Pyrrolysyl-tRNA synthetase mutant and application thereof

Abstract

The invention discloses a pyrrole lysyl-tRNA (transfer ribonucleic acid) synthetase mutant and application of the pyrrole lysyl-tRNA synthetase mutant. On the basis of the amino acid sequence of pyrrole lysyl-tRNA synthetase, the mutant comprises one or more of the following mutations: aspartic acid at the second site is mutated into asparagine, valine at the 31st site is mutated into isoleucine, threonine at the 56th site is mutated into proline, arginine at the 61st site is mutated into lysine, and arginine at the 61st site is mutated into lysine. Histidine at the 62nd site is mutated into tyrosine, threonine at the 122nd site is mutated into serine, and serine at the 193rd site is mutated into arginine; the amino acid sequence of the pyrrole lysyl-tRNA synthetase is as shown in SEQ ID NO. 1 (sequence identifier number 1). The pyrrole lysyl-tRNA synthetase mutant disclosed by the invention is higher in non-natural amino acid introduction efficiency, has universality to non-natural amino acids, solves the problem of low introduction efficiency of non-natural amino acids in proteins, and greatly expands research on structures and functions of proteins by introduction of non-natural amino acids.

Description

Technical Field

[0001] The invention relates to the technical field of enzyme engineering, and in particular to a pyrrolysyl-tRNA synthetase mutant and application thereof. Background Art

[0002] Aminoacyl-tRNA synthetase is a crucial enzyme in the protein translation process. It performs two catalytic steps in the cell: first, it catalyzes the binding of the phosphate group of ATP to the carboxyl group of amino acids to generate aminoacyl-AMP; second, it binds to tRNA and catalyzes the transfer of amino acids in aminoacyl-AMP to tRNA, thereby forming aminoacyl-tRNA to participate in the extension of protein peptide chains. Pyrrolysyl-tRNA synthetase (PylRS) is one of the commonly used enzymes in genetic code expansion technology. It can catalyze the binding of amino acids with different side chain groups to orthogonal tRNA. Subsequently, aminoacyl-tRNA recognizes the blank stop codon UAG and introduces these amino acids with different side chain groups during the synthesis of peptide chains in the ribosome.

[0003] Modifying PylRS to improve its activity and specificity is a hot topic in current research. Through methods such as directed evolution, scientists are committed to improving the catalytic efficiency of PylRS and its ability to recognize different non-natural amino acids (NCAAs). Such modifications can not only expand the application scope of NCAA in protein research, but also reduce industrial production costs and promote the application of gene code expansion technology in biopharmaceuticals and other fields. In addition, the optimized PylRS will also play a greater role in synthetic biology, protein engineering and other fields, promoting the development of new protein drugs and functional proteins.

[0004] The types of PylRS reported so far include MmPylRS, MbPylRS, MaPylRS and chPylRS. The discovery of different PylRS makes it possible to introduce more unnatural amino acids and higher introduction efficiency into proteins. However, in practical applications, these PylRS still show low efficiency of introducing unnatural amino acids. For example, the introduction efficiency of MmPylRS, MbPylRS and chPylRS for the high-affinity substrate BocK is only 2%-5% of that of the wild-type protein (Continuous directed evolution of aminoacyl-tRNA synthetases), and the introduction efficiency of MaPylRS is similar to that of MmPylSR (Mutually orthogonal pyrrolysyl-tRNA synthetase / tRNA pairs). How to transform PylRS into an efficient and universal tool for introducing unnatural amino acids has become a key issue.

[0005] In summary, the modification of PylRS can help overcome its current limitation of poor activity, significantly improve the efficiency of NCAA introduction and the expression of recombinant proteins, and promote the widespread application of gene code expansion technology in various fields. Summary of the invention

[0006] In order to improve the efficiency of pyrrolysyl-tRNA synthetase (PylRS) in introducing different types of non-natural amino acids, the present invention provides a pyrrolysyl-tRNA synthetase mutant and its application, which can greatly improve the efficiency of introducing various types of non-natural amino acids (NCAA) into proteins.

[0007] The present invention provides a pyrrolysyl-tRNA synthetase mutant, based on the amino acid sequence of the pyrrolysyl-tRNA synthetase, wherein the mutant comprises one or more of the following mutations:

[0008] Aspartic acid at position 2 mutated to asparagine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, threonine at position 122 mutated to serine and serine at position 193 mutated to arginine;

[0009] The amino acid sequence of the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO.1.

[0010] In certain embodiments, the nucleotide sequence of the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO.2.

[0011] In certain embodiments, the pyrrolysyl-tRNA synthetase is derived from Methanosarcina mazei.

[0012] In certain embodiments, the mutant further comprises one or more of A1)-A5):

[0013] A1) Asparagine at position 7 was mutated to tyrosine;

[0014] A2) The histidine at position 63 is mutated to leucine or isoleucine;

[0015] A3) Lysine at position 67 was mutated to asparagine;

[0016] A4) Valine at position 74 is mutated to tryptophan or phenylalanine;

[0017] A5) Aspartic acid at position 76 was mutated to asparagine or histidine.

[0018] Preferably, the mutant comprises a combination of three or more of the above-mentioned mutations.

[0019] Furthermore, the mutant comprises four mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine and valine at position 74 mutates to tryptophan.

[0020] Furthermore, the mutant comprises five mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine, valine at position 74 mutates to tryptophan and aspartic acid at position 76 mutates to asparagine.

[0021] Furthermore, the mutant comprises five mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine, valine at position 74 mutates to tryptophan and aspartic acid at position 76 mutates to histidine.

[0022] Furthermore, the mutant comprises four mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to isoleucine, lysine at position 67 mutates to asparagine and valine at position 74 mutates to phenylalanine.

[0023] The invention divides the structural domain of MmPylRS into a tRNA binding domain (TBD) and a C-terminal domain (CD), and transforms the TBD region of the C-terminal mutant IFRS (N346S / C348I) of MmPylRS. The relative fluorescence intensity after IFRS introduces 3-bromo-phenylalanine (3BrF) into GFP protein indicates the activity of the mutant.

[0024] The present invention constructs and obtains a combined mutant by combining multiple amino acid mutations, thereby greatly improving the catalytic activity of pyrrolysyl-tRNA synthetase to non-natural amino acids.

[0025] The present invention also provides an isolated polynucleotide encoding the pyrrolysyl-tRNA synthetase mutant as described above.

[0026] In certain embodiments, the sequence of the polynucleotide comprises one or more of the sequences shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 and SEQ ID NO.10.

[0027] The nucleotide sequences of mutants Z1-IFRS, Z2-IFRS, Z3-IFRS and Z4-IFRS are shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 and SEQ ID NO.10, respectively.

[0028] The present invention also provides a nucleic acid construct comprising the polynucleotide as described above.

[0029] The present invention also provides a host comprising the nucleic acid construct as described above or a gene in which the polynucleotide as described above is