B7-H6, C4.4, CA6, Cadherin 3, Cadherin 6, CCR4, CD123, CD133, CD138, CD142, CD166, CD25, CD30, CD352, CD37, CD38, CD44, CD56, CD66e, CD70, CD71, CD74, CD79b, CD80, CEA, CEACAM5, Claudin18.2, cMet, CSPG4, CTLA, DLK1, DLL3, DR5, EG FR, ENPP3, EpCAM, EphA2, ephrin A4, ETBR, FGFR2, FGFR3, FRα, FRb, GCC, GD2, GFRa4, gpA33, GPC3, gpNBM, GPRC5, HER2, IL-13R, IL-13Ra, IL-13Ra2, IL-8, IL-15, IL1RAP, integrin aV, KIT, L1CAM, LAMP1, LewisY, LeY, LIV-1, LRRC, LY6E, MCSP, mesothelin, MUC1, MUC16, MUC1C, NaPi2B, adhesion protein 4, NKG2D, NOTCH3, NY ESO 1, ovarin, P-cadherin, pan-Erb2, PSCA, PSMA, PTK7, ROR1, Staphylococcus aureus (SAures), SCT, SLAMF7, SLITRK6, SSTR2, STEAP1, survivin, TDGF1, TIM1, TROP2, and WT1.

[0244] In some embodiments, the first expression cassette further comprises a linker polynucleotide sequence located between the ACP and the antigen recognition receptor.

[0245] In some embodiments, the antigen recognition receptor includes an antigen binding domain. In some embodiments, the antigen binding domain includes an antibody, an antigen binding fragment of an antibody, a F(ab) fragment, a F(ab') fragment, a single chain variable fragment (scFv) or a single domain antibody (sdAb). In some embodiments, the antigen binding domain includes a single chain variable fragment (scFv). In some embodiments, the scFv includes a heavy chain variable domain (VH) and a light chain variable domain (VL). In some embodiments, VH and VL are separated by a peptide linker.

[0246] scFv has a variable domain of a light chain (VL) connected from its C-terminus to the N-terminus of a heavy chain (VH) variable domain via a polypeptide chain. Alternatively, scFv comprises a polypeptide chain in which the C-terminus of VH is connected to the N-terminus of VL via a polypeptide chain. In some embodiments, scFv comprises the structure VH-L-VL or VL-L-VH, wherein VH is a heavy chain variable domain, L is a peptide linker, and VL is a light chain variable domain.

[0247] An sdAb is a molecule in which one variable domain of an antibody specifically binds to an antigen in the absence of the other variable domain.

[0248] The F(ab) fragment contains the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain and the variable domains VL and VH on the light chain and heavy chain, respectively. The F(ab') fragment differs from the Fab fragment in that some residues are added at the carboxyl terminus of the heavy chain CH1 domain, including one or more cysteines from the antibody hinge region. The F(ab')2 fragment contains two Fab' fragments connected by a disulfide bond near the hinge region.

[0249] In some embodiments, the antigen recognition receptor is a chimeric antigen receptor (CAR) or a T cell receptor (TCR). In some embodiments, the antigen recognition receptor is a CAR. In some embodiments, CAR includes one or more intracellular signaling domains, and the one or more intracellular signaling domains are selected from: CD3 ζ chain intracellular signaling domain, CD97 intracellular signaling domain, CD11a-CD18 intracellular signaling domain, CD2 intracellular signaling domain, ICOS intracellular signaling domain, CD27 intracellular signaling domain, CD154 intracellular signaling domain, CD8 intracellular signaling domain, OX40 intracellular signaling domain, 4-1BB intracellular signaling domain, CD28 intracellular signaling domain, ZAP40 intracellular signaling domain, CD30 intracellular signaling domain, GITR intracellular signaling domain, HVEM intracellular signaling domain, DAP10 intracellular signaling domain, DAP12 intracellular signaling domain and MyD88 intracellular signaling domain. In some embodiments, the CAR comprises a CD3 zeta chain intracellular signaling domain and one or more additional intracellular signaling domains (e.g., co-stimulatory domains) selected from the group consisting of a CD97 intracellular signaling domain, a CD11a-CD18 intracellular signaling domain, a CD2 intracellular signaling domain, an ICOS intracellular signaling domain, a CD27 intracellular signaling domain, a CD154 intracellular signaling domain, a CD8 intracellular signaling domain, an OX40 intracellular signaling domain, a 4-1BB intracellular signaling domain, a CD28 intracellular signaling domain, a ZAP40 intracellular signaling domain, a CD30 intracellular signaling domain, a The intracellular signaling domain comprises a mitogen-activated protein kinase (IMG) domain, a mitogen-activated protein kinase (IMG) domain, a mitogen-activated protein kinase (AKT) domain, a mitogen-activated protein kinase (AKT) domain, a mitogen-activated protein kinase (AKS) domain, a mitogen-activated protein kinase (AKS) domain, a mitogen-activated protein kinase (AKS) domain, a mitogen-activated protein kinase (AKT ...T) domain, a mitogen-activated protein kinase (AKS) domain, a mitogen-activated protein kinase (AKT) domain, a mitogen-activated protein kinase (AKT) domain, a

[0250] In some embodiments, CAR further comprises a transmembrane domain, and the transmembrane domain is selected from the group consisting of a CD8 transmembrane domain, a CD28 transmembrane domain, a CD3 zeta chain transmembrane domain, a CD4 transmembrane domain, a 4-1BB transmembrane domain, an OX40 transmembrane domain, an ICOS transmembrane domain, a CTLA-4 transmembrane domain, a PD-1 transmembrane domain, a LAG-3 transmembrane domain, a 2B4 transmembrane domain, a BTLA transmembrane domain, an OX40 transmembrane domain, a DAP10 transmembrane domain, a DAP12 transmembrane domain, a CD16a transmembrane domain, a DNAM-1 transmembrane domain, a KIR2DS1 transmembrane domain, a KIR3DS1 transmembrane domain, a NKp44 transmembrane domain, a NKp46 transmembrane domain, a FceRlg transmembrane domain, and a NKG2D transmembrane domain.

[0251] In some embodiments, CAR further includes a spacer region (e.g., hinge domain) between the antigen binding domain and the transmembrane domain. Spacers or hinge domains are any oligopeptides or polypeptides that act by connecting the transmembrane domain to the extracellular domain and / or intracellular signaling domain in the polypeptide chain. Spacers or hinge domains provide flexibility for inhibitory chimeric receptors or tumor-targeted chimeric receptors or their domains, or prevent steric hindrance of inhibitory chimeric receptors or tumor-targeted chimeric receptors or their domains. In some embodiments, spacer region domains or hinge domains may include up to 300 amino acids (e.g., 10 to 100 amino acids, or 5 to 20 amino acids). In some embodiments, one or more spacer domains may be included in other regions of inhibitory chimeric receptors or tumor-targeted chimeric receptors.

[0252] Exemplary spacers or hinge domains can include, but are not limited to, IgG domains (such as IgG1 hinges, IgG2 hinges, IgG3 hinges, or IgG4 hinges), IgD hinge domains, CD8α hinge domains, and CD28 hinge domains. In some embodiments, the spacer or hinge domain is an IgG domain, an IgD domain, a CD8α hinge domain, or a CD28 hinge domain.

[0253] Exemplary spacer or hinge domain protein sequences are shown in Table 4. Exemplary spacer or hinge domain nucleotide sequences are shown in Table 5.

[0254]

[0255]

[0256]

[0257] Suitable transmembrane domains, spacer or hinge domains, and intracellular domains for CARs are generally described in Stoiber et al., Cells 2019, 8(5), 472; Guedan et al., Mol Therapy: Met & Clinic Dev, 2019 12: 145-156; and Sadelain et al., Cancer Discov; 2013, 3(4); 388–98, each of which is hereby incorporated by reference in its entirety.

[0258] In some embodiments, the CAR further comprises a secretion signal peptide. Any suitable secretion signal peptide of the present disclosure can be used.

[0259] Post-transcriptional regulatory elements

[0260] In some embodiments, the engineered nucleic acids of the present disclosure include a post-transcriptional regulatory element (PRE). PRE can enhance gene expression by achieving tertiary RNA structural stability and 3' end formation. Non-limiting examples of PRE include hepatitis B virus PRE (HPRE) and woodchuck hepatitis virus PRE (WPRE). In some embodiments, the post-transcriptional regulatory element is a woodchuck hepatitis virus post-transcriptional regulatory element (WPRE). In some embodiments, WPRE includes α, β and γ components of the WPRE element. In some embodiments, WPRE includes the α component of the WPRE element.

[0261] Immune response cells

[0262] Certain aspects of the present disclosure relate to cells (such as immune response cells) that have been genetically engineered to include one or more chimeric receptors of the present disclosure or one or more polynucleotides encoding such chimeric receptors, and to methods of using such cells to treat solid tumors.

[0263] In some embodiments, the cell is a mammalian cell. In some embodiments, the mammalian cell is a primary cell. In some embodiments, the mammalian cell is a cell line. In some embodiments, the mammalian cell is a bone marrow cell, a blood cell, a skin cell, a bone cell, a muscle cell, a neuronal cell, a fat cell, a liver cell or a heart cell. In some embodiments, the cell is a stem cell. Exemplary stem cells include, but are not limited to, embryonic stem cells (ESC), induced pluripotent stem cells (iPSC), adult stem cells and tissue-specific stem cells, such as hematopoietic stem cells (blood stem cells), mesenchymal stem cells (MSC), neural stem cells, epithelial stem cells or skin stem cells. In some embodiments, the cell is a cell derived or differentiated from stem cells of the present disclosure. In some embodiments, the cell is an immune cell. The immune cells of the present disclosure can be separated or differentiated from stem cells of the present disclosure (e.g., by ESC or iPSC). Exemplary immune cells include, but are not limited to, T cells (e.g., helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, autologous killer T cells, αβT cells and γδT cells), B cells, natural killer (NK) cells, dendritic cells, myeloid cells, macrophages and monocytes. In some embodiments, the cell is a neuronal cell. The neuronal cell of the present disclosure can be separated or differentiated by stem cells of the present disclosure (e.g., by ESC or iPSC). Exemplary neuronal cells include but are not limited to neural progenitor cells, neurons (e.g., sensory neurons, motor neurons, cholinergic neurons, GABAergic neurons, glutamatergic neurons, dopaminergic neurons, or serotonergic neurons), astrocytes, oligodendrocytes, and microglia.

[0264] In some embodiments, the cell is an immune response cell. The immune response cells of the present disclosure can be separated or differentiated from the stem cells of the present disclosure (e.g., from ESC or iPSC). Exemplary immune response cells of the present disclosure include, but are not limited to, lymphoid lineage cells. Lymphoid lineages (including B cells, T cells, and natural killer (NK) cells) provide the production of antibodies, the regulation of the cellular immune system, the detection of foreign substances in the blood, the detection of host foreign cells, and the like. Examples of immune response cells of lymphoid lineages include, but are not limited to, T cells, natural killer (NK) cells, embryonic stem cells, pluripotent stem cells, and induced pluripotent stem cells (e.g., those stem cells from which lymphoid cells can be derived or differentiated). T cells can be lymphocytes that mature in the thymus and are primarily responsible for cell-mediated immunity. T cells are involved in the adaptive immune system. In some embodiments, the T cells of the present disclosure can be any type of T cells, including, but not limited to, T helper cells, cytotoxic T cells, memory T cells (including central memory T cells, stem cell-like memory T cells (or stem cell-like memory T cells) and two types of effector memory T cells: for example, T EM Cells and TEMRA T cells, regulatory T cells (also known as suppressor T cells), natural killer T cells, mucosa-associated invariant T cells, and gamma delta T cells. Cytotoxic T cells (CTLs or killer T cells) are a subset of T lymphocytes that are able to induce the death of infected somatic or tumor cells. A patient's own T cells can be genetically modified to target specific antigens by the introduction of one or more chimeric receptors (such as chimeric TCRs or CARs).

[0265] Natural Killer (NK) cells may be lymphocytes that function as part of cell-mediated immunity and during the innate immune response. NK cells do not require prior activation in order to perform their cytotoxic effects on target cells.

[0266] In some embodiments, the immune response cells of the present disclosure are T cells. The T cells of the present disclosure can be autologous, allogeneic, or derived in vitro from engineered progenitor cells or stem cells.

[0267] In some embodiments, the immune response cells of the present disclosure are universal T cells lacking TCR-αβ. In the art, methods for developing universal T cells are described in, for example, Valton et al., Molecular Therapy (2015); 23 9, 1507-1518, and Torikai et al., Blood 2012 119: 5697-5705.

[0268] In some embodiments, the immune response cells of the present disclosure are isolated immune response cells comprising one or more chimeric receptors of the present disclosure. In some embodiments, the immune response cells comprise one or more, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten or more chimeric receptors of the present disclosure.

[0269] In some embodiments, the immune response cell is a T cell. In some embodiments, the immune response cell is a natural killer (NK) cell.

[0270] In some embodiments, immune response cells express or can express immune receptors.Immunoreceptors are generally capable of inducing changes in signal transduction or protein expression in cells expressing immune receptors, thereby regulating immune responses (e.g., regulation, activation, activation, stimulation, increase, prevention, weakening, inhibition, reduction, reduction, obstruction or suppression of immune responses) when bound to cognate ligands. For example, when CD3 chains are present in TCR / CAR clusters in response to ligand binding, signal transduction cascades mediated by activation motifs (ITAM) based on immune receptor tyrosine are generated. Specifically, in certain embodiments, when endogenous TCR, exogenous TCR, chimeric TCR or CAR (specifically activating CAR) are bound to their corresponding antigens, immune synapses are formed, and the formation of the immune synapses is included in the binding of receptors (e.g., CD4 or CD8, CD3γ / δ / ε / ζ, etc.) near the aggregation of many molecules. The aggregation of such membrane-bound signal transduction molecules allows the ITAM motifs included in the CD3 chains to be phosphorylated, and then T cell activation pathways can be initiated and transcription factors (such as NF-κΒ and AP-1) can be finally activated. These transcription factors are able to induce global gene expression in T cells to increase IL-2 production, thereby promoting proliferation and expression of master regulatory T cell proteins, thereby initiating T cell-mediated immune responses such as cytokine production and / or T cell-mediated killing.

[0271] Cells expressing multiple chimeric antigen receptors

[0272] In some embodiments, the cell of the present disclosure (e.g., immune response cell) includes two or more chimeric receptors of the present disclosure. In some embodiments, the cell includes two or more chimeric receptors, wherein the first chimeric receptor in the two or more chimeric receptors is an activating chimeric receptor, and the second chimeric receptor in the two or more chimeric receptors is a chimeric inhibitory receptor. In some embodiments, the cell includes a first activating chimeric receptor and a second activating chimeric receptor. In some embodiments, the cell includes three or more chimeric receptors, wherein at least one chimeric receptor in the three or more chimeric receptors is an activating chimeric receptor. In some embodiments, the cell includes three or more chimeric receptors, wherein at least one chimeric receptor in the three or more chimeric receptors is a chimeric inhibitory receptor. In some embodiments, the cell includes four or more chimeric receptors. In some embodiments, the cell includes five or more chimeric receptors.

[0273] In some embodiments, each of the two or more chimeric receptors comprises, for example, different antigen binding domains that bind to the same antigen or different antigens. In some embodiments, each antigen bound by two or more chimeric receptors is expressed on the same cell, such as an epithelial cell type (e.g., the same epithelial cell type).

[0274] In embodiments where a cell (e.g., an immune response cell) of the present disclosure expresses two or more different chimeric receptors, the antigen binding domain of each of the different chimeric receptors can be designed so that the antigen binding domains do not interact with each other. For example, a cell (e.g., an immune response cell) of the present disclosure that expresses a first chimeric receptor and a second chimeric receptor can include a first chimeric receptor that includes an antigen binding domain that does not associate with an antigen binding domain of a second chimeric receptor. For example, the antigen binding domain of the first chimeric receptor can include an antibody fragment, such as an scFv, and the antigen binding domain of the second chimeric receptor can include a V H H.

[0275] Without wishing to be bound by theory, it is believed that in cells having multiple chimeric membrane-embedded receptors each comprising an antigen binding domain, interactions between the antigen binding domains of each receptor may be undesirable because such interactions may inhibit the ability of one or more of the antigen binding domains to bind to their cognate antigens. Therefore, in embodiments of the present disclosure where cells (e.g., immune response cells) express two or more chimeric receptors, the chimeric receptors include antigen binding domains that minimize such inhibitory interactions. In one embodiment, the antigen binding domain of one chimeric receptor includes an scFv, and the antigen binding domain of the second chimeric receptor includes a single VH domain, such as a single VH domain of a camel, shark, or lamprey, or a single VH domain derived from a human or mouse sequence.

[0276] In some embodiments, when present on the surface of a cell, the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen is not substantially reduced by the presence of the second chimeric receptor. In some embodiments, the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen in the presence of the second chimeric receptor is 85%, 90%, 95%, 96%, 97%, 98% or 99% of the binding of the antigen binding domain of the first chimeric receptor to its cognate antigen in the absence of the second chimeric receptor. In some embodiments, when present on the surface of a cell, the antigen binding domains of the first chimeric receptor and the second chimeric receptor associate with each other to a lesser extent than when both are scFv antigen binding domains. In some embodiments, the antigen binding domains of the first chimeric receptor and the second chimeric receptor associate with each other to a lesser extent than when both are scFv antigen binding domains 85%, 90%, 95%, 96%, 97%, 98% or 99% less than when both are scFv antigen binding domains.

[0277] Co-stimulatory ligand

[0278] In some embodiments, the cell of the present disclosure (e.g., immune response cell) may further include one or more recombinant or exogenous costimulatory ligands. For example, the cell can be further transduced with one or more costimulatory ligands so that the cell co-expresses or is induced to co-express one or more chimeric receptors and one or more costimulatory ligands. Without wishing to be bound by theory, it is believed that the interaction between one or more chimeric receptors and one or more costimulatory ligands can provide non-antigen specific signals important for the complete activation of cells. The example of suitable costimulatory ligands includes but is not limited to tumor necrosis factor (TNF) superfamily members and immunoglobulin (Ig) superfamily ligands. TNF is a cytokine involved in systemic inflammation and stimulates acute phase reactions. Its main function is to regulate immune cells. Members of the TNF superfamily have many common features. Most TNF superfamily members are synthesized as type II transmembrane proteins (extracellular C-terminals) containing short cytoplasmic segments and relatively long extracellular regions. Examples of suitable TNF superfamily members include, but are not limited to, nerve growth factor (NGF), CD40L (CD40L) / CD 154, CD137L / 4-1BBL, TNF-α, CD134L / OX40L / CD252, CD27L / CD70, Fas ligand (FasL), CD30L / CD153, tumor necrosis factor β (TNFP) / lymphotoxin α (LTa), lymphotoxin β (LTP), CD257 / B cell activating factor (BAFF) / Blys / THANK / Tall-1, glucocorticoid-induced TNF receptor ligand (GITRL) and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF 14). The immunoglobulin (Ig) superfamily is a large group of cell surface soluble proteins that participate in the recognition, binding or adhesion processes of cells. These proteins share structural features with immunoglobulins and have immunoglobulin domains (folds). Examples of suitable immunoglobulin superfamily ligands include, but are not limited to, CD80 and CD86 (both of which are ligands for CD28), PD-L1 / (B7-H1) (which is a ligand for PD-1). In certain embodiments, one or more co-stimulatory ligands are selected from 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof.

[0279] In some embodiments, cells of the present disclosure (eg, immune response cells) include one or more recombinant or exogenous co-stimulatory ligands regulated by an engineered CCL3 promoter described herein, eg, an engineered CCL-3 promoter from Table 1. In certain embodiments, TNF superfamily members (e.g., nerve growth factor (NGF), CD40L (CD40L) / CD154, CD137L / 4-1BBL, TNF-α, CD134L / OX40L / CD252, CD27L / CD70, Fas ligand (FasL), CD30L / CD153, tumor necrosis factor β (TNFP) / lymphotoxin α (LTa), lymphotoxin β (LTP), CD257 / B cell activating factor (BAFF) / Blys / THANK / Tall-1, glucocorticoid-inducible TNF receptor ligand (GITRL) and TNF-related apoptosis-inducing ligand (TRAIL), LIGHT (TNFSF 14)) are regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1. In certain embodiments, Ig superfamily member ligands (e.g., CD80, CD86, PD-L1, and B7-H1) are regulated by an engineered CCL3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1. In certain embodiments, co-stimulatory ligands (e.g., 4-1BBL, CD80, CD86, CD70, OX40L, CD48, TNFRSF14, PD-L1, and combinations thereof) are regulated by an engineered CCL-3 promoter described herein, e.g., an engineered CCL-3 promoter from Table 1.

[0280] Chemokine receptors

[0281] In certain embodiments, the cell (for example, immune response cell) of the present disclosure includes one or more chimeric receptors and may further include one or more chemokine receptors. For example, the transgenic expression of chemokine receptor CCR2b or CXCR2 in cells such as T cells enhances the transportation of solid tumors secreting CCL2 or CXCL1 (Craddock et al., Journal of Immunotherapy (JImmunother.) October 2010; 33 (8): 780-8, and Kershaw et al., Human Gene Therapy (Hum Gene Ther.) November 1, 2002; 13 (16): 1971-80). It is not desirable to be bound by theory, it is believed that the chemokine receptors expressed on cells expressing chimeric receptors of the present disclosure can recognize chemokines secreted by tumors and improve cell targeting to tumors, which can promote cell infiltration into tumors and enhance the anti-tumor efficacy of cells. The chemokine receptors of the present disclosure may include naturally occurring chemokine receptors, recombinant chemokine receptors or their chemokine binding fragments. Examples of suitable chemokine receptors that can be expressed on the cells of the present disclosure include, but are not limited to, CXC chemokine receptors, such as CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, or CXCR7; CC chemokine receptors, such as CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, or CCR11; CX3C chemokine receptors, such as CX3CR1; XC chemokine receptors, such as XCR1; and chemokine binding fragments thereof. In some embodiments, the chemokine receptor to be expressed on the cell is selected based on the chemokines secreted by the tumor.

[0282] In some embodiments, the cells of the present disclosure (e.g., immune response cells) include one or more chemokine receptors regulated by the engineered CCL3 promoter described herein, for example, the engineered CCL-3 promoter from Table 1. Examples of such chemokine receptors include, for example, but not limited to, CXC chemokine receptors, such as CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, or CXCR7; CC chemokine receptors, such as CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, or CCR11; CX3C chemokine receptors, such as CX3CR1; XC chemokine receptors, such as XCR1; and chemokine binding fragments thereof. In certain embodiments, the chemokine receptors regulated by the engineered CCL3 promoter described herein are selected based on the chemokines secreted by the tumor, for example, the engineered CCL-3 promoter from Table 1.

[0283] Chimeric receptor regulation

[0284] Some embodiments of the present disclosure relate to regulating one or more chimeric receptor activities of cells expressing chimeric receptors of the present disclosure. There are several methods that can regulate chimeric receptor activity. In some embodiments, adjustable chimeric receptors may be required, wherein one or more chimeric receptor activities can be controlled to optimize the safety and / or efficacy of chimeric receptor therapy. For example, the use of caspase fused to a dimerization domain to induce apoptosis (see, e.g., Di et al., New England Journal of Medicine (N Engl. J. Med.) November 3, 2011; 365(18): 1673-1683) can be used as a safety switch in chimeric receptor therapy. In some embodiments, the cells expressing the chimeric receptor of the present disclosure may also express inducible caspase-9 (iCaspase-9) which induces caspase-9 activation and leads to cell apoptosis after administration of a dimerizing drug such as rimiducid (IUPAC name: [(1R)-3-(3,4-dimethoxyphenyl)-1-[3-[2-[2-[2-[3-[(1R)-3-(3,4-dimethoxyphenyl)-1-[(2S)-1-[(2S)-2-(3,4,5-trimethoxyphenyl)butanoyl]piperidine-2-carbonyl]oxypropyl]phenoxy]acetyl]amino]ethylamino]-2-oxoethoxy]phenyl]propyl](2S)-1-[(2S)-2-(3,4,5-trimethoxyphenyl)butanoyl]piperidine-2-carboxylate). In some embodiments, iCaspase-9 contains a binding domain comprising a chemical dimerization inducer (CID) that mediates dimerization in the presence of the CID, which results in inducible and selective depletion of cells expressing the chimeric receptor.

[0285] Alternatively, in some embodiments, the chimeric receptors of the present invention can be regulated by using small molecules or antibodies that inactivate or otherwise inhibit the activity of the chimeric receptor. For example, antibodies can deplete cells expressing chimeric receptors by inducing antibody-dependent cell-mediated cytotoxicity (ADCC). In some embodiments, cells expressing chimeric receptors of the present invention can further express antigens recognized by molecules that can induce cell death by ADCC or complement-induced cell death. For example, cells expressing chimeric receptors of the present invention can further express receptors that can be targeted by antibodies or antibody fragments. Examples of suitable receptors that can be targeted by antibodies or antibody fragments include, but are not limited to, EpCAM, VEGFR, integrins (e.g., αvβ3, α4, α13 / 4β3, α4β7, α5β1, αvβ3, αv), TNF receptor superfamily members (e.g., TRAIL-R1 and TRAIL-R2), PDGF receptor, interferon receptor, folate receptor, GPNMB, ICAM-1, HLA-DR, CEA, CA-125, MUC1, TAG-72, IL-6 receptor, 5T4, GD2, GD3, CD2, CD3, CD4, CD 5. CD11, CD11a / LFA-1, CD15, CD18 / ITGB2, CD19, CD20, CD22, CD23 / IgE receptor, CD25, CD28, CD30, CD33, CD38, CD40, CD41, CD44, CD51, CD52, CD62L, CD74, CD80, CD125, CD147 / basigin, CD152 / CTLA-4, CD154 / CD40L, CD195 / CCR5, CD319 / SLAMF7 and EGFR, as well as truncated forms thereof.

[0286] In some embodiments, the chimeric receptor-expressing cells of the present disclosure may also express a truncated epidermal growth factor receptor (EGFR) that lacks signaling capability but retains an epitope recognized by a molecule capable of inducing ADCC (eg, WO2011 / 056894).

[0287] In some embodiments, the cells expressing chimeric receptors of the present invention further comprise a highly expressed tight marker / suicide gene, which combines target epitopes from both CD32 antigen and CD20 antigen in cells expressing chimeric receptors, thereby binding anti-CD20 antibodies (e.g., rituximab), thereby causing selective depletion of cells expressing chimeric receptors by ADCC. Other methods for depleting cells expressing chimeric receptors of the present invention may include, but are not limited to, administering monoclonal anti-CD52 antibodies, which selectively bind to and target cells expressing chimeric receptors to be destroyed by inducing ADCC. In some embodiments, chimeric receptor ligands such as anti-atopic antibodies may be used to selectively target cells expressing chimeric receptors. In some embodiments, the anti-atopic antibodies may cause effector cell activity, such as ADCC or ADC activity. In some embodiments, the chimeric receptor ligands may be further coupled to agents such as toxins that induce cell killing. In some embodiments, cells expressing chimeric receptors of the present invention may further express target proteins recognized by cell depletion agents of the present invention. In some embodiments, the target protein is CD20 and the cell depleting agent is an anti-CD20 antibody. In such embodiments, the cell depleting agent is administered once it is desired to reduce or eliminate cells expressing the chimeric receptor. In some embodiments, the cell depleting agent is an anti-CD52 antibody.

[0288] In some embodiments, the regulated chimeric receptor comprises a set of polypeptides, wherein the components of the chimeric receptor of the present disclosure are distributed on separate polypeptides or members. For example, the set of polypeptides may include a dimerization switch that, in the presence of a dimerizing molecule, allows the polypeptides to couple to each other to form a functional chimeric receptor.

[0289] Polynucleotide constructs encoding chimeric receptors

[0290] Certain aspects of the present disclosure relate to polynucleotides (e.g., isolated polynucleotides) encoding one or more chimeric receptors of the present disclosure. In some embodiments, the polynucleotide is an RNA construct, such as a messenger RNA (mRNA) transcript or a modified RNA. In some embodiments, the polynucleotide is a DNA construct.

[0291] In some embodiments, the polynucleotide encoding of the present disclosure includes one or more antigen binding domains (wherein each domain binds to a target antigen), a transmembrane domain and a chimeric receptor of one or more intracellular signaling domains. In some embodiments, the polynucleotide encoding includes a chimeric receptor of an antigen binding domain, a transmembrane domain, a primary signaling domain (e.g., a CD3-ζ domain) and one or more co-stimulatory signaling domains. In some embodiments, the polynucleotide further includes a nucleic acid sequence encoding a spacer region. In some embodiments, the antigen binding domain is connected to the transmembrane domain by a spacer region. In some embodiments, the nucleic acid further includes a nucleotide sequence encoding a leader sequence.

[0292] The polynucleotides of the present disclosure can be obtained using any suitable recombinant method known in the art, including but not limited to, by screening a collection library from cells expressing the gene of interest, by obtaining the gene of interest from a vector known to contain the gene, or by isolating the gene of interest directly from cells and tissues containing the gene using standard techniques. Alternatively, the gene of interest can be produced synthetically.

[0293] In some embodiments, the polynucleotides of the present disclosure are included in a vector. In some embodiments, the polynucleotides of the present disclosure are expressed in cells via a transposon, a CRISPR / Cas9 system, a TALEN, or a zinc finger nuclease.

[0294] In some embodiments, expression of a polynucleotide encoding a chimeric receptor of the present disclosure can be achieved by operably linking the nucleic acid to a promoter and incorporating the construct into an expression vector. Suitable vectors can replicate and integrate in eukaryotic cells. Typical cloning vectors contain transcription and translation terminators, initiation sequences, and promoters that can be used to regulate expression of the desired nucleic acid.

[0295] In some embodiments, the expression constructs of the present disclosure can also be used for nucleic acid immunization and gene therapy using standard gene delivery protocols (eg, US5399346, US5580859, and US5589466). In some embodiments, the vectors of the present disclosure are gene therapy vectors.

[0296] The polynucleotides of the present disclosure can be cloned into many types of vectors. For example, the polynucleotides can be cloned into vectors including but not limited to plasmids, phage plasmids, phage derivatives, animal viruses or cosmids. In some embodiments, the vector can be an expression vector, a replication vector, a probe generation vector or a sequencing vector.

[0297] In some embodiments, the plasmid vector includes a transposon / transposase system to incorporate the polynucleotides of the present disclosure into the host cell genome. Methods for expressing proteins in immune cells using transposon and transposase plasmid systems are generally described in Chicaybam L, Human Gene Therapy. April 2019; 30(4):511-522. doi:10.1089 / hum.2018.218; and P, Cytotherapy. April 2018; 20(4):507-520. doi:10.1016 / j.jcyt.2017.10.001, each of which is hereby incorporated by reference in its entirety. In some embodiments, the transposon system is a Sleeping Beauty transposon / translocase or a piggyBac transposon / translocase.

[0298] In some embodiments, the expression vector of the present disclosure can be provided to the cell in the form of a viral vector. Suitable viral vector systems are well known in the art. For example, the viral vector can be derived from a retrovirus, an adenovirus, an adeno-associated virus, a herpes virus and a lentivirus. In some embodiments, the vector of the present disclosure is a lentiviral vector. The lentiviral vector is suitable for long-term gene transfer because such vectors allow long-term stable integration of transgenics and reproduction in daughter cells. The lentiviral vector is also superior to vectors derived from tumor retroviruses (e.g., murine leukemia viruses) because the lentiviral vector can transduce non-proliferating cells. In some embodiments, the vector of the present disclosure is an adenoviral vector (A5 / 35). In some embodiments, the vector of the present disclosure contains a replication origin, a promoter sequence, a suitable restriction endonuclease site and one or more selective markers (e.g., WO01 / 96584; WO01 / 29058; and US6326193) that are functional in at least one organism. Many virus-based systems have been developed for transferring genes into mammalian cells. The selected gene can be inserted into a vector and encapsulated in a retroviral particle using techniques known in the art. The recombinant virus can then be isolated and delivered to mammalian cells in vivo or ex vivo.Many retroviral systems are known in the art.

[0299] In certain embodiments, the carrier of the present disclosure comprises other promoter elements, such as the enhancer of the frequency of regulation transcription initiation.Enhancer is usually located in the region of 30bp to 110bp upstream of the start site, although it has been proved that many promoters also contain functional elements downstream of the start site.The interval between the promoter elements can be flexible, so that the promoter function is retained when the elements are reversed or moved relative to each other.For example, in thymidine kinase (tk) promoter, the interval between the promoter elements can be increased to 50bp, and then the activity begins to decline.Depending on the promoter, a single element can be coordinated or independently function to activate transcription.Exemplary promoters can include but are not limited to SFFV gene promoter, EFS gene promoter, CMV IE gene promoter, EF1a promoter, ubiquitin C promoter and phosphoglycerol kinase (PGK) promoter.

[0300] In some embodiments, the promoter capable of expressing the polynucleotides of the present disclosure in mammalian cells (such as the immune response cells of the present disclosure) is the EF1a promoter. The native EF1a promoter drives the expression of the alpha subunit of the elongation factor-1 complex responsible for enzymatic delivery of aminoacyl tRNAs to the ribosome. The EF1a promoter has been widely used in mammalian expression plasmids and has been shown to be effective in driving chimeric receptor expression of polynucleotides cloned into lentiviral vectors.

[0301] In some embodiments, the promoter capable of expressing the polynucleotides of the present disclosure in mammalian cells (such as immune response cells of the present disclosure) is a constitutive promoter. For example, a suitable constitutive promoter is a spleen focus forming virus (SFFV) promoter. Another example of a suitable constitutive promoter is an immediate early cytomegalovirus (CMV) promoter. The CMV promoter is a strong constitutive promoter capable of driving high-level expression of any polynucleotide sequence operably connected to a promoter. Other suitable constitutive promoters include but are not limited to ubiquitin C (UbiC) promoter, simian virus 40 (SV40) early promoter, mouse mammary tumor virus (MMTV) promoter, human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukosis virus promoter, Epstein-Barr virus immediate early promoter, Rous sarcoma virus promoter, actin promoter, myosin promoter, elongation factor 1a promoter, hemoglobin promoter and creatine kinase promoter.

[0302] In some embodiments, the promoter capable of expressing the polynucleotides of the present disclosure in mammalian cells (such as the immune response cells of the present disclosure) is an inducible promoter. The use of an inducible promoter can provide a molecular switch capable of inducing or inhibiting the expression of the polynucleotides of the present disclosure when the promoter is operably linked to the polynucleotide. Examples of inducible promoters include, but are not limited to, metallothionein promoters, glucocorticoid promoters, progesterone promoters, and tetracycline promoters.

[0303] In some embodiments, the vectors of the present disclosure may further include a signal sequence to promote secretion, a polyadenylation signal and a transcription terminator, an element to allow episomal replication, and / or an element to allow selection.

[0304] In some embodiments, the vectors of the present disclosure may further include a selective marker gene and / or a reporter gene to facilitate identification and selection of cells expressing the chimeric receptor from a cell population that has been transduced with the vector. In some embodiments, the selective marker may be encoded by a polynucleotide separated from the vector and used in a co-transfection procedure. The selective marker or reporter gene may be flanked by appropriate regulatory sequences to allow expression in the host cell. Examples of selective markers include, but are not limited to, antibiotic resistance genes, such as neo and the like.

[0305] In certain embodiments, reporter gene can be used to identify transduced cells and for evaluating the functionality of regulatory sequences. As disclosed herein, reporter gene is such a gene, which does not exist in a recipient organism or tissue or is not expressed by a recipient organism or tissue and encodes a polypeptide whose expression causes an easily detectable property (such as enzymatic activity). The expression of reporter gene can be measured at a suitable time after polynucleotides have been introduced into recipient cells. Examples of reporter genes include but are not limited to genes encoding luciferase, genes encoding beta-galactosidase, genes encoding chloramphenicol acetyltransferase, genes encoding secreted alkaline phosphatase, and genes encoding green fluorescent protein. Suitable expression systems are well known in the art and can be prepared or commercially obtained using known techniques. In certain embodiments, the construct with the minimum 5' flanking region showing the highest level of reporter gene expression is identified as a promoter. Such promoter region can be connected to a reporter gene and used to evaluate the ability of a medicament to regulate promoter-driven transcription.

[0306] In some embodiments, a vector comprising a polynucleotide sequence encoding a chimeric receptor of the present disclosure further comprises a second polynucleotide encoding a polypeptide that increases the activity of the chimeric receptor.

[0307] In embodiments where the cell expressing the chimeric receptor comprises two or more chimeric receptors, a single polynucleotide may encode the two or more chimeric receptors under a single regulatory control element (e.g., a promoter) or under a separate regulatory control element for each nucleotide sequence encoding the chimeric receptor included in the polynucleotide. In some embodiments where the cell expressing the chimeric receptor comprises two or more chimeric receptors, each chimeric receptor may be encoded by a separate polynucleotide. In some embodiments, each separate polynucleotide comprises its own control element (e.g., a promoter). In some embodiments, a single polynucleotide encodes two or more chimeric receptors, and the nucleotide sequence encoding the chimeric receptor is in the same reading frame and expressed as a single polypeptide chain. In such embodiments, the two or more chimeric receptors may be separated by one or more peptide cleavage sites such as an automatic cleavage site or a substrate for an intracellular protease. Suitable peptide cleavage sites may include, but are not limited to, a T2A peptide cleavage site, a P2A peptide cleavage site, an E2A peptide cleavage site, and an F2A peptide cleavage site. In some embodiments, the two or more chimeric receptors comprise a T2A peptide cleavage site. In some embodiments, the two or more chimeric receptors comprise an E2A peptide cleavage site. In some embodiments, the two or more chimeric receptors comprise T2A and E2A peptide cleavage sites.

[0308] The method of introducing a gene into a cell and expressing a gene is well known in the art. For example, in some embodiments, an expression vector can be transferred to a host cell by physical means, chemical means or biological means. Examples of physical means for introducing polynucleotides into a host cell include but are not limited to calcium phosphate precipitation, lipofection, particle bombardment, microinjection and electroporation. Examples of chemical means for introducing polynucleotides into a host cell include but are not limited to colloidal dispersion systems, macromolecular complexes, nanocapsules, microspheres, beads and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles and liposomes. Examples of biological means for introducing polynucleotides into a host cell include but are not limited to the use of DNA and RNA vectors.

[0309] In some embodiments, liposomes can be used as non-viral delivery systems to introduce polynucleotides or vectors of the present disclosure into host cells in vitro, in vitro or in vivo. In some embodiments, the polynucleotides can be associated with lipids, such as by being encapsulated in an aqueous solution inside the liposome, being dispersed in the lipid bilayer of the liposome, being connected to the liposome via a connecting molecule associated with both the liposome and the polynucleotide, being wrapped in the liposome, being compounded with the liposome, being dispersed in a solution containing lipids, being mixed with lipids, being combined with lipids, being included in lipids in the form of a suspension, including micelles or being compounded with micelles, or otherwise being associated with lipids. As disclosed herein, lipid-associated polynucleotides or vector compositions are not limited to any particular structure in solution. In some embodiments, such compositions may be present in a bilayer structure, in the form of micelles, or have a "collapsed" structure. Such compositions may also be dispersed in a solution to form aggregates of uneven size or shape. As disclosed herein, lipids are fatty substances that may be naturally occurring or synthesized. In some embodiments, lipids can include naturally occurring fat droplets in the cytoplasm or contain long-chain aliphatic hydrocarbons and derivatives thereof, such as fatty acids, alcohols, amines, amino alcohols and aldehydes. Suitable lipids can be obtained from commercial sources, and include but are not limited to dimyristylphosphatidylcholine ("DMPC"), dicetyl phosphate ("DCP"), cholesterol and dimyristylphosphatidylglycerol ("DMPG"). The stock solution of lipids in chloroform or chloroform / methanol can be stored at about -20 ° C. Chloroform is used as a solvent because it evaporates more easily than methanol. As used herein, "liposomes" can encompass various monolayers and multilayer lipid vehicles formed by producing encapsulated lipid bilayers or aggregates. In some embodiments, liposomes can be characterized as having a vesicle structure containing a phospholipid bilayer membrane and an internal aqueous medium. In some embodiments, multilayer liposomes can have multiple lipid layers separated by an aqueous medium. Multilayer liposomes can be formed spontaneously when phospholipids are suspended in excess aqueous solution. In some embodiments, the lipid components may undergo self-rearrangement before forming a closed structure and may trap water and dissolved solutes between the lipid bilayers. In some embodiments, the lipids may present micellar structures or exist only as heterogeneous aggregates of lipid molecules.

[0310] In some embodiments, the polynucleotides or vectors of the present disclosure are introduced into mammalian host cells (such as immune response cells of the present disclosure). In some embodiments, the polynucleotides or vectors of the present disclosure can be confirmed to be present in host cells by any suitable assay known in the art, including but not limited to Southern blot assay, Northern blot assay, RT-PCR, PCR, ELISA assay, and Western blot assay.

[0311] In some embodiments, the polynucleotides or vectors of the present disclosure are stably transduced into immune response cells of the present disclosure. In some embodiments, cells exhibiting stable expression of the polynucleotides or vectors express the encoded chimeric receptor for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 3 months, at least 6 months, at least 9 months, or at least 12 months after transduction.

[0312] In embodiments where the chimeric receptor of the present invention is transiently expressed in a cell, a polynucleotide or vector encoding a chimeric receptor of the present invention is transfected into an immune response cell of the present invention. In some embodiments, the immune response cell expresses the chimeric receptor for about 4 days, about 5 days, about 6 days, about 7 days, about 8 days, about 9 days, about 10 days, about 11 days, about 12 days, about 13 days, about 14 days, or about 15 days after transfection.

[0313] Methods for engineering cells

[0314] Also provided herein are compositions and methods for engineering cells to produce an activation conditionally controlled polypeptide (ACP) and one or more effector molecules encoded by any engineered nucleic acid comprising a first expression cassette as described herein and a second expression cassette otherwise known in the art.

[0315] In general, cells are engineered to produce ACP and effector molecules by introducing (i.e., delivering) one or more polynucleotides of the present disclosure into the cytosol and / or nucleus of the cell, the polynucleotides comprising a first promoter and an exogenous polynucleotide sequence encoding the ACP, and a second expression cassette comprising an ACP response promoter and a second exogenous sequence encoding one or more effector molecules. For example, the polynucleotide expression cassette encoding the ACP polypeptide and one or more effector molecules can be any engineered nucleic acid described herein. Delivery methods include, but are not limited to, viral-mediated delivery, lipid-mediated transfection, nanoparticle delivery, electroporation, ultrasonic treatment, and cell membrane deformation by physical means. Those skilled in the art will appreciate that the choice of delivery method may depend on the specific cell type to be engineered.

[0316] In some embodiments, engineered cells are transduced using an oncolytic virus. Examples of oncolytic viruses include, but are not limited to, oncolytic herpes simplex virus, oncolytic adenovirus, oncolytic measles virus, oncolytic influenza virus, oncolytic Indiana vesicular virus, oncolytic Newcastle disease virus, oncolytic vaccinia virus, oncolytic poliovirus, oncolytic myxoma virus, oncolytic reovirus, oncolytic mumps virus, oncolytic Maraba virus, oncolytic rabies virus, oncolytic rotavirus, oncolytic hepatitis virus, oncolytic rubella virus, oncolytic dengue virus, oncolytic chikungunya virus, oncolytic respiratory syncytial virus, oncolytic lymphocytic choriomeningitis virus, oncolytic measles virus, oncolytic slow virus, oncolytic replicating retrovirus, oncolytic rhabdovirus, oncolytic Seneca Valley virus, oncolytic Sindbis virus and any variants or derivatives thereof. In some embodiments, an oncolytic virus is a recombinant oncolytic virus including a first expression cassette and a second expression cassette. In some embodiments, an oncolytic virus further includes a third expression cassette.

[0317] Viruses, including any oncolytic viruses described herein, may be recombinant viruses encoding one or more transgenes encoding one or more effector molecules, such as any engineered nucleic acids described herein. Viruses, including any oncolytic viruses described herein, may be recombinant viruses encoding one or more transgenes encoding one or more of two or more effector molecules, such as any engineered nucleic acids described herein. In some embodiments, cells are engineered by transduction with an oncolytic virus.

[0318] Virus-mediated delivery

[0319] Delivery platforms based on viral vectors can be used to engineer cells. Generally speaking, delivery platforms based on viral vectors are engineered to cells by introducing (i.e., delivering) into host cells. For example, delivery platforms based on viral vectors can be engineered to cells by introducing any engineered nucleic acid described herein. Delivery platforms based on viral vectors can be nucleic acids, and therefore, engineered nucleic acids can also encompass engineered nucleic acids from viral sources. Such engineered nucleic acids from viral sources can also be referred to as recombinant viruses or engineered viruses.

[0320] Delivery platforms based on viral vectors can encode more than one engineered nucleic acid, gene or transgene in the same nucleic acid. For example, engineered virus-derived nucleic acids, such as recombinant viruses or engineered viruses, can encode one or more transgenics, including but not limited to any engineered nucleic acid described herein encoding one or more effector molecules. The one or more transgenics encoding the one or more effector molecules can be constructed to express the one or more effector molecules. In addition to the one or more transgenics (e.g., transgenics encoding the one or more effector molecules), delivery platforms based on viral vectors can also encode one or more genes, such as viral genes (e.g., capsid proteins, envelope proteins, viral polymerases, viral transcriptases, etc.) required for viral infectivity and / or viral production, referred to as cis-acting elements or genes.

[0321] Delivery platforms based on viral vectors may include more than one viral vector, such as a separate viral vector encoding an engineered nucleic acid, gene or transgene as described herein and referred to as a trans-acting element or gene. For example, in addition to a vector encoding one or more effector molecules, a delivery platform based on an auxiliary-dependent viral vector may provide additional genes required for viral infectivity and / or viral production on one or more additional separate vectors. A viral vector may deliver more than one engineered nucleic acid, such as a vector that delivers an engineered nucleic acid configured to produce two or more effector molecules. More than one viral vector may deliver more than one engineered nucleic acid, such as a vector that delivers one or more engineered nucleic acids configured to produce two or more effector molecules. The number of viral vectors used may depend on the packaging capacity of the above-mentioned vaccine platform based on viral vectors, and those skilled in the art may select an appropriate number of viral vectors.

[0322] In general, any viral vector-based system can be used for in vitro production of molecules (e.g., effector molecules), or for in vivo and ex vivo gene therapy procedures, e.g., for in vivo delivery of engineered nucleic acids encoding one or more effector molecules. The selection of an appropriate viral vector-based system will depend on a variety of factors, such as cargo / payload size, immunogenicity of the viral system, intended target cells, intensity and timing of gene expression, and other factors known to those skilled in the art.

[0323] The delivery platform based on the viral vector can be an RNA-based virus or a DNA-based virus. Exemplary delivery platforms based on viral vectors include, but are not limited to, herpes simplex virus, adenovirus, measles virus, influenza virus, Indiana vesicular virus, Newcastle disease virus, vaccinia virus, polio virus, myxoma virus, reovirus, mumps virus, Maraba virus, rabies virus, rotavirus, hepatitis virus, rubella virus, dengue virus, chikungunya virus, respiratory syncytial virus, lymphocytic choriomeningitis virus, measles virus, lentivirus, replicating retrovirus, rhabdovirus, Seneca Valley virus, Sindbis virus, and any variants or derivatives thereof.Other exemplary viral vector-based delivery platforms are described in the art, such as vaccinia virus, fowlpox virus, self-replicating alphavirus, Maraba virus, adenovirus (see, e.g., Tatsis et al., Adenovirus, Molecular Therapy (2004) 10, 616-629), or lentivirus, including but not limited to second, third, or hybrid second / third generation lentiviruses and recombinant lentiviruses of any generation designed to target specific cell types or receptors (see, e.g., Hu et al., Immunization Delivered by Lentiviral Vectors for Cancer and Infectious Diseases, Immunol Rev. (2011) 239(1):45-61; Sakuma et al., Lentiviral vectors: basic to translational, Biochem. J.) (2012) 443(3):603-18; Cooper et al., Rescue of splicing-mediated intron loss maximizes expression in lentiviral vectors containing the humanubiquitin C promoter, Nucl. Acids Res. (2015) 43(1):682-690; Zufferey et al., Self-Inactivating Lentivirus Vector for Safe and Efficient In vivo Gene Delivery, J. Virol. (1998) 72(12):9873-9880).

[0324] In front of these sequences, there may be one or more sequences targeting subcellular compartments. After being introduced (i.e., delivered) into the host cell, the infected cell (i.e., engineered cell) can express the one or more effector molecules and secrete the one or more effector molecules in some cases. Vaccinia vectors and methods that can be used for immunization schemes are described in, for example, U.S. Patent No. 4,722,848. Another vector is BCG (BCG). BCG vectors are described in Stover et al., (" Nature (Nature) "351:456-460 (1991)). According to the description herein, it will be apparent to those skilled in the art that various other vectors (e.g., Salmonella typhi (Salmonella typhi) vectors, etc.) that can be used to introduce (i.e., deliver) engineered nucleic acids.

[0325] Delivery platforms based on viral vectors can be viruses targeting tumor cells, referred to herein as oncolytic viruses. Examples of oncolytic viruses include but are not limited to oncolytic herpes simplex virus, oncolytic adenovirus, oncolytic measles virus, oncolytic influenza virus, oncolytic Indiana vesicular virus, oncolytic Newcastle disease virus, oncolytic vaccinia virus, oncolytic poliovirus, oncolytic myxoma virus, oncolytic reovirus, oncolytic mumps virus, oncolytic Maraba virus, oncolytic rabies virus, oncolytic rotavirus, oncolytic hepatitis virus, oncolytic rubella virus, oncolytic dengue virus, oncolytic chikungunya virus, oncolytic respiratory syncytial virus, oncolytic lymphocytic choriomeningitis virus, oncolytic measles virus, oncolytic slow virus, oncolytic replicating retrovirus, oncolytic rhabdovirus, oncolytic Seneca Valley virus, oncolytic Sindbis virus and any variants or derivatives thereof. Any oncolytic virus described herein can be a recombinant oncolytic virus including one or more transgenics (e.g., engineered nucleic acids) encoding one or more effector molecules. The transgene encoding the one or more effector molecules can be configured to express the one or more effector molecules.

[0326] In some embodiments, the virus is selected from the group consisting of: a lentivirus, a retrovirus, an oncolytic virus, an adenovirus, an adeno-associated virus (AAV), and a virus-like particle (VLP).

[0327] Delivery platforms based on viral vectors can be based on retroviruses. In general, retroviral vectors are composed of cis-acting long terminal repeats with a packaging capacity of up to 6-10 kb of foreign sequences. Minimal cis-acting LTRs are sufficient to replicate and package the vector, which is then used to integrate one or more engineered nucleic acids (e.g., transgenes encoding one or more effector molecules) into target cells to provide permanent transgene expression. Retroviral delivery systems include, but are not limited to, those based on murine leukemia virus (MuLV), gibbon ape leukemia virus (GaLV), simian immunodeficiency virus (SIV), human immunodeficiency virus (HIV), and combinations thereof (see, e.g., Buchscher et al., Journal of Virology 66:2731-2739 (1992); Johann et al., Journal of Virology 66:1635-1640 (1992); Sommnerfelt et al., Virol. 176:58-59 (1990); Wilson et al., Journal of Virology 63:2374-2378 (1989); Miller et al., Journal of Virology 65:2220-2224 (1991); PCT / US94 / 05700). Other retroviral systems include the Phoenix retroviral system.

[0328] The delivery platform based on viral vector can be based on lentivirus. Generally speaking, lentiviral vectors are retroviral vectors that can transduce or infect non-dividing cells and usually produce high viral titers. The delivery platform based on lentivirus can be based on HIV, such as ViraPower system (ThermoFisher) or pLenti system (Cell Biolabs). The delivery platform based on lentivirus can be based on SIV or FIV. Other exemplary lentiviral-based delivery platforms are described in more detail in U.S. Pat. Nos. 7,311,907, 7,262,049, 7,250,299, 7,226,780, 7,220,578, 7,211,247, 7,160,721, 7,078,031, 7,070,993, 7,056,699, 6,955,919, each of which is incorporated herein by reference for all purposes.

[0329] The delivery platform based on viral vectors can be based on adenovirus. In general, adenovirus-based vectors are able to have very high transduction efficiencies in many cell types, do not require cell division, achieve high titers and expression levels, and can be mass-produced in relatively simple systems. In general, adenoviruses can be used to transiently express transgenes within infected cells because adenoviruses do not usually integrate into the host's genome. Adenovirus-based delivery platforms are described in more detail in Li et al., Invest Opthalmol Vis Sci 35:2543-2549, 1994; Borras et al., Gene Ther 6:515-524, 1999; Li and Davidson, PNAS 92:7700-7704, 1995; Sakamoto et al., H Gene Ther 5:1088-1097, 1999; WO 94 / 12649; WO 93 / 03769; WO 93 / 19191; WO 94 / 28938; WO 95 / 11984 and WO 95 / 00655, each of which is incorporated herein by reference for all purposes. Other exemplary adenovirus-based delivery platforms are described in more detail in U.S. Pat. Nos. 5,585,362, 6,083,716, 7,371,570, 7,348,178, 7,323,177, 7,319,033, 7,318,919, and 7,306,793, and in International Patent Application WO 96 / 13597, each of which is incorporated herein by reference for all purposes.

[0330] The delivery platform based on the viral vector can be based on adeno-associated virus (AAV). Adeno-associated virus ("AAV") vectors can be used to transduce cells with engineered nucleic acids (e.g., any engineered nucleic acids described herein). The AAV system can be used to produce effector molecules in vitro, or for in vivo and ex vivo gene therapy procedures, such as for in vivo delivery of engineered nucleic acids encoding one or more effector molecules (see, e.g., West et al. Virology 160:38-47 (1987); U.S. Pat. Nos. 4,797,368; 5,436,146; 6,632,670; 6,642,051; 7,078,387; 7,314,912; 6,498,244; 7,906,111; U.S. Pat. Nos. 4,797,368, ... 2003-0138772, US2007 / 0036760 and US2009 / 0197338; Gao et al., Journal of Virology, 78(12):6381-6388 (June 2004); Gao et al., Proceedings of the National Academy of Sciences of the United States of America, 100(10):6081-6086 (May 13, 2003); and international patent applications WO2010 / 138263 and WO 93 / 24641; Kotin, Human Gene Therapy 5:793-801 (1994); Muzyczka, J. Clin. Invest. 94:1351 (1994), each of which is incorporated herein by reference for all purposes. Exemplary methods for constructing recombinant AAV vectors are described in more detail in the following documents: U.S. Pat. No. 5,173,414; Tratschin et al., Mol. Cell. Biol. 5:3251-3260 (1985); ... 》4:2072-2081 (1984); Hermonat & Muzyczka, "Proceedings of the National Academy of Sciences of the United States of America" ​​81:64666470 (1984); and Samuiski et al., "Journal of Virology" 63:03822-3828 (1989), each of which is incorporated herein by reference for all purposes. In general, AAV-based vectors include a capsid protein having an amino acid sequence corresponding to any of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV.Rh10, AAV11 and variants thereof.

[0331] The delivery platform based on viral vector can be a virus-like particle (VLP) platform. In general, VLP is constructed by producing viral structural proteins and purifying the obtained viral particles. Then, after purification, goods / payload (for example, any engineered nucleic acid described herein) is encapsulated in purified particles in vitro. Therefore, the production of VLP keeps the nucleic acid encoding viral structural proteins separate from the nucleic acid encoding goods / payload. The viral structural proteins for VLP production can be produced in a variety of expression systems, including mammals, yeast, insects, bacteria or in vivo translation expression systems. Methods known to those skilled in the art can be used to denature purified viral particles and re-form to produce VLP in the presence of desired goods. The production of VLP is described in more detail in Seow et al., ("Molecular Therapy" May 2009; 17 (5): 767-777), and the document is incorporated herein by reference for all purposes.

[0332] The delivery platform based on viral vector can be engineered to target (i.e., infect) a range of cells, a narrow subset of targeted cells, or to target specific cells. In general, the envelope protein selected for the delivery platform based on viral vector will determine the viral tropism. The viruses used in the delivery platform based on viral vector can be pseudotyped to target specific target cells. The delivery platform based on viral vector can be pantropic and infect a range of cells. For example, the delivery platform based on a pantropic viral vector can include a VSV-G envelope. The delivery platform based on viral vector can be amphotropic and infect mammalian cells. Therefore, those skilled in the art can select appropriate tropism, pseudotype and / or envelope protein to target the desired cell type.

[0333] Lipid structure delivery system

[0334] The engineered nucleic acids of the present disclosure (e.g., any engineered nucleic acids described herein) can be introduced into cells using lipid-mediated delivery systems. In general, lipid-mediated delivery systems use structures consisting of an outer lipid membrane encapsulating an inner compartment. Examples of lipid-based structures include, but are not limited to, lipid-based nanoparticles, liposomes, micelles, exosomes, vesicles, extracellular vesicles, cells, or tissues. Lipid structure delivery systems can deliver cargo / payloads (e.g., any engineered nucleic acids described herein) in vitro, in vivo, or ex vivo.

[0335] Nanoparticles based on lipids may include but are not limited to unilamellar liposomes, multilamellar liposomes and lipid preparations. As used herein, "liposome" is a general term, which encompasses the in vitro preparation of lipid vehicles formed by encapsulating desired goods (e.g., engineered nucleic acids, any engineered nucleic acids as described herein) in lipid shells or lipid aggregates. The feature of liposomes may be a vesicle structure with a double-layer membrane, generally including phospholipids, and generally including an internal medium of an aqueous composition. Liposomes include but are not limited to emulsions, foams, micelles, insoluble monolayers, liquid crystals, phospholipid dispersions, lamellar layers, etc. Liposomes may be unilamellar liposomes. Liposomes may be multilamellar liposomes. Liposomes may be multilamellar liposomes. Liposomes may be positively charged, negatively charged or uncharged. In certain embodiments, the liposome charge is neutral. Liposomes may be formed by standard vesicle-forming lipids, which generally include neutral and negatively charged phospholipids and sterols, such as cholesterol. Generally, by considering the desired purpose, for example, the standard of in vivo delivery, such as liposome size, acid instability and the stability of liposomes in the bloodstream guide the selection of lipids. A variety of methods can be used to prepare liposomes, as described in, for example, Szoka et al., Ann. Rev. Biophys. Bioeng. 9; 467 (1980), U.S. Pat. Nos. 4,235,871, 4,501,728, 4,501,728, 4,837,028, and 5,019,369, each of which is incorporated herein by reference for all purposes.

[0336] When the lipid suspension including phospholipids is in excessive aqueous solution so that multiple lipid layers are separated by aqueous medium, multilayer liposomes are spontaneously generated. After lipid component experience self-rearrangement, water and dissolved solute are trapped in the closed structure between lipid bilayer. Expected goods (for example, polypeptide, nucleic acid, small molecule drug, engineered nucleic acid, any engineered nucleic acid as described herein, viral vector, delivery system based on virus, etc.) can be encapsulated in the aqueous interior of liposome, by connecting molecules all connected with liposome and polypeptide / nucleic acid and liposome association, be scattered in the lipid bilayer of liposome, be trapped in liposome, compound with liposome, or otherwise associate with liposome, make it possible to be delivered to target entity. Lipophilic molecules or molecules with lipophilic region can also be dissolved in lipid bilayer or associate with lipid bilayer.

[0337] Liposomes used according to the present embodiment can be prepared by different methods, as known to those of ordinary skill in the art. The preparation of liposomes is described in more detail in WO 2016 / 201323, International Applications PCT / US85 / 01161 and PCT / US89 / 05040, and U.S. Patents 4,728,578, 4,728,575, 4,737,323, 4,533,254, 4,162,282, 4,310,505, and 4,921,706; Each is incorporated herein by reference for all purposes.

[0338] The liposomes can be cationic liposomes. Examples of cationic liposomes are described in more detail in U.S. Pat. Nos. 5,962,016, 5,030,453, 6,680,068; U.S. Application Nos. 2004 / 0208921 and International Patent Applications WO03 / 015757A1, WO04029213A2 and WO02 / 100435A1, each of which is hereby incorporated by reference in its entirety.

[0339] Lipid-mediated gene delivery methods are described, for example, in WO 96 / 18372; WO 93 / 24640; Mannino and Gould-Fogerite, BioTechniques 6(7):682-691 (1988); U.S. Pat. No. 5,279,833, Rose U.S. Pat. No. 5,279,833; WO 91 / 06309; and Felgner et al., Proceedings of the National Academy of Sciences of the United States of America 84:7413-7414 (1987), each of which is incorporated herein by reference for all purposes.

[0340] Exosomes are small membrane vesicles of endocytic origin, which are released into the extracellular environment after fusion of multivesicular bodies with the plasma membrane. The size of exosomes ranges between 30nm and 100nm in diameter. Their surface consists of a lipid bilayer from the cell membrane of the donor cell, and they contain cytoplasm from the cell that produces the exosomes and display membrane proteins from the parent cell on the surface. Exosomes for delivery of nucleic acids are known to those skilled in the art, for example, exosomes described in more detail in U.S. Patent No. 9,889,210, which is incorporated herein by reference for all purposes.

[0341] As used herein, the term "extracellular vesicle" or "EV" refers to a vesicle of cell origin including a membrane that wraps an internal space. In general, extracellular vesicles include all membrane-bound vesicles, and the diameter of these vesicles is smaller than the cells from which they are derived. Typically, the diameter of an extracellular vesicle ranges from 20nm to 1000nm, and may include various macromolecular cargoes that are in the internal space, displayed on the outer surface of the extracellular vesicle, and / or span the membrane. Cargo may include nucleic acids (e.g., any engineered nucleic acid described herein), proteins, carbohydrates, lipids, small molecules, and / or combinations thereof. As an example and not limitation, extracellular vesicles include apoptotic bodies, cell fragments, vesicles derived from cells by direct or indirect manipulation (e.g., by continuous extrusion or treatment with an alkaline solution), vesicles, vesicled organelles, and vesicles produced by living cells (e.g., by direct cytoplasmic membrane budding or late endosomes and cytoplasmic membrane fusion). Extracellular vesicles may be derived from living or dead organisms, explanted tissues or organs, and / or cultured cells.

[0342] As used herein, the term "exosome" refers to a small (diameter between 20-300nm, more preferably between 40-200nm) vesicle of cell origin, which includes a membrane that wraps the internal space, and the vesicle is generated from the cell by direct plasma membrane budding or by late endosome fusion with the plasma membrane. Exosomes include lipids or fatty acids and polypeptides, and optionally include a payload (e.g., a therapeutic agent), a receptor (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA or DNA, any engineered nucleic acid as described herein), a sugar (e.g., a monosaccharide, a polysaccharide or a polysaccharide) or other molecules. Exosomes can be derived from production cells and separated from production cells based on their size, density, biochemical parameters or a combination thereof. Exosomes are an extracellular vesicle. Typically, the production / biogenesis of exosomes does not result in the destruction of production cells. Exosomes and the preparation of exosomes are described in more detail in WO 2016 / 201323, which is hereby incorporated by reference as a whole.

[0343] As used herein, the term "nanovesicle" (also referred to as "microvesicle") refers to a small (diameter between 20-250nm, more preferably between 30-150nm) vesicle of cell origin, which includes a membrane that wraps the internal space, and the vesicle is produced from the cell by direct or indirect manipulation, so that the production cell will not produce the nanovesicle in the absence of the manipulation. In general, nanovesicles are subspecies of extracellular vesicles. Suitable manipulation of production cells includes but is not limited to continuous extrusion, treatment with alkaline solution, ultrasonic treatment or a combination thereof. In some cases, the production of nanovesicles may lead to the destruction of the production cells. Preferably, the nanovesicle population is substantially free of vesicles obtained from production cells by direct budding from the plasma membrane or late endosome fusion with the plasma membrane. The nanovesicle includes lipids or fatty acids and polypeptides, and optionally includes a payload (e.g., a therapeutic agent), a receptor (e.g., a targeting moiety), a polynucleotide (e.g., a nucleic acid, RNA or DNA, any engineered nucleic acid as described herein), a sugar (e.g., a monosaccharide, a polysaccharide or a polysaccharide) or other molecules. Once obtained from the production cells according to the described manipulations, the nanovesicles can be isolated from the production cells based on their size, density, biochemical parameters, or a combination thereof.

[0344] In general, lipid nanoparticles (LNPs) are synthetic lipid structures that rely on the amphiphilicity of lipids to form membranes and vesicle-like structures (Riley 2017). In general, these vesicles deliver cargo / payload by absorbing into the membrane of the target cell and releasing the cargo into the cytosol, such as any engineered nucleic acid or viral system described herein. The lipid used in the formation of LNPs can be cationic, anionic or neutral. The lipid can be synthetic or of natural origin, and in some cases biodegradable. The lipid can include fats, cholesterol, phospholipids, lipid conjugates, including but not limited to polyethylene glycol (PEG) conjugates (PEGylated lipids), waxes, oils, glycerides and fat-soluble vitamins. The lipid composition generally includes a limited mixture of materials, such as cationic lipids, neutral lipids, anionic lipids and amphiphilic lipids. In some cases, specific lipids are included to prevent LNP aggregation, prevent lipid oxidation or provide functional chemical groups that promote attachment of additional parts. The lipid composition can affect overall LNP size and stability. In one example, the lipid composition includes dilinoleylmethyl-4-dimethylaminobutyrate (MC3) or MC3-like molecules. MC3 and MC3-like lipid compositions can be formulated to include one or more other lipids, such as PEG or PEG-conjugated lipids, sterols or neutral lipids. In addition, LNP can be further engineered or functionalized to promote the targeting of specific cell types. Another consideration in LNP design is the balance between targeting efficiency and cytotoxicity.

[0345] In general, micelles are spherical synthetic lipid structures formed using single-chain lipids, wherein the hydrophilic head of the single-chain lipid forms an outer layer or membrane, and the hydrophobic tail of the single-chain lipid forms the center of the micelle. Micelles generally refer to lipid structures containing only a lipid monolayer. Micelles are described in more detail in Quader et al. (Molecular Therapy July 5, 2017; 25(7): 1501-1513), which is incorporated herein by reference for all purposes.

[0346] Nucleic acid carriers directly exposed to serum, such as expression vectors, may have several adverse consequences, including serum nuclease degradation of nucleic acid or free nucleic acid to the immune system's off-target stimulation. Similarly, viral delivery systems directly exposed to serum can trigger the neutralization of undesirable immune responses and / or viral delivery systems. Therefore, the encapsulation of engineered nucleic acids and / or viral delivery systems can be used to avoid degradation, while also avoiding potential off-target effects. In some instances, engineered nucleic acids and / or viral delivery systems are fully encapsulated in delivery vehicles, such as in the aqueous interior of LNP. Engineered nucleic acids and / or viral delivery systems can be encapsulated in LNP by techniques well known to those skilled in the art, such as microfluid mixing and droplet generation performed on a microfluidic droplet generation device. Such devices include, but are not limited to, standard T-joint devices or flow focusing devices. In one example, desired lipid formulations, such as containing MC3 or MC3-like compositions, are provided to droplet generation devices in parallel with engineered nucleic acids or viral delivery systems and any other required reagents, so that delivery vectors and required reagents are fully encapsulated in the LNP interior based on MC3 or MC3-like. In one example, the droplet generation device can control the size range and size distribution of the generated LNPs. For example, the size of the LNPs can be in the range of 1 to 1000 nanometers in diameter, such as 1, 10, 50, 100, 500, or 1000 nanometers. After the droplets are generated, the delivery vehicle encapsulating the cargo / payload (e.g., engineered nucleic acids and / or viral delivery systems) can be further processed or engineered to prepare them for administration.

[0347] Nanoparticle delivery

[0348] Nanomaterials can be used to deliver engineered nucleic acids (e.g., any engineered nucleic acids described herein). Importantly, nanomaterial vehicles can be made of non-immunogenic materials and can generally avoid immunity to the delivery vehicle itself. These materials may include, but are not limited to, lipids (as described above), inorganic nanomaterials, and other polymeric materials. Nanomaterial particles are described in more detail in Riley et al., (Recent Advances in Nanomaterials for Gene Delivery—A Review). Nanomaterials 2017, 7 (5), 94, which are incorporated herein by reference for all purposes.

[0349] Genome Editing System

[0350] Genome editing systems can be used to engineer the host genome to encode engineered nucleic acids, such as the engineered nucleic acids of the present disclosure. In general, a "genome editing system" refers to any system for integrating exogenous genes into the host cell genome. Genome editing systems include, but are not limited to, transposon systems, nuclease genome editing systems, and viral vector-based delivery platforms.

[0351] Transposon systems can be used to integrate engineered nucleic acids, such as the engineered nucleic acids of the present disclosure, into the host genome. Transposons typically include terminal inverted repeats (TIRs) located on both sides of the cargo / payload nucleic acid and the transposase. Transposon systems can provide transposons that are in cis or trans positions with the cargo flanking the TIR. The transposon system can be a retrotransposon system or a DNA transposon system. In general, transposon systems randomly integrate cargo / payload (e.g., engineered nucleic acids) into the host genome. Examples of transposon systems include systems using transposons of the Tc1 / mariner transposon superfamily, such as the Sleeping Beauty transposon system, which is described in more detail in Hudecek et al. (Crit Rev Biochem Mol Biol. 2017 Aug; 52(4): 355-380) and U.S. Pat. Nos. 6,489,458, 6,613,752, and 7,985,739, each of which is incorporated herein by reference for all purposes. Another example of a transposon system includes the PiggyBac transposon system, which is described in more detail in U.S. Pat. Nos. 6,218,185 and 6,962,810, each of which is incorporated herein by reference for all purposes.

[0352] Nuclease genome editing systems can be used to engineer the host genome to encode engineered nucleic acids, such as the engineered nucleic acids disclosed herein. Without wishing to be bound by theory, in general, the nuclease-mediated gene editing system for introducing exogenous genes utilizes the natural DNA repair mechanism of the cell, particularly the homologous recombination (HR) repair pathway. In short, after genomic DNA is damaged (usually double-strand breaks), the cell can repair the damage by using another DNA source with the same or substantially the same sequence at its 5' and 3' ends as a template during DNA synthesis, thereby eliminating the damage. Under natural conditions, HDR can use other chromosomes present in the cell as templates. In the gene editing system, exogenous polynucleotides are introduced into the cell and used as homologous recombination templates (HRT or HR templates). In general, during templated HDR, any additional exogenous sequences (e.g., genes or a part of genes) not originally found in the chromosome containing damage between the 5' and 3' complementary ends in the HRT can be incorporated (i.e., "integrated") into a given genomic locus. Thus, a typical HR template for a given genomic locus has a nucleotide sequence identical to a first region of the endogenous genomic target locus, a nucleotide sequence identical to a second region of the endogenous genomic target locus, and a nucleotide sequence encoding a cargo / payload nucleic acid (e.g., any engineered nucleic acid described herein, such as any engineered nucleic acid encoding one or more effector molecules).

[0353] In some examples, the HR template can be linear. Examples of linear HR templates include, but are not limited to, linearized plasmid vectors, ssDNA, synthetic DNA, and PCR amplified DNA. In specific examples, the HR template can be circular, such as a plasmid. The circular template can include a supercoiled template.

[0354] The identical or substantially identical sequences found at the 5' and 3' ends of the HR template relative to the exogenous sequence to be introduced are generally referred to as arms (HR arms). The HR arms may be identical (i.e., 100% identical) to the region of the endogenous genomic target locus. The HR arms in some examples may be substantially identical to the region of the endogenous genomic target locus. Although substantially identical HR arms may be used, it may be advantageous to have identical HR arms because the efficiency of the HDR pathway may be affected by HR arms having less than 100% identity.

[0355] Each HR arm, that is, 5' and 3' HR arms can be the same size or different sizes. The length of each HR arm can be greater than or equal to 50, 100, 200, 300, 400 or 500 bases respectively. Although the HR arm can be generally of any length, practical factors such as the effect of HR arm length and overall template size on overall editing efficiency can also be considered. The HR arm can be the same or substantially the same as the region of the endogenous genomic target locus adjacent to the cleavage site. Each HR arm can be the same or substantially the same as the region of the endogenous genomic target locus adjacent to the cleavage site. Each HR arm can be the same or substantially the same as the region of the endogenous genomic target locus within a certain distance from the cleavage site, such as 1 base pair, less than or equal to 10 base pairs, less than or equal to 50 base pairs, or less than or equal to 100 base pairs.

[0356] Nuclease genome editing systems can use a variety of nucleases to cleave target genomic loci, including but not limited to clustered regularly interspaced short palindromic repeats (CRISPR) family nucleases or their derivatives, transcription activator-like effector nucleases (TALENs) or their derivatives, zinc finger nucleases (ZFNs) or their derivatives, and homing endonucleases (HEs) or their derivatives.

[0357] CRISPR-mediated gene editing systems can be used to engineer host genomes to encode engineered nucleic acids, such as engineered nucleic acids encoding one or more effector molecules described herein. The CRISPR system is described in more detail in M. Adli ("The CRISPR tool kit for genome editing and beyond" Nature Communications; Issue 9 (2018), Article No.: 1911), all of which are incorporated herein by reference. In general, CRISPR-mediated gene editing systems include CRISPR-associated (Cas) nucleases and RNAs that guide the cutting of specific target sequences. An exemplary CRISPR-mediated gene editing system is a CRISPR / Cas9 system comprising a Cas9 nuclease and an RNA having a CRISPR RNA (crRNA) domain and a trans-activating CRISPR (tracrRNA) domain. crRNA generally has two RNA domains: a guide RNA sequence (gRNA) that guides a specificity by hybridizing with base pairs of a target sequence (e.g., a "determined nucleotide sequence" of a genomic sequence); and an RNA domain that hybridizes with tracrRNA. TracrRNA can interact with a nuclease (e.g., Cas9) to promote the recruitment of the nuclease to a genomic locus. crRNA and tracrRNA polynucleotides can be separate polynucleotides. crRNA and tracrRNA polynucleotides can be single polynucleotides, also referred to as single guide RNA (sgRNA). Although the Cas9 system is described herein, other CRISPR systems such as the Cpf1 system can also be used. Nucleases can include derivatives thereof, such as Cas9 functional mutants, such as Cas9 "nickase" mutants, which generally only mediate the cutting of a single strand of a determined nucleotide sequence, rather than the complete double-strand break generally produced by the Cas9 enzyme.

[0358] In general, the components of the CRISPR system interact with each other to form a ribonucleoprotein (RNP) complex to mediate sequence-specific cleavage. In some CRISPR systems, each component can be produced separately and used to form an RNP complex. In some CRISPR systems, each component can be produced separately in vitro and contacted with each other in vitro (i.e., "compound") to form an RNP complex. The RNP produced in vitro can then be introduced (i.e., "delivered") into the cytoplasm and / or nucleus of the cell, for example, the cytoplasm and / or nucleus of a T cell. The RNP complex produced in vitro can be delivered to the cell in a variety of ways, including but not limited to electroporation, lipid-mediated transfection, cell membrane deformation by physical means, lipid nanoparticles (LNP), virus-like particles (VLP) and ultrasonic treatment. In a specific example, Nucleofactor / Electroporation-based delivery systems The RNP complex produced in vitro is delivered to the cell.Other electroporation systems include but are not limited to the MaxCyte electroporation system, the Miltenyi CliniMACS electroporation system, the Neon electroporation system, and the BTX electroporation system.CRISPR nucleases (e.g., Cas9) can be produced in vitro using a variety of protein production techniques known to those skilled in the art (i.e., synthesized and purified).CRISPR system RNAs (e.g., sgRNA) can be produced in vitro using a variety of RNA production techniques known to those skilled in the art (e.g., in vitro transcription or chemical synthesis).

[0359] The RNP complexes produced in vitro can be complexed at different ratios of nuclease to gRNA. The RNP complexes produced in vitro can also be used in CRISPR-mediated editing systems in different amounts. For example, depending on the number of cells that need to be edited, the total amount of RNP added can be adjusted, such as reducing the amount of RNP complex added when editing a large number of cells in the reaction.

[0360] In some CRISPR systems, each component (e.g., Cas9 and sgRNA) can be encoded by a polynucleotide alone, wherein each polynucleotide is introduced into the cell together or alone. In some CRISPR systems, each component can be encoded by a single polynucleotide (i.e., a multi-promoter or multicistronic vector, see below for a description of an exemplary multicistronic system) and introduced into the cell. After the CRISPR components encoded by each polynucleotide are expressed in the cell (e.g., translation of the nuclease and transcription of the CRISPR RNA), the RNP complex can be formed in the cell, which can then guide site-specific cutting.

[0361] Some RNPs can be engineered to have a portion that facilitates RNP delivery into the nucleus. For example, the Cas9 nuclease can have a nuclear localization signal (NLS) domain such that if the Cas9 RNP complex is delivered to the cytosol of a cell or after Cas9 translation and subsequent RNP formation, the NLS can facilitate further transport of the Cas9 RNP into the nucleus.

[0362] The engineered cells described herein can be engineered using non-viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using non-viral methods. The engineered cells described herein can be engineered using viral methods, for example, the nucleases and / or CRISPR-mediated gene editing systems described herein can be delivered to cells using viral methods such as adenovirus, retrovirus, lentivirus, or any other viral-based delivery method described herein.

[0363] In some CRISPR systems, more than one CRISPR composition may be provided so that each composition individually targets more than one target nucleotide sequence of the same gene or general genomic locus. For example, two separate CRISPR compositions may be provided to guide cutting at two different target nucleotide sequences within a certain distance of each other. In some CRISPR systems, more than one CRISPR composition may be provided so that each composition individually targets the opposite strand of the same gene or general genomic locus. For example, two separate CRISPR "nickase" compositions may be provided to guide cutting at the opposite strand of the same gene or general genomic locus.

[0364] In general, the features of the CRISPR-mediated editing system described herein can be applied to other nuclease-based genome editing systems. TALEN is an engineered site-specific nuclease, which consists of a DNA binding domain of a TALE (transcription activator-like effector) and a catalytic domain of a restriction endonuclease Fok1. By changing the amino acids present in the highly variable residue region of the monomer of the DNA binding domain, different artificial TALENs can be formed to target various nucleotide sequences. The DNA binding domain then guides the nuclease to the target sequence and produces a double-strand break. The TALEN-based system is described in more detail in U.S. Serial No. 12 / 965,590; U.S. Patent No. 8,450,471; U.S. Patent No. 8,440,431; U.S. Patent No. 8,440,432; U.S. Patent No. 10,172,880; and U.S. Serial No. 13 / 738,381, all of which are incorporated herein by reference in their entirety. ZFN-based editing systems are described in more detail in U.S. Pat. Nos. 6,453,242; 6,534,261; 6,599,692; 6,503,717; 6,689,558; 7,030,215; 6,794,136; 7,067,317; 7,262,054; 7,070,934; 7,361,635; 7,253,273; and U.S. Patent Publication Nos. 2005 / 0064474; 2007 / 0218528; 2005 / 0267061; all of which are incorporated herein by reference in their entirety for all purposes.

[0365] Other engineered delivery systems

[0366] Various additional ways to introduce an engineered nucleic acid (eg, any engineered nucleic acid described herein) into a cell or other target receptor entity (eg, any lipid structure described herein).

[0367] Electroporation can be used to deliver polynucleotides to recipient entities. Electroporation is a method of internalizing cargo / payload to the internal compartment of a target cell or entity by applying an electric field to make the outer membrane or shell of a target cell or entity instantaneously permeabilized. Generally speaking, the method involves placing a cell or target entity between two electrodes in a solution containing the cargo of interest (e.g., any engineered nucleic acid described herein). Then, the lipid membrane of the cell is destroyed (i.e., permeabilized) by applying an instantaneous set voltage that allows cargo to enter the interior of the entity (such as the cytoplasm of a cell). In the example of a cell, even if it is not the majority, at least some cells remain viable. Electroporation can be performed in vitro, in vivo or in vitro to cells and other entities. Electroporation conditions (e.g., cell number, cargo concentration, recovery conditions, voltage, time, capacitance, pulse type, pulse length, volume, electrocup length, electroporation solution composition, etc.) vary according to several factors, including but not limited to the type of cell or other receptor entity, cargo to be delivered, desired internalization efficiency, and desired vigor. The optimization of such standards is within the scope of those skilled in the art. Various devices and schemes can be used for electroporation. Examples include but are not limited to Transfection system, Flow Electroporation TM , Nucleofector TM Systems and Bio- Electroporation system.

[0368] Other means for introducing an engineered nucleic acid (eg, any of the engineered nucleic acids described herein) into a cell or other target receptor entity include, but are not limited to, sonication, gene gun, hydrodynamic injection, and deformation of the cell membrane by physical means.

[0369] Compositions and methods for delivering engineered mRNA (such as naked plasmids or mRNA) in vivo are described in detail in Kowalski et al., (Mol. Ther. 2019 Apr 10;27(4):710–728) and Kaczmarek et al., (Genome Med. 2017;9:60), each of which is incorporated herein by reference for all purposes.

[0370] How to use

[0371] Methods for treating diseases are also encompassed in the present disclosure. The method comprises administering a therapeutically effective amount of an engineered nucleic acid, engineered cell, or isolated cell as described above. In some aspects, provided herein is a method for treating a subject in need thereof, the method comprising administering a therapeutically effective dose of any engineered cell, isolated cell, or composition disclosed herein.

[0372] In some aspects, provided herein is a method of increasing expression of a target gene, e.g., a tumor suppressor gene.

[0373] In some aspects, the present invention provides a method for increasing the expression of a target gene, for example, an immunomodulatory gene. Exemplary immunomodulatory genes include, for example, but not limited to, cytokines, chemokines, their receptors, and their derivatives.

[0374] In some aspects, provided herein are methods of stimulating a cell-mediated immune response against tumor cells in a subject, the method comprising administering to a subject having a tumor a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0375] In some aspects, provided herein are methods of providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0376] In some aspects, provided herein are methods of treating a subject having cancer, the method comprising administering a therapeutically effective dose of any of the engineered cells, isolated cells, or compositions disclosed herein.

[0377] In some aspects, provided herein are methods of reducing tumor volume in a subject, the method comprising administering to a subject having a tumor a composition comprising any of the engineered cells, isolated cells, or compositions disclosed herein.

[0378] In some embodiments, the administration comprises systemic administration. In some embodiments, the administration comprises intratumoral administration. In some embodiments, the isolated cells are derived from a subject. In some embodiments, the isolated cells are allogeneic to the subject.

[0379] In some embodiments, the method further includes administering a checkpoint inhibitor. The checkpoint inhibitor is selected from: anti-PD-1 antibody, anti-PD-L1 antibody, anti-PD-L2 antibody, anti-CTLA-4 antibody, anti-LAG-3 antibody, anti-TIM-3 antibody, anti-TIGIT antibody, anti-VISTA antibody, anti-KIR antibody, anti-B7-H3 antibody, anti-B7-H4 antibody, anti-HVEM antibody, anti-BTLA antibody, anti-GAL9 antibody, anti-A2AR antibody, anti-phosphatidylserine antibody, anti-CD27 antibody, anti-TNFa antibody, anti-TREM1 antibody and anti-TREM2 antibody. In some embodiments, the method further includes administering an anti-CD40 antibody.

[0380] In some embodiments, the tumor is selected from the group consisting of adenocarcinoma, bladder tumor, brain tumor, breast tumor, cervical tumor, colorectal tumor, esophageal tumor, glioma, kidney tumor, liver tumor, lung tumor, melanoma, mesothelioma, ovarian tumor, pancreatic tumor, gastric tumor, testicular yolk sac tumor, prostate tumor, skin tumor, thyroid tumor, and uterine tumor.

[0381] Some methods include selecting a subject (or patient population) having a tumor (or cancer) and treating the subject with engineered cells or delivery vehicles that modulate tumor-mediated immunosuppression mechanisms.

[0382] The methods provided herein also include formulations for delivery of engineered cells or delivery vehicles. In some embodiments, the formulation is a substantially pure formulation containing, for example, less than 5% (e.g., less than 4%, 3%, 2% or 1%) cells other than engineered cells. The formulation may include 1 x 10 5 cells / kg to 1x10 7 cells / kg cells.

[0383] The method provided herein also includes the combination of medicine or pharmaceutical composition and any one of the engineered cells disclosed herein, the cells separated or the composition of the treatment effective dose, so that ACP is induced and / or repressor protease is repressed.For example, tamoxifen or its metabolites (for example, 4-hydroxy tamoxifen, N-desmethyl tamoxifen, tamoxifen-N-oxide or endoxifen) can be used to induce ACP. Medicine or medicament can be used before any one of the engineered cells disclosed herein, the cells separated or the composition, in parallel with the use thereof, in parallel with the use thereof and / or after the use thereof. Medicine or medicament can be used continuously. Medicine or medicament can be used in parallel or simultaneously with the use of any one of the engineered cells disclosed herein, the cells separated or the composition. Compared with the use of any one of the engineered cells disclosed herein, the cells separated or the composition (for example, before or after the use), medicine or medicament can be used at a separate time interval. Compared to any one of the engineered cells, isolated cells or compositions disclosed herein, the drug or medicament can be administered concurrently / simultaneously and at separate time intervals. The drug or pharmaceutical composition and the engineered cells, isolated cells or compositions can be administered by different routes, for example, the drug or pharmaceutical composition can be administered orally, and the engineered cells, isolated cells or compositions can be administered intraperitoneally, intravenously, subcutaneously or by any other route suitable for administration, as will be understood by those skilled in the art.

[0384] The specific dosage level and frequency of administration for any particular patient may vary and will depend on a variety of factors, including the activity of the specific compound employed, the metabolic stability and duration of action of the compound, the age, body weight, general health, sex, diet, mode and time of administration, rate of excretion, drug combination, the severity of the particular condition, and the host being treated.

[0385] The methods provided herein comprise administering a protease inhibitor. In some embodiments, the NS3 protease can be inhibited by a protease inhibitor. Any suitable protease inhibitor can be used, including but not limited to simeprevir, danoprevir, asunaprevir, ciluruprevir, boceprevir, sovarprevir, paritaprevir, telaprevir, grazoprevir, glecaprevir and voxiprevir or any combination thereof. In some embodiments, the protease inhibitor is selected from: simeprevir, danoprevir, asunaprevir, ciluruprevir, boceprevir, sovarprevir, paritaprevir, telaprevir, grazoprevir, glecaprevir and voxiprevir.

[0386] In some embodiments, the protease inhibitor is grazoprevir. In some embodiments, the protease inhibitor is a combination of grazoprevir and elbasvir (NS5A inhibitor of the hepatitis C virus NS5A replication complex). Grazoprevir and elbasvir can be co-formulated as a pharmaceutical composition, such as in tablet form (e.g., under the trade name Tablets obtained). Grazoprevir and elbasvir can be co-formulated in a weight ratio of 2:1, such as a unit dose of 100 mg grazoprevir and 50 mg elbasvir (e.g., as available under the trade name The protease inhibitor can be administered at a dose that is capable of inhibiting the repressive protease domain of ACP. The protease inhibitor can be administered at an approved dose for another indication. As an illustrative, non-limiting example, Zepatier can be administered at its approved dose for the treatment of HCV.

[0387] Grazoprevir (including combinations with Elbasvir) can be orally administered in a dosage range of 0.001 to 1000 mg / kg of mammal (e.g., human) body weight per day in a single dose or divided doses. One dosage range is 0.01 to 500 mg / kg body weight per day orally in a single dose or divided doses. Another dosage range is 0.1 to 100 mg / kg body weight per day orally in a single dose or divided doses. For oral administration, Grazoprevir (including combinations with Elbasvir) can be provided in the form of tablets or capsules containing 1.0 to 500 mg of active ingredient, particularly 1, 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 400, 500 and 750 mg of active ingredient for symptomatic adjustment of the dosage of the patient to be treated. In general, the total daily dose of grazoprevir (including combination with Elbasvir) can be in the range of about 1 to about 2500 mg per day, but will inevitably change according to the treatment goals, patients and administration routes. In one embodiment, the dosage of grazoprevir (including combination with Elbasvir) is about 10 to about 1000 mg / day, administered in a single dose or in 2-4 doses. In another embodiment, the dosage of grazoprevir (including combination with Elbasvir) is about 1 to about 500 mg / day, administered in a single dose or in 2-4 doses. In another embodiment, the dosage of grazoprevir (including combination with Elbasvir) is about 1 to about 100 mg / day, administered in a single dose or in 2-4 doses. In another embodiment, the dosage of grazoprevir (including combination with Elbasvir) is about 1 to about 50 mg / day, administered in a single dose or in 2-4 doses. In another embodiment, the dosage of grazoprevir (including in combination with Elbasvir) is about 500 to about 1500 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage of grazoprevir (including in combination with Elbasvir) is about 500 to about 1000 mg / day, administered in a single dose or in 2-4 divided doses. In another embodiment, the dosage of grazoprevir (including in combination with Elbasvir) is about 100 to about 500 mg / day, administered in a single dose or in 2-4 divided doses.

[0388] In vivo expression

[0389] The methods provided herein also include in vivo delivery compositions that can produce engineered cells as described herein, for example, any engineered nucleic acid as described herein can be delivered to cells in vivo. Such compositions include any viral-mediated delivery platform, any lipid structure delivery system, any nanoparticle delivery system, any genome editing system, or any other engineered delivery system described herein that can engineer cells in vivo.

[0390] The methods provided herein also include delivering in vivo a composition capable of producing any effector molecule described herein. The methods provided herein also include delivering in vivo a composition capable of producing two or more effector molecules described herein. The composition capable of producing effector molecules in vivo includes but is not limited to any engineered nucleic acid described herein. The composition capable of producing effector molecules in vivo can be naked mRNA or naked plasmid.

[0391] Pharmaceutical composition

[0392] The engineered nucleic acid or engineered cell can be formulated into a pharmaceutical composition. In addition to one or more engineered nucleic acids or engineered cells, these compositions can also include pharmaceutically acceptable excipients, carriers, buffers, stabilizers or other materials well known to those skilled in the art. Such materials should be nontoxic and should not interfere with the efficacy of the active ingredient. The exact nature of the carrier or other materials can depend on the route of administration, such as oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.

[0393] Pharmaceutical compositions for oral administration can be in tablet, capsule, powder or liquid form. Tablets can include solid carriers such as gelatin or adjuvants. Liquid pharmaceutical compositions usually include liquid carriers such as water, petroleum, animal or vegetable oils, mineral oils or synthetic oils. Physiological saline solutions, glucose or other sugar solutions or glycols such as ethylene glycol, propylene glycol or polyethylene glycol can be included.

[0394] For intravenous, cutaneous or subcutaneous injection, or injection at the affected part, the active ingredient will be in the form of an acceptable aqueous solution for parenteral administration, which is pyrogen-free and has suitable pH, isotonicity and stability. Those skilled in the art are fully capable of using, for example, isotonic vehicles such as sodium chloride injection, Ringer's injection, lactated Ringer's injection to prepare suitable solutions. Preservatives, stabilizers, buffers, antioxidants and / or other additives may be included as needed.

[0395] Whether a polypeptide, nucleic acid, small molecule or other pharmaceutically useful compound according to the present disclosure is administered to an individual, it is preferably administered in a "therapeutically effective amount" or a "prophylactically effective amount" (as the case may be, although prevention can be considered treatment), which is also sufficient to show benefit to the individual. The actual amount administered and the rate and time course of administration will depend on the nature and severity of the protein aggregation disease being treated. The prescription of treatment, such as decisions about dosage, etc., is within the responsibility of general practitioners and other physicians, and generally takes into account the condition to be treated, the condition of the individual patient, the delivery site, the method of administration, and other factors known to the practitioner. Examples of the above-mentioned techniques and protocols can be found in Remington's Pharmaceutical Sciences, 16th edition, Osol, A. (ed.), 1980.

[0396] The compositions may be administered alone or in combination with other therapies, either simultaneously or sequentially, depending on the condition to be treated.

[0397] Reagent test kit

[0398] Some aspects of the present disclosure relate to a test kit for treating and / or preventing cancer (e.g., solid tumors). In certain embodiments, the test kit comprises a treatment or prevention composition, which comprises an effective amount of one or more chimeric receptors of the present disclosure, isolated nucleic acids of the present disclosure, carriers of the present disclosure, and / or cells of the present disclosure (e.g., immune response cells). In certain embodiments, the test kit comprises a sterile container. In certain embodiments, such containers may be boxes, ampoules, bottles, vials, tubes, bags, pouches, blister packs, or other suitable container forms as known in the art. The container may be made of plastic, glass, laminated paper, metal foil, or other materials suitable for accommodating a pharmaceutical agent (medicament).

[0399] In some embodiments, a therapeutic or preventive composition is provided together with instructions for administering the therapeutic or preventive composition to a subject suffering from cancer (e.g., a solid tumor) or a risk of developing cancer. In some embodiments, the instructions may include information about the use of the composition for treating and / or preventing a condition. In some embodiments, the instructions include, but are not limited to, descriptions of the therapeutic or preventive composition, dosage schedules, schedules for administration for treating or preventing a condition or its symptoms, precautions, warnings, indications, counter-indications, overdose information, adverse reactions, animal pharmacology, clinical studies, and / or references. In some embodiments, the instructions may be printed directly on the container (when present), or as a label applied to the container, or as a separate paper, brochure, card, or folder provided in or with the container.

[0400] Other embodiments

[0401] Embodiment 1: An engineered CCL3 promoter comprising ablation of at least one nucleotide motif, wherein the ablation increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal.

[0402] Embodiment 2: The engineered CCL3 promoter according to embodiment 1, wherein the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO:132.

[0403] Embodiment 3: The engineered CCL3 promoter according to embodiment 1 or embodiment 2, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif comprises a sequence selected from the group consisting of: position 566 to position 576 of SEQ ID NO: 132, position 674 to position 695 of SEQ ID NO: 132, position 820 to position 832 of SEQ ID NO: 132, position 1089 to position 1105 of SEQ ID NO: 132, position 1127 to position 1141 of SEQ ID NO: 132, position 1184 to position 1199 of SEQ ID NO: 132, position 1475 to position 1500 of SEQ ID NO: 132, position 1534 to position 1544 of SEQ ID NO: 132, position 1553 to position 1595 of SEQ ID NO: 132, position 1634 to position 1674 of SEQ ID NO: 132, position 1680 to position 1694 of SEQ ID NO: 132 Position 1681 to position 1692 of SEQ ID NO:132 and position 1982 to position 1998 of SEQ ID NO:132.

[0404] Embodiment 4: The engineered CCL3 promoter according to any one of embodiments 1 to 3, wherein the ablation comprises a substitution or deletion of one or more nucleotides of the at least one nucleotide motif.

[0405] Embodiment 5: An engineered CCL3 promoter according to any one of embodiments 1 to 4, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 566 to position 576 of SEQ ID NO: 132.

[0406] Embodiment 6: The engineered CCL3 promoter according to embodiment 5, wherein the ablation comprises a nucleotide substitution comprising the sequence GTACCAGAATA (SEQ ID NO: 191) from position 566 to position 576 of SEQ ID NO: 132.

[0407] Embodiment 7: The engineered CCL3 promoter according to Embodiment 5, wherein the ablation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO:132.

[0408] Embodiment 8: An engineered CCL3 promoter according to any one of Embodiments 1 to 7, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 674 to position 695 of SEQ ID NO: 132.

[0409] Embodiment 9: The engineered CCL3 promoter according to embodiment 8, wherein the ablation comprises a nucleotide substitution comprising the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO: 193) from position 674 to position 695 of SEQ ID NO: 132.

[0410] Embodiment 10: The engineered CCL3 promoter according to Embodiment 8, wherein the ablation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO:132.

[0411] Embodiment 11: An engineered CCL3 promoter according to any one of Embodiments 1 to 10, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 820 to position 832 of SEQ ID NO: 132.

[0412] Embodiment 12: The engineered CCL3 promoter according to embodiment 11, wherein the ablation comprises a nucleotide substitution comprising the sequence ACGAAGCAATACT (SEQ ID NO: 195) from position 820 to position 832 of SEQ ID NO: 132.

[0413] Embodiment 13: The engineered CCL3 promoter according to Embodiment 11, wherein the ablation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132.

[0414] Embodiment 14: An engineered CCL3 promoter according to any one of Embodiments 1 to 13, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1089 to position 1105 of SEQ ID NO: 132.

[0415] Embodiment 15: The engineered CCL3 promoter according to embodiment 14, wherein the ablation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO: 199) from position 1089 to position 1105 of SEQ ID NO: 132.

[0416] Embodiment 16: The engineered CCL3 promoter according to Embodiment 14, wherein the ablation comprises a nucleotide deletion from position 1089 to position 1105 of SEQ ID NO:132.

[0417] Embodiment 17: An engineered CCL3 promoter according to any one of Embodiments 1 to 16, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1127 to position 1141 of SEQ ID NO: 132.

[0418] Embodiment 18: The engineered CCL3 promoter according to embodiment 17, wherein the ablation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO: 201) from position 1127 to position 1141 of SEQ ID NO: 132.

[0419] Embodiment 19: The engineered CCL3 promoter according to Embodiment 17, wherein the ablation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO:132.

[0420] Embodiment 20: An engineered CCL3 promoter according to any one of Embodiments 1 to 19, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1184 to position 1199 of SEQ ID NO: 132.

[0421] Embodiment 21: The engineered CCL3 promoter according to embodiment 20, wherein the ablation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132.

[0422] Embodiment 22: The engineered CCL3 promoter according to Embodiment 20, wherein the ablation comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO:132.

[0423] Embodiment 23: An engineered CCL3 promoter according to any one of Embodiments 1 to 22, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1475 to position 1500 of SEQ ID NO: 132.

[0424] Embodiment 24: The engineered CCL3 promoter according to embodiment 23, wherein the ablation comprises a nucleotide substitution comprising the sequence CCGATCTCTAGTTAAGTTAGCTGTAT (SEQ ID NO: 217) from position 1475 to position 1500 of SEQ ID NO: 132.

[0425] Embodiment 25: The engineered CCL3 promoter according to Embodiment 23, wherein the ablation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO:132.

[0426] Embodiment 26: An engineered CCL3 promoter according to any one of Embodiments 1 to 25, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO: 132.

[0427] Embodiment 27: The engineered CCL3 promoter according to embodiment 26, wherein the ablation comprises a nucleotide substitution comprising the sequence GTAGAACTCTT (SEQ ID NO: 219) from position 1534 to position 1544 of SEQ ID NO: 132.

[0428] Embodiment 28: The engineered CCL3 promoter according to Embodiment 26, wherein the ablation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO:132.

[0429] Embodiment 29: An engineered CCL3 promoter according to any one of Embodiments 1 to 28, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1553 to position 1595 of SEQ ID NO: 132.

[0430] Embodiment 30: The engineered CCL3 promoter according to embodiment 29, wherein the ablation comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATCTTCATATTACCTCCA (SEQ ID NO: 221) from position 1553 to position 1595 of SEQ ID NO: 132.

[0431] Embodiment 31: The engineered CCL3 promoter according to Embodiment 29, wherein the ablation comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO:132.

[0432] Embodiment 32: An engineered CCL3 promoter according to any one of Embodiments 1 to 31, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1634 to position 1645 of SEQ ID NO: 132.

[0433] Embodiment 33: The engineered CCL3 promoter according to embodiment 32, wherein the ablation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO: 223) from position 1634 to position 1645 of SEQ ID NO: 132.

[0434] Embodiment 34: The engineered CCL3 promoter according to Embodiment 32, wherein the ablation comprises a nucleotide deletion from position 1634 to position 1645 of SEQ ID NO:132.

[0435] Embodiment 35: An engineered CCL3 promoter according to any one of Embodiments 1 to 34, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1663 to position 1674 of SEQ ID NO: 132.

[0436] Embodiment 36: The engineered CCL3 promoter according to embodiment 35, wherein the ablation comprises a nucleotide substitution comprising the sequence TATACCTTGGTT (SEQ ID NO: 225) from position 1663 to position 1674 of SEQ ID NO: 132.

[0437] Embodiment 37: The engineered CCL3 promoter according to Embodiment 35, wherein the ablation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO:132.

[0438] Embodiment 38: An engineered CCL3 promoter according to any one of Embodiments 1 to 37, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132.

[0439] Embodiment 39: The engineered CCL3 promoter according to embodiment 38, wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132.

[0440] Embodiment 40: The engineered CCL3 promoter according to embodiment 39, wherein the engineered CCL3 promoter comprises the polynucleotide of SEQ ID NO:4.

[0441] Embodiment 41: The engineered CCL3 promoter according to Embodiment 38, wherein the ablation comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO:132.

[0442] Embodiment 42: An engineered CCL3 promoter according to any one of Embodiments 1 to 40, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1982 to position 1998 of SEQ ID NO: 132.

[0443] Embodiment 43: The engineered CCL3 promoter according to Embodiment 42, wherein the ablation comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO: 241) from position 1982 to position 1998 of SEQ ID NO: 132.

[0444] Embodiment 44: The engineered CCL3 promoter according to Embodiment 42, wherein the ablation comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO:132.

[0445] Embodiment 45: The engineered CCL3 promoter according to any one of embodiments 1 to 44, wherein the ablation comprises ablation of at least two nucleotide motifs.

[0446] Embodiment 46: The engineered CCL3 promoter according to any one of embodiments 1 to 45, wherein the ablation comprises ablation of at least three nucleotide motifs.

[0447] Embodiment 47: The engineered CCL3 promoter according to any one of embodiments 1 to 46, wherein the ablation comprises ablation of at least four nucleotide motifs.

[0448] Embodiment 48: The engineered CCL3 promoter according to any one of embodiments 1 to 47, wherein the ablation comprises ablation of at least five nucleotide motifs.

[0449] Embodiment 49: The engineered CCL3 promoter according to any one of embodiments 1 to 48, wherein the ablation comprises ablation of at least six nucleotide motifs.

[0450] Embodiment 50: The engineered CCL3 promoter according to embodiment 49, wherein the at least six nucleotide motifs include:

[0451] a. the nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132,

[0452] b. the nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132,

[0453] c. the nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132,

[0454] d. the nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132,

[0455] e. the nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132, and

[0456] f. The nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO:132.

[0457] Embodiment 51: The engineered CCL3 promoter according to Embodiment 50, wherein said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO:132.

[0458] Embodiment 52: The engineered CCL3 promoter according to Embodiment 50, wherein said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO:132.

[0459] Embodiment 53: The engineered CCL3 promoter according to Embodiment 50 or Embodiment 51, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132.

[0460] Embodiment 54: The engineered CCL3 promoter according to Embodiment 52, wherein the ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0461] Embodiment 55: The engineered CCL3 promoter according to Embodiment 52 or Embodiment 54, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO:132.

[0462] Embodiment 56: The engineered CCL3 promoter according to Embodiment 55, wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132.

[0463] Embodiment 57: The engineered CCL3 promoter according to Embodiment 56, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:2.

[0464] Embodiment 58: The engineered CCL3 promoter according to Embodiment 56, wherein said ablation of the nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0465] Embodiment 59: The engineered CCL3 promoter according to any one of embodiments 52 to 57, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO: 132.

[0466] Embodiment 60: The engineered CCL3 promoter according to Embodiment 59, wherein the ablation of the nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO: 132 comprises a deletion of the nucleotide motif.

[0467] Embodiment 61: The engineered CCL3 promoter according to Embodiment 57, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:1.

[0468] Embodiment 62: The engineered CCL3 promoter according to any one of embodiments 1 to 60, wherein the ablation comprises ablation of at least nine nucleotide motifs.

[0469] Embodiment 63: The engineered CCL3 promoter according to Embodiment 61, wherein the at least nine nucleotide motifs comprise:

[0470] The nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132,

[0471] The nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132,

[0472] The nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132,

[0473] The nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132,

[0474] The nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132,

[0475] The nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132,

[0476] The nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO: 132,

[0477] a nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO: 132, and

[0478] The nucleotide motif corresponds to positions 1681-1692 of SEQ ID NO:132.

[0479] Embodiment 64: The engineered CCL3 promoter according to Embodiment 63, wherein the ablation comprises a deletion of each of the at least nine nucleotide motifs.

[0480] Embodiment 65: The engineered CCL3 promoter of Embodiment 62 or Embodiment 63, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3.

[0481] Embodiment 66: The engineered CCL3 promoter according to Embodiment 62, wherein the at least nine nucleotide motifs comprise:

[0482] The nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132,

[0483] The nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132,

[0484] The nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132,

[0485] The nucleotide motif corresponding to positions 911-926 of SEQ ID NO: 132,

[0486] The nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132,

[0487] The nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132,

[0488] The nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132,

[0489] a nucleotide motif corresponding to positions 1211-1223 of SEQ ID NO: 132, and

[0490] The nucleotide motif corresponding to positions 1236-1248 of SEQ ID NO:132.

[0491] Embodiment 67: The engineered CCL3 promoter according to Embodiment 62, wherein said ablation of said at least nine nucleotide motif comprises a deletion corresponding to position 556 to position 1248 of SEQ ID NO:132.

[0492] Embodiment 68: The engineered CCL3 promoter according to Embodiment 62, wherein said ablation of said at least nine nucleotide motif comprises a deletion corresponding to position 550 to position 1250 of SEQ ID NO:132.

[0493] Embodiment 69: The engineered CCL3 promoter according to Embodiment 68, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1425 to position 1445 of SEQ ID NO:132.

[0494] Embodiment 70: The engineered CCL3 promoter according to Embodiment 69, wherein said ablation of the nucleotide motif corresponding to positions 1425-1445 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0495] Embodiment 71: The engineered CCL3 promoter according to any one of embodiments 68 to 70, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO:132.

[0496] Embodiment 72: The engineered CCL3 promoter according to Embodiment 71, wherein said ablation of said nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0497] Embodiment 73: The engineered CCL3 promoter according to any one of embodiments 68 to 72, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132.

[0498] Embodiment 74: The engineered CCL3 promoter according to Embodiment 73, wherein said ablation of said nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0499] Embodiment 75: The engineered CCL3 promoter according to any one of Embodiments 68 to 74, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132.

[0500] Embodiment 76: The engineered CCL3 promoter according to Embodiment 75, wherein said ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0501] Embodiment 77: An engineered CCL3 promoter according to any one of Embodiments 68 to 76, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132.

[0502] Embodiment 78: The engineered CCL3 promoter according to Embodiment 77, wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132.

[0503] Embodiment 79: The engineered CCL3 promoter according to Embodiment 78, wherein the CCL3 promoter comprises SEQ ID NO:242.

[0504] Embodiment 80: The engineered CCL3 promoter according to any one of embodiments 68 to 72, wherein the ablation comprises a deletion of at least two nucleotide motifs from position 1425 to position 1500 according to SEQ ID NO:132.

[0505] Embodiment 81: The engineered CCL3 promoter according to Embodiment 80, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132.

[0506] Embodiment 82: The engineered CCL3 promoter according to Embodiment 81, wherein said ablation of the nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0507] Embodiment 83: The engineered CCL3 promoter according to any one of Embodiments 80 to 82, wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132.

[0508] Embodiment 84: The engineered CCL3 promoter according to Embodiment 83, wherein said ablation of the nucleotide motif corresponding to positions 1663-1679 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif.

[0509] Embodiment 85: An engineered CCL3 promoter according to any one of Embodiments 80 to 84, wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132.

[0510] Embodiment 86: The engineered CCL3 promoter of Embodiment 85, wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132.

[0511] Embodiment 87: The engineered CCL3 promoter according to any one of Embodiments 80 to 86, wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132.

[0512] Embodiment 88: The engineered CCL3 promoter according to Embodiment 87, wherein the CCL3 promoter comprises SEQ ID NO:243.

[0513] Embodiment 89: The engineered CCL3 promoter according to Embodiment 87 or 88, wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132.

[0514] Embodiment 90: An engineered CCL3 promoter according to Embodiment 89, wherein the CCL3 promoter comprises SEQ ID NO:244.

[0515] Embodiment 91: The engineered CCL3 promoter according to any one of embodiments 80 to 89, wherein the ablation further comprises a deletion of position 1663 to position 1692 of SEQ ID NO:132.

[0516] Embodiment 92: The engineered CCL3 promoter according to Embodiment 91, wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132.

[0517] Embodiment 93: The engineered CCL3 promoter according to any one of Embodiments 91 to 92, wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132.

[0518] Embodiment 94: An engineered CCL3 promoter according to any one of Embodiments 91 to 93, wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 245.

[0519] Example 95: An engineered CCL3 promoter comprising at least one nucleotide motif.

[0520] Embodiment 96: The engineered CCL3 promoter according to embodiment 95, wherein the at least one nucleotide motif is selected from the group consisting of:

[0521] The nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132,

[0522] The nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132,

[0523] The nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132,

[0524] The nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132,

[0525] The nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132,

[0526] The nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132,

[0527] The nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132,

[0528] The nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132,

[0529] The nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132,

[0530] The nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132,

[0531] The nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132,

[0532] The nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132,

[0533] The nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132,

[0534] a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and

[0535] The nucleotide motif corresponds to positions 1840-1861 of SEQ ID NO:132.

[0536] Embodiment 97: The engineered CCL3 promoter according to embodiment 95, comprising at least fifteen nucleotide motifs comprising:

[0537] The nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132,

[0538] The nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132,

[0539] The nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132,

[0540] The nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132,

[0541] The nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132,

[0542] The nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132,

[0543] The nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132,

[0544] The nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132,

[0545] The nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132,

[0546] The nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132,

[0547] The nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132,

[0548] The nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132,

[0549] The nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132,

[0550] a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and

[0551] The nucleotide motif corresponds to positions 1840-1861 of SEQ ID NO:132.

[0552] Embodiment 98: An engineered CCL3 promoter according to any one of Embodiments 95 to 97, wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 246.

[0553] Example 99: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:1.

[0554] Example 100: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:2.

[0555] Example 101: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:3.

[0556] Example 102: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:4.

[0557] Example 103: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:242.

[0558] Example 104: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO: 243.

[0559] Example 105: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO:244.

[0560] Example 106: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO: 245.

[0561] Example 107: An engineered CCL3 promoter comprising the polynucleotide sequence of SEQ ID NO: 246.

[0562] Embodiment 108: A heterologous construct comprising the engineered CCL3 promoter of any one of embodiments 1 to 107 operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide.

[0563] Embodiment 109: The heterologous construct of Embodiment 108, wherein the polypeptide comprises at least one effector molecule.

[0564] Embodiment 110: The heterologous construct of Embodiment 108 or Embodiment 109, wherein the polypeptide comprises a first effector molecule and a second effector molecule.

[0565] Embodiment 111: The heterologous construct of Embodiment 110, wherein the polynucleotide comprises a polynucleotide sequence encoding the first effector molecule, a linker polynucleotide sequence, and a polynucleotide sequence encoding the second effector.

[0566] Embodiment 112: The heterologous construct of Embodiment 111, wherein the linker polynucleotide sequence encodes one or more 2A ribosomal skipping elements.

[0567] Embodiment 113: The heterologous construct of Embodiment 112, wherein the one or more 2A ribosomal skipping elements comprise elements each selected from the group consisting of: P2A, T2A, E2A, and F2A.

[0568] Embodiment 114: A heterologous construct according to any one of Embodiments 109 to 113, wherein the at least one effector molecule is selected from the group consisting of therapeutic classes, wherein the therapeutic classes are selected from the group consisting of: cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides and enzymes.

[0569] Embodiment 115: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a cytokine.

[0570] Embodiment 116: A heterologous construct according to Embodiment 115, wherein the cytokine is selected from the group consisting of: IL1-β, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-γ and TNF-α.

[0571] Embodiment 117: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a chemokine.

[0572] Embodiment 118: The heterologous construct of Embodiment 117, wherein the chemokine is selected from the group consisting of CCL21a, CXCL10, CXCL11, CXCL13, CXCL10-CXCL11 fusion protein, CCL19, CXCL9 and XCL1.

[0573] Embodiment 119: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a homing molecule.

[0574] Embodiment 120: A heterologous construct according to Embodiment 119, wherein the homing molecule is selected from the group consisting of: anti-integrin α4, β7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15.

[0575] Embodiment 121: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a growth factor.

[0576] Embodiment 122: The heterologous construct of Embodiment 121, wherein the growth factor is selected from the group consisting of: FLT3L and GM-CSF.

[0577] Embodiment 123: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a co-activator molecule.

[0578] Embodiment 124: The heterologous construct of Embodiment 123, wherein the co-activator molecule is selected from the group consisting of: c-Jun, 4-1BBL and CD40L.

[0579] Embodiment 125: The heterologous construct of any one of Embodiments 109 to 114, wherein each of said at least one effector molecule comprises a tumor microenvironment modifier.

[0580] Embodiment 126: The heterologous construct of Embodiment 123, wherein the tumor microenvironment modifier is selected from the group consisting of: adenosine deaminase, TGFβ inhibitor, immune checkpoint inhibitor, VEGF inhibitor and HPGE2.

[0581] Embodiment 127: The heterologous construct of any one of Embodiments 110 to 114, wherein each of said first effector molecule and said second effector molecule is from a separate therapeutic class.

[0582] Embodiment 128: The heterologous construct according to any one of Embodiments 109 to 127, wherein each of said at least one effector molecule is a human-derived effector molecule.

[0583] Embodiment 129: A vector comprising the heterologous construct according to any one of embodiments 108 to 128.

[0584] Embodiment 130: A dual expression vector comprising the heterologous construct according to any one of embodiments 108 to 128 and a second construct comprising a polynucleotide sequence encoding an activating immune receptor.

[0585] Embodiment 131: According to the dual expression vector of Embodiment 130, wherein the activated immune receptor comprises an antigen recognition receptor.

[0586] Embodiment 132: According to the dual expression vector of Embodiment 131, wherein the antigen recognition receptor comprises a T cell receptor (TCR).

[0587] Embodiment 133: According to the dual expression vector of Embodiment 132, wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor.

[0588] Embodiment 134: The dual expression vector of Embodiment 132 or Embodiment 133, wherein the TCR is an endogenous T cell receptor.

[0589] Embodiment 135: A dual expression vector according to Embodiment 132 or Embodiment 133, wherein the TCR is an exogenous T cell receptor.

[0590] Example 136: According to the dual expression vector of Example 131, wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR).

[0591] Embodiment 137: An immune response cell comprising the heterologous construct of any one of embodiments 108 to 128, the vector of embodiment 129, or the dual expression vector of any one of embodiments 130 to 136.

[0592] Example 138: An immune response cell according to Example 137, wherein the immune response cell is selected from the group consisting of: T cells, CD8+T cells, CD4+T cells, γ-δT cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, red blood cells, platelet cells, human embryonic stem cells (ESC), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSC), induced pluripotent stem cells (iPSC) and iPSC-derived cells.

[0593] Embodiment 139: According to the immune response cell of Embodiment 137, wherein the immune response cell is a T cell.

[0594] Embodiment 140: According to the immune response cell of Embodiment 137, wherein the immune response cell is a NK cell.

[0595] Embodiment 141: An immune response cell according to any one of Embodiments 137 to 140, wherein the immune response cell expresses an activating immune receptor.

[0596] Embodiment 142: According to the immune response cell of embodiment 141, wherein the activated immune receptor comprises an antigen recognition receptor.

[0597] Embodiment 143: According to the immune response cell of embodiment 142, wherein the antigen recognition receptor comprises a T cell receptor (TCR).

[0598] Embodiment 144: According to the immune response cell of embodiment 143, wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor.

[0599] Embodiment 145: An immune response cell according to Embodiment 143 or 144, wherein the TCR is an endogenous T cell receptor.

[0600] Embodiment 146: An immune response cell according to Embodiment 143 or 144, wherein the TCR is an exogenous T cell receptor.

[0601] Example 147: An immune response cell according to Example 142, wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR).

[0602] Embodiment 148: According to the immune response cell of embodiment 142, wherein the antigen recognition receptor comprises an activating NK cell receptor.

[0603] Embodiment 149: The immune response cell according to Embodiment 148, wherein the activating NK cell receptor is selected from the group consisting of: NKG2D, NKp30, NKp44, NKp46 and ITAM-containing killer cell Ig-like receptor (KIR).

[0604] Embodiment 150: The immune response cell of Embodiment 148 or 149, wherein the activating NK cell receptor is NKG2D.

[0605] Embodiment 151: According to the immune response cell of embodiment 148 or 149, wherein the activating NK cell receptor is NKp30.

[0606] Embodiment 152: An immune response cell according to Embodiment 148 or 149, wherein the activating NK cell receptor is NKp44.

[0607] Embodiment 153: An immune response cell according to Embodiment 148 or 149, wherein the activating NK cell receptor is NKp46.

[0608] Embodiment 154: An immune response cell according to Embodiment 148 or 149, wherein the activating NK cell receptor is an ITAM-containing KIR.

[0609] Embodiment 155: An immune response cell according to any one of Embodiments 142 to 147, wherein the immune response cell comprises a heterologous construct encoding the antigen recognition receptor.

[0610] Embodiment 156: The immune response cell according to any one of Embodiments 137 to 155, wherein the immune response cell is autologous.

[0611] Embodiment 157: The immune response cell according to any one of Embodiments 137 to 155, wherein the immune response cell is allogeneic.

[0612] Embodiment 158: A pharmaceutical composition comprising an engineered CCL3 promoter according to any one of embodiments 1 to 107, a heterologous construct according to any one of embodiments 108 to 128, a vector according to embodiment 129, a dual expression vector according to any one of embodiments 130 to 136, or an immune response cell according to any one of embodiments 137 to 157, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient, or a combination thereof.

[0613] Embodiment 159: A method of increasing the expression of a target gene, the method comprising increasing the expression of the target gene using the engineered CCL3 promoter of any one of embodiments 1 to 98, the heterologous construct of any one of embodiments 108 to 128, the vector of embodiment 129, or the dual expression vector of any one of embodiments 130 to 136.

[0614] Embodiment 160: The method according to Embodiment 159, wherein the target gene is an immune regulatory gene.

[0615] Embodiment 161: A method of treating a subject in need thereof, the method comprising administering an engineered CCL3 promoter according to any one of Embodiments 1 to 107, a heterologous construct according to any one of Embodiments 108 to 128, a therapeutically effective dose of a vector according to Embodiment 129, a dual expression vector according to any one of Embodiments 130 to 136, an immune response cell according to any one of Embodiments 137 to 157, or a pharmaceutical composition according to Embodiment 158.

[0616] Embodiment 162: A method of stimulating a cell-mediated immune response in a subject, the method comprising administering to the subject an engineered CCL3 promoter according to any one of Embodiments 1 to 107, a heterologous construct according to any one of Embodiments 108 to 128, a therapeutically effective dose of a vector according to any one of Embodiments 129, a dual expression vector according to any one of Embodiments 130 to 136, an immune response cell according to any one of Embodiments 137 to 157, or a pharmaceutical composition according to Embodiment 158.

[0617] Embodiment 163: A method of reducing tumor volume in a subject, the method comprising administering to a subject having a tumor a composition comprising an engineered CCL3 promoter according to any one of Embodiments 1 to 107, a heterologous construct according to any one of Embodiments 108 to 128, a vector according to Embodiment 129, a dual expression vector according to any one of Embodiments 130 to 136, an immune response cell according to any one of Embodiments 137 to 157, or a pharmaceutical composition according to Embodiment 158.

[0618] Embodiment 164: A method of providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof an engineered CCL3 promoter according to any one of Embodiments 1 to 107, a heterologous construct according to any one of Embodiments 108 to 128, a therapeutically effective dose of a vector according to Embodiment 56, a dual expression vector according to any one of Embodiments 130 to 136, an immune response cell according to any one of Embodiments 137 to 157, or a pharmaceutical composition according to Embodiment 158.

[0619] Embodiment 165: A method of treating a subject having cancer, the method comprising administering to a subject in need thereof an engineered CCL3 promoter according to any one of Embodiments 1 to 107, a heterologous construct according to any one of Embodiments 108 to 128, a therapeutically effective dose of a vector according to any one of Embodiments 129, a dual expression vector according to any one of Embodiments 130 to 136, an immune response cell according to any one of Embodiments 137 to 157, or a pharmaceutical composition according to Embodiment 158.

[0620] Embodiment 166: The method of any one of Embodiments 134 to 138, wherein said method comprises administering said immune response cells.

[0621] Embodiment 167: A kit for treating and / or preventing tumors, the kit comprising the immune response cell according to any one of Embodiments 137 to 157.

[0622] Embodiment 168: The kit according to Embodiment 167, wherein the kit further comprises written instructions for using the immune response cells to treat and / or prevent the tumor in the subject.

[0623] Example 169: A kit for treating and / or preventing tumors, comprising the pharmaceutical composition according to Example 158.

[0624] Embodiment 170: The kit according to Embodiment 169, wherein the kit further comprises written instructions for using the pharmaceutical composition to treat and / or prevent the tumor in the subject.

[0625] Examples

[0626] The following are examples of specific embodiments of the present invention. These examples are provided for illustrative purposes only and are not intended to limit the scope of the present invention in any way.

[0627] Efforts have been made to ensure accuracy with respect to numbers used (eg, amounts, temperature, etc.), but some experimental errors and deviations should, of course, be accounted for.

[0628] Example 1: Generation of a CCL3 promoter ablation series and evaluation in immune response cells

[0629] In order to provide a variant of the CCL3 promoter with reduced size, an engineering method was performed using the wild-type CCL3 promoter (SEQ ID NO: 132) as a template. Standard molecular cloning techniques known in the art were used to replace each regulatory element (e.g., transcription factor binding motif) with an artificial nucleotide sequence. After the introduction of the artificial nucleotide sequence, the new promoter sequence was analyzed bioinformatically to ensure that no new binding motifs were introduced. A total of 36 CCL3 promoter variants were generated. The sequences of these variants are provided in Table 1.

[0630] Inducibility of CCL3 promoter variants in T cells

[0631] The CCL3 promoter variants were then tested for inducibility. Briefly, Pan T cells isolated from peripheral blood mononuclear cells (PBMCs) derived from apheresis packs were incubated with CD3 / CD28 antibody-labeled beads at a 3:1 ratio for activation. After about 24 hours of incubation, Pan T cells were co-transduced with viruses containing a CCL3 promoter driving mKate-PEST virus and an exemplary CAR (including a GPC3-binding chimeric antigen receptor (CAR) having a CD8a hinge, a CD8a transmembrane domain, and a 4-1BB / CD3ζ intracellular domain. After about 72 hours, the beads were washed out. About 20,000 transduced Pan T cells were seeded per well on a 96-well plate and given about 24 hours to adhere. The transduced Pan T cells were activated with CD3 / CD28 beads at a 1:1 ratio for about 48 hours. The expression of mCherry (mKate) and YFP (GPC3) by the activated Pan T cells was then quantified by flow cytometry.

[0632] Quantification of fluorescence Figure 1 , normalized to the wild-type CCL3 promoter (SEQ ID NO: 132). The CCL3 promoter variants that exhibited the highest levels of inducibility were 4153 (SEQ ID NO: 161), 4141 (SEQ ID NO: 149), 4137 (SEQ ID NO: 145), 4136 (SEQ ID NO: 144), 4149 (SEQ ID NO: 157), 4135 (SEQ ID NO: 143), 4139 (SEQ ID NO: 147), and 4140 (SEQ ID NO: 148).

[0633] Inducibility of CCL3 promoter variants in natural killer (NK) cells

[0634] Activate natural killer (NK) cells derived from human donors with irradiated K562 feeder cells showing membrane-bound IL-21 and membrane-bound IL-15. On the 10th day after activation, NK cells were transduced with viruses. After 24 hours, the culture medium was changed, and the cells were then left to stand until the 18th day. As described above, NK cells were transduced with eight CCL3 promoter variants (4153, 4141, 4137, 4136, 4149, 4135, 4139 and 4140) showing the highest inducibility level in T cells. After incubation for about eight days, NK cells were activated by co-culturing with Huh7 cells at a 1:1 ratio, and cells were co-cultured for a total of about 24 hours or about 48 hours incubation. Then the mCherry (mKate) of activated and unactivated NK cells was evaluated by flow cytometry. Wild-type CCL3 promoter (2935), SFFV mKate (1682), and 2096 (NFAT mKate) were used as controls.

[0635] Quantification of fluorescence signal Figure 2A and Figure 2B As shown in. 24 hours after activation ( Figure 2A ) or 48 hours ( Figure 2B ), induction was observed for all constructs.

[0636] Figure 3A A histogram depicting the geometric mean fluorescence intensity (gMFI) of mKate (mCherry) of activated and non-activated NK cells after 24 hours of stimulation is shown. The 4153 promoter variants showed the highest mCherry fluorescence fold change compared to other CCL3 promoter variants, and the fold change was comparable to that observed in the NFAT promoter (2096) control. The fold change of mCherry was Figure 3B Such as Figure 3C and Figure 3D As shown in Figure 1 (1682 was removed due to its outlier level of gMFI), which depicts stimulated NK cells plotted against unstimulated NK cells, variants 4137, 4136, 4153 had the highest gMFI and low basal levels of mCherry expression at 24 hours of stimulation compared to the control. Figure 3C and 3D As seen, the 2096 promoter resulted in higher expression levels in both stimulated and unstimulated cells, and thus one benefit of the CCL3 promoter variant is inducibility based on NK cell activation, but with lower leakiness (ie, lower baseline expression) than the NFAT promoter.

[0637] Figure 4AA histogram depicting the geometric mean fluorescence intensity (gMFI) of mKate (mCherry) of activated and non-activated NK cells after 48 hours of stimulation is shown. The 4153 promoter variant showed the highest fold change in mCherry fluorescence compared to other CCL3 promoter variants, and the fold change was higher than that of the CCL3 promoter control (2935). The fold change of mCherry was Figure 4B Such as Figure 4C and Figure 4D As shown (1682 was removed due to its outlier level of gMFI), for stimulated NK cells plotted against unstimulated NK cells, variant 4153 showed the highest gMFI and low basal mCherry expression at 48 hours of stimulation compared to control.

[0638] Although the above studies were initially designed to identify CCL3 promoters with reduced size, it was surprisingly observed that ablation of a specific nucleotide motif in the CCL3 promoter provided enhanced inducibility of the variant promoter relative to the wild-type promoter.

[0639] Example 2: Generation of CCL3 promoter deletions and evaluation in immune response cells

[0640] To reduce the size of the CCL3 promoter with enhanced inducibility, deletion variants were engineered, comprising deletions at the positions substituted in the ablation patches as provided in Example 1 .

[0641] The first promoter variant construct 5958 was engineered to include a deletion of the motif at each ablation patch substituted in the following constructs: 4141, 4137, 4136, 4135, 4139, 4140, 4148, 4150, and 4153. The second promoter variant construct 5959 was engineered to delete the nucleotide sequence between, but not including, the ablation patches substituted in constructs 4134 and 4145 (from positions 550 to 1259 of SEQ ID NO: 132), and replace the wild-type sequence (AGAAACCATTTC SEQ ID NO: 226) with the wild-type sequence substituted by the ablation patch of 4153 (i.e., including the nucleotide substitution of the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132). The third promoter variant construct 5960 is engineered to delete the nucleotide sequence (from 550 to 1259 of position 550 of SEQ ID NO:132) between the ablation patches replaced in the 4134 and 4145 constructs, but not including the ablation patches, to delete the sequence replaced by the ablation patches of 4148 and 4150, and to include the ablation patch replacement sequence of 4153. Each of these deletion-containing constructs contains a secreted blue fluorescent protein (sec-BFP) reporter gene. Additionally, the fourth promoter construct 5957 is engineered to include the same ablation patch replacement as 4153, and includes the sec-BFP reporter gene. The sequences of these four promoter variants are provided in Table 1.

[0642] The T cells separated from the PBMC derived from the apheresis bag were transduced with four kinds of CCL3 promoter variant constructs described in Example 1 above. As described above, T cells were transduced 24 hours after activation. On the 2nd day after transduction, BFP expression was assessed by flow cytometry. For each transduction in four transductions, on the 2nd day, about 70% of cells were BFP positive (data not shown). Eleven days after transduction, Dynabeads coated with anti-CD3 and anti-CD28 agonist antibodies were used again to stimulate T cells with a bead to cell ratio of 1:1, or not stimulated as a control. Two days before bead stimulation, cells were plated with 200,000 cells / well. Two days after bead stimulation, BFP expression was assessed again, and the BFP level relative to unstimulated stimulated by beads was compared for each construct.

[0643] The geometric mean fluorescence intensity (gMFI) and the fold change between stimulated and unstimulated are shown in Figure 5A and Figure 5B .like Figure 5BAs shown, the BFP expression of T cells stimulated by beads of each of the four constructs increased by at least ten-fold compared to unstimulated cells. The increased inducibility of this CCL3 promoter can be achieved by deleting the nucleotide sequence of the ablation patch identified in Example 1. Additionally, increased inducibility can be obtained by deleting the sequence of many ablation patches identified in Example 1 and the sequence between the many ablation patches, which can beneficially reduce the size of the promoter by more than 700 nucleotides.

[0644] Example 3: Generation of Additional CCL3 Promoter Deletions and Evaluation in Immune Responder Cells Additional CCL3 promoter deletions were generated and tested.

[0645] The first promoter variant construct 5957 was generated as previously described in Example 2.

[0646] The second promoter variant construct 7293 was engineered to delete the nucleotide sequence between the ablation patches replaced in constructs 4134 and 4145, but not including the ablation patches (from positions 550 to 1259 of SEQ ID NO: 132), to delete the sequences replaced by the ablation patches of 4147, 4148, 4150, and 4152, and to include the ablation patch replacement sequence of 4153. The third promoter variant construct 7294 was engineered to delete the nucleotide sequence between the ablation patches replaced in constructs 4134 and 4145, but not including the ablation patches (from positions 550 to 1259 of SEQ ID NO: 132), to delete the sequences replaced by the ablation patches of 4150 and 4152, to include the ablation patch replacement sequence of 4153, and to delete the nucleotide sequence between the ablation patches in constructs 4154 and 4156 and to include the nucleotide sequence of the ablation patches.

[0647] The third promoter variant construct 7295 was engineered to delete the nucleotide sequence between, but not including, the ablation patches replaced in constructs 4134 and 4145 (from positions 550 to 1259 of SEQ ID NO: 132), to delete the sequence of ablation patches 4147 and 4148 and the sequence between them (from positions 1425-1500 of SEQ ID NO: 132), to replace with ablation patch deletion 4150, to replace with ablation patch deletion 4152, to replace with ablation patch deletion containing 4154 and 4156 and the sequence between them (from positions 1750 to 1818 of SEQ ID NO: 132), to replace with ablation patch deletion containing 4158 and 4160 and the sequence between them (from positions 1867 to 2000 of SEQ ID NO: 132), and to replace the ablation patch sequence containing 4153.

[0648] The fourth promoter variant construct 7296 was engineered to delete the nucleotide sequence between, but not including, the ablation patches replaced in constructs 4134 and 4145 (from positions 550 to 1259 of SEQ ID NO: 132), to delete the sequence including the ablation patches 4147 and 4148 and the sequence between them (from positions 1425-1500 of SEQ ID NO: 132), to replace with ablation patch deletion 4150, to replace with ablation patch deletion including the sequence including the ablation patches 4152 and 4156 and the sequence between them (from positions 1663 to 1818 of SEQ ID NO: 132), and to replace with ablation patch deletion including the sequence including the ablation patches 4158 and 4160 and the sequence between them (from positions 1867 to 2000 of SEQ ID NO: 132). Each of these deletion-containing constructs contained a secreted blue fluorescent protein (sec-BFP) reporter gene. The sequences of these promoter variants are provided in Table 1.

[0649] The fifth promoter variant construct 7297 was engineered to generate a small promoter containing ablation patches of 4125, 4126, 4127, 4128, 4129, 4130, 4131, 4132, 4133, 4134, 4145, 4146, 4149, 4151 and 4157.

[0650] The T cells separated from the PBMC derived from the apheresis bag were transduced with CCL3 promoter variant constructs as previously described. As described above, T cells were transduced 24 hours after activation. On the 2nd day after transduction, BFP expression was assessed by flow cytometry. For each transduction, on the 2nd day, approximately 70% of cells were BFP positive (data not shown). Eleven days after transduction, Dynabeads coated with anti-CD3 and anti-CD28 agonist antibodies were used again to stimulate T cells with a bead to cell ratio of 1: 1, or not stimulated as a control. Two days before bead stimulation, cells were plated with 200,000 cells / well. Two days after bead stimulation, BFP expression was assessed again, and the BFP level relative to unstimulated stimulated by beads was compared for each construct.

[0651] The geometric mean fluorescence intensity (gMFI) and the fold change between stimulated and unstimulated cells are shown in Fig. 6A and Figure 6B .like Figure 6BAs shown, compared with unstimulated cells, the BFP expression of T cells stimulated by beads of constructs other than construct 7297 was increased. The increased inducibility of this CCL3 promoter can be achieved by deleting the nucleotide sequence of the ablation patch identified in Example 1. Alternatively, the increased inducibility can be obtained by deleting the sequence comprising many of the ablation patches identified in Example 1 and the sequence between the many ablation patches, which can beneficially reduce the size of the promoter.

[0652] explain

[0653] All references, patents, and patent applications disclosed herein are incorporated by reference for the subject matter in which each is cited, which, in some cases, may be the entire document.

[0654] Unless expressly indicated to the contrary, the indefinite articles "a" and "an" as used herein in the specification and claims should be understood to mean "at least one."

[0655] It should also be understood that in any method claimed herein that includes more than one step or action, the order of the steps or actions of the method is not necessarily limited to the order in which the steps or actions of the method are recited unless explicitly stated to the contrary.

[0656] In the claims and in the foregoing specification, all transitional phrases, such as "comprising," "including," "carrying," "having," "containing," "involving," "maintaining," "consisting of," and the like, are to be construed as open ended, i.e., meaning including but not limited to. Only the transitional phrases "consisting of" and "consisting essentially of" shall be closed or semi-closed transitional phrases, respectively, as provided in Section 2111.03 of the U.S. Patent Office Manual of Patent Examining Procedures.

Claims

1. An engineered CCL3 promoter comprising ablation of at least one nucleotide motif, wherein the ablation increases the inducibility of the engineered CCL3 promoter in the presence of an immune cell activation signal compared to the inducibility of a wild-type CCL3 promoter in the presence of the same immune cell activation signal; Optionally wherein the wild-type CCL3 promoter comprises the nucleotide sequence of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally wherein the motif comprises a sequence selected from the group consisting of position 566 to position 576 of SEQ ID NO: 132, position 674 to position 695 of SEQ ID NO: 132, position 820 to position 832 of SEQ ID NO: 132, position 1089 to position 1105 of SEQ ID NO: 132, position 1127 to position 1141 of SEQ ID NO: 132, position 1184 to position 1199 of SEQ ID NO: 132, position 1475 to position 1500 of SEQ ID NO: 132, position 1534 to position 1544 of SEQ ID NO: 132, position 1553 to position 1595 of SEQ ID NO: 132, position 1634 to position 1674 of SEQ ID NO: 132, position 1681 to position 1692 of SEQ ID NO: 132, and position 1982 to position 1998 of SEQ ID NO: 132; Optionally wherein the ablation comprises a substitution or deletion of one or more nucleotides of the at least one nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132; Optionally, wherein the motif corresponds to position 566 to position 576 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution of the sequence GTACCAGAATA (SEQ ID NO: 191) comprising from position 566 to position 576 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 566 to position 576 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 674 to position 695 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution of the sequence TATATACCAGCGAGTTCGATAA (SEQ ID NO: 193) comprising from position 674 to position 695 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 674 to position 695 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132 NO:132, optionally wherein the motif corresponds to position 820 to position 832 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ACGAAGCAATACT (SEQ ID NO:195) from position 820 to position 832 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) from position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TCTGTATAAAGCTCGTA (SEQ ID NO:199) from position 1089 to position 1105 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 820 to position 832 of SEQ ID NO:132 NO:132, position 1089 to position 1105 nucleotide deletion, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1127 to position 1141 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence CCATAGTGAGGAAAT (SEQ ID NO:201) from position 1127 to position 1141 of SEQ ID NO:132,Optionally, wherein the ablation comprises a nucleotide deletion from position 1127 to position 1141 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1184 to position 1199 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1475 to position 1500 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GTTAAGCATACTAAAC (SEQ ID NO: 203) from position 1184 to position 1199 of SEQ ID NO: 132 NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 1475 to position 1500 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide substitution of the sequence GTAGAACTCTT (SEQ ID NO:219) comprising from position 1534 to position 1544 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 1534 to position 1544 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1534 to position 1544 of SEQ ID NO:132 NO:132, position 1553 to position 1595, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence AATACCTTGGTGGAGCTCATCTAATATCTTCATATTACCTCCA (SEQ ID NO:221) from position 1553 to position 1595 of SEQ ID NO:132, optionally wherein the ablation comprises a nucleotide deletion from position 1553 to position 1595 of SEQ ID NO:132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132,Optionally, wherein the motif corresponds to position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence CGATTGAACAAA (SEQ ID NO: 223) from position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1634 to position 1645 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence TATACCTTGGTT (SEQ ID NO: 225) from position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1663 to position 1674 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132 A motif of a sequence within the nucleotide sequence of SEQ ID NO: 132, wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the engineered CCL3 promoter comprises the polynucleotide of SEQ ID NO: 4; Optionally, wherein the ablation comprises a nucleotide deletion from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1982 to position 1998 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide substitution comprising the sequence GGAAGTAGCTTGTTTAA (SEQ ID NO: 241) from position 1982 to position 1998 of SEQ ID NO: 132, optionally wherein the ablation comprises a nucleotide deletion from position 1982 to position 1998 of SEQ ID NO: 132; Optionally wherein the ablation comprises ablation of at least two nucleotide motifs, at least three nucleotide motifs, at least four nucleotide motifs, at least five nucleotide motifs, or at least six nucleotide motifs; Optionally wherein the at least six nucleotide motifs comprise: a nucleotide motif corresponding to position 566-576 of SEQ ID NO:132, a nucleotide motif corresponding to position 674-695 of SEQ ID NO:132, a nucleotide motif corresponding to position 820-832 of SEQ ID NO:132, a nucleotide motif corresponding to position 1089-1105 of SEQ ID NO:132, a nucleotide motif corresponding to position 1127-1141 of SEQ ID NO:132, and a nucleotide motif corresponding to position 1184-1199 of SEQ ID NO:132, Optionally, said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 566 to position 1199 of SEQ ID NO: 132, optionally wherein said ablation of said at least six nucleotide motifs comprises a deletion corresponding to position 550 to position 1259 of SEQ ID NO: 132, optionally wherein said ablation further comprises ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132, optionally wherein said ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said ablation further comprises ablation of a nucleotide motif corresponding to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein said ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein said engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 2; Optionally, wherein said ablation of the nucleotide motif corresponding to positions 1681-1692 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said ablation further comprises ablation of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132, optionally wherein said ablation of the nucleotide motif corresponding to positions 1475 to 1500 of SEQ ID NO: 132 comprises a deletion of said nucleotide motif, optionally wherein said engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO: 1, Optionally, the ablation comprises ablation of at least nine nucleotide motifs, optionally wherein the at least nine nucleotide motifs comprise: a nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1475-1500 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1553-1595 of SEQ ID NO: 132 and a nucleotide motif corresponding to positions 1564-1596 of SEQ ID NO:

132. NO:132, wherein the ablation comprises a deletion of each of the at least nine nucleotide motifs, wherein the engineered CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:3, Optionally, wherein the at least nine nucleotide motifs include: a nucleotide motif corresponding to positions 566-576 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 674-695 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 820-832 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 911-926 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1089-1105 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1127-1141 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1184-1199 of SEQ ID NO: 132, a nucleotide motif corresponding to positions 1211-1223 of SEQ ID NO: 132, and a nucleotide motif corresponding to positions 1236-1248 of SEQ ID NO: 132, optionally wherein the ablation of the at least nine nucleotide motifs includes a nucleotide motif corresponding to SEQ ID NO: NO:132, optionally wherein said ablation of at least nine nucleotide motifs includes a deletion corresponding to position 550 to position 1250 of SEQ ID NO:132, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1425 to position 1445 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1425-1445 of SEQ ID NO:132 includes a deletion of said nucleotide motif, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1475 to position 1500 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1475-1500 of SEQ ID NO:132 includes a deletion of said nucleotide motif, optionally wherein said ablation further includes ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132, optionally wherein said ablation of a nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO:132 The ablation of the nucleotide motif at position 1553-1595 of NO:132 comprises a deletion of the nucleotide motif, optionally wherein the ablation further comprises ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132, optionally wherein the ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO:132 comprises a deletion of the nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO:132, optionally wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO:132,Optionally wherein the ablation comprises a nucleotide substitution comprising the sequence ATTGCGTCAATT (SEQ ID NO: 227) from position 1681 to position 1692 of SEQ ID NO: 132, Optionally wherein the CCL3 promoter comprises SEQ ID NO: 242, Optionally, wherein the ablation comprises the deletion of at least two nucleotide motifs according to position 1425 to position 1500 of SEQ ID NO: 132, optionally wherein the ablation further comprises the ablation of the nucleotide motif corresponding to position 1553 to position 1595 of SEQ ID NO: 132, optionally wherein the ablation of the nucleotide motif corresponding to position 1553-1595 of SEQ ID NO: 132 comprises the deletion of the nucleotide motif, optionally wherein the ablation further comprises the ablation of the nucleotide motif corresponding to position 1663 to position 1679 of SEQ ID NO: 132, optionally wherein the ablation of the nucleotide motif corresponding to position 1663-1679 of SEQ ID NO: 132 comprises the deletion of the nucleotide motif, optionally wherein the at least one nucleotide motif comprises a motif having a sequence within the nucleotide sequence of SEQ ID NO: 132, optionally wherein the motif corresponds to position 1681 to position 1692 of SEQ ID NO: 132, optionally wherein the ablation comprises a motif comprising from SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, optionally wherein the CCL3 promoter comprises SEQ ID NO:243, optionally wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, optionally wherein the CCL3 promoter comprises SEQ ID NO:244, optionally wherein the ablation further comprises a deletion corresponding to position 1663 to position 1692 of SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1750 to position 1818 of SEQ ID NO:132, optionally wherein the ablation further comprises a deletion corresponding to position 1867 to position 2000 of SEQ ID NO:132, or optionally wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:

245.

2. An engineered CCL3 promoter comprising at least one nucleotide motif, Optionally wherein the at least one nucleotide motif is selected from the group consisting of: a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132, b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132, c) the nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132, d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132, e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132, f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132, g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132, h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132, i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132, k) a nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132, 1) a nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132, m) a nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132, n) a nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132, o) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and p) a nucleotide motif corresponding to positions 1840-1861 of SEQ ID NO: 132; Optionally wherein the engineered CCL3 promoter comprises at least fifteen nucleotide motifs, the at least fifteen nucleotide motifs comprising: a) a nucleotide motif corresponding to positions 60-77 of SEQ ID NO: 132, b) a nucleotide motif corresponding to positions 92-111 of SEQ ID NO: 132, c) the nucleotide motif corresponding to positions 201-224 of SEQ ID NO: 132, d) a nucleotide motif corresponding to positions 231-243 of SEQ ID NO: 132, e) a nucleotide motif corresponding to positions 265-284 of SEQ ID NO: 132, f) a nucleotide motif corresponding to positions 307-324 of SEQ ID NO: 132, g) a nucleotide motif corresponding to positions 376-388 of SEQ ID NO: 132, h) a nucleotide motif corresponding to positions 452-475 of SEQ ID NO: 132, i) a nucleotide motif corresponding to positions 494-507 of SEQ ID NO: 132, j) a nucleotide motif corresponding to positions 533-549 of SEQ ID NO: 132, k) a nucleotide motif corresponding to positions 1260-1288 of SEQ ID NO: 132, 1) a nucleotide motif corresponding to positions 1345-1363 of SEQ ID NO: 132, m) a nucleotide motif corresponding to positions 1534-1544 of SEQ ID NO: 132, n) a nucleotide motif corresponding to positions 1634-1645 of SEQ ID NO: 132, and o) a nucleotide motif corresponding to positions 1840-1861 of SEQ ID NO: 132; Or optionally wherein the CCL3 promoter comprises the polynucleotide sequence of SEQ ID NO:

246.

3. An engineered CCL3 promoter comprising a polynucleotide sequence selected from the group consisting of SEQ ID NOs: 1-4 and 242-246.

4. A heterologous construct comprising an engineered CCL3 promoter according to any one of claims 1 to 3 operably linked to a polynucleotide comprising a polynucleotide sequence encoding a polypeptide; Optionally wherein the polypeptide comprises at least one effector molecule, Optionally wherein the polypeptide comprises a first effector molecule and a second effector molecule, Optionally wherein the polynucleotide comprises a polynucleotide sequence encoding the first effector molecule, a linker polynucleotide sequence and a polynucleotide sequence encoding the second effector molecule, Optionally wherein the linker polynucleotide sequence encodes one or more 2A ribosomal jumping elements, Optionally wherein the one or more 2A ribosomal jumping elements comprise elements each selected from the group consisting of: P2A, T2A, E2A and F2A, Optionally wherein the at least one effector molecule is selected from the class of therapeutic agents, wherein the class of therapeutic agents is selected from the group consisting of cytokines, chemokines, homing molecules, growth factors, co-activator molecules, tumor microenvironment modifiers, receptors, ligands, antibodies, peptides and enzymes, Optionally wherein each effector molecule of the at least one effector molecule comprises: a) cytokines, optionally wherein the cytokine is selected from the group consisting of IL1-β, IL2, IL4, IL6, IL7, IL10, IL12, IL12p70 fusion protein, IL15, IL17A, IL18, IL21, IL22, type I interferon, interferon-γ and TNF-α; b) a chemokine, optionally wherein the chemokine is selected from the group consisting of: CCL21a, CXCL10, CXCL11, CXCL13, a CXCL10-CXCL11 fusion protein, CCL19, CXCL9 and XCL1; c) a homing molecule, optionally wherein the homing molecule is selected from the group consisting of: anti-integrin α4, β7; anti-MAdCAM; CCR9; CXCR4; SDF1; MMP-2; CXCR1; CXCR7; CCR2; CCR4; and GPR15; d) a growth factor, optionally wherein the growth factor is selected from the group consisting of: FLT3L and GM-CSF; e) a co-activator molecule, optionally wherein the co-activator molecule is selected from the group consisting of: c-Jun, 4-1BBL and CD40L; f) a tumor microenvironment modifier, optionally wherein the tumor microenvironment modifier is selected from the group consisting of: an adenosine deaminase, a TGFβ inhibitor, an immune checkpoint inhibitor, a VEGF inhibitor, and HPGE2; Optionally wherein each of said first effector molecule and said second effector molecule is from a separate therapeutic class; And optionally wherein each effector molecule of the at least one effector molecule is a human-derived effector molecule.

5. A vector comprising the heterologous construct according to claim 4.

6. A dual expression vector comprising the heterologous construct according to claim 4 and a second construct comprising a polynucleotide sequence encoding an activating immune receptor, optionally wherein the activating immune receptor comprises an antigen recognition receptor, Optionally wherein the antigen recognition receptor comprises a T cell receptor (TCR), optionally wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and Optionally wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR).

7. An immune response cell comprising the heterologous construct according to claim 4, the vector according to claim 5 or the dual expression vector according to claim 6, Optionally wherein the immune response cells are selected from the group consisting of: T cells, CD8+T cells, CD4+T cells, γ-δT cells, cytotoxic T lymphocytes (CTLs), regulatory T cells, virus-specific T cells, natural killer T (NKT) cells, natural killer (NK) cells, B cells, tumor infiltrating lymphocytes (TILs), innate lymphoid cells, mast cells, eosinophils, basophils, neutrophils, myeloid cells, macrophages, monocytes, dendritic cells, erythrocytes, platelet cells, human embryonic stem cells (ESCs), ESC-derived cells, pluripotent stem cells, mesenchymal stromal cells (MSCs), induced pluripotent stem cells (iPSCs), and iPSC-derived cells; Optionally wherein the immune response cell expresses an activating immune receptor, optionally wherein the activating immune receptor comprises an antigen recognition receptor, optionally wherein the antigen recognition receptor comprises a T cell receptor (TCR), optionally wherein the TCR is an endogenous T cell receptor or an exogenous T cell receptor, and optionally wherein the antigen recognition receptor comprises a chimeric antigen receptor (CAR); Optionally wherein the antigen recognition receptor comprises an activating NK cell receptor, optionally wherein the activating NK cell receptor is selected from the group consisting of: NKG2D, NKp30, NKp44, NKp46, and ITAM-containing killer cell Ig-like receptor (KIR); Optionally wherein the immune response cell comprises a heterologous construct encoding the antigen recognition receptor; and Optionally wherein the immune response cells are autologous, or optionally wherein the immune response cells are allogeneic.

8. A pharmaceutical composition comprising the engineered CCL3 promoter according to any one of claims 1 to 3, the heterologous construct according to claim 4, the vector according to claim 5, the dual expression vector according to claim 6 or the immune response cell according to claim 7, and a pharmaceutically acceptable carrier, a pharmaceutically acceptable excipient or a combination thereof.

9. A method for increasing the expression of a target gene, the method comprising increasing the expression of the target gene using an engineered CCL3 promoter according to any one of claims 1 to 3, a heterologous construct according to claim 4, a vector according to claim 5 or a dual expression vector according to claim 6, optionally wherein the target gene is an immunomodulatory gene.

10. A method of treating a subject in need thereof, the method comprising administering the engineered CCL3 promoter of any one of claims 1 to 3, the heterologous construct of claim 4, the vector of claim 5, the dual expression vector of claim 6, the immune response cell of claim 7, or the pharmaceutical composition of claim 8.

11. A method of stimulating a cell-mediated immune response in a subject, the method comprising administering to the subject an engineered CCL3 promoter according to any one of claims 1 to 3, a heterologous construct according to claim 4, a vector according to claim 5, a dual expression vector according to claim 6, an immune response cell according to claim 7, or a pharmaceutical composition according to claim 8.

12. A method of reducing tumor volume in a subject, the method comprising administering to a subject having a tumor a composition comprising the engineered CCL3 promoter of any one of claims 1 to 3, the heterologous construct of claim 4, the vector of claim 5, the dual expression vector of claim 6, the immune response cell of claim 7, or the pharmaceutical composition of claim 8.

13. A method of providing anti-tumor immunity in a subject, the method comprising administering to a subject in need thereof an engineered CCL3 promoter according to any one of claims 1 to 3, a heterologous construct according to claim 4, a vector according to claim 5, a dual expression vector according to claim 6, an immune response cell according to claim 7, or a pharmaceutical composition according to claim 8.

14. A method of treating a subject having cancer, the method comprising administering to a subject in need thereof an engineered CCL3 promoter according to any one of claims 1 to 3, a heterologous construct according to claim 4, a vector according to claim 5, a dual expression vector according to claim 6, an immune response cell according to claim 7, or a pharmaceutical composition according to claim 8.

15. A kit for treating and / or preventing tumors, the kit comprising the immune response cell according to claim 7 or the pharmaceutical composition according to claim 8, optionally wherein the kit further comprises written instructions for using the immune response cell or the pharmaceutical composition to treat and / or prevent the tumor in a subject.

Images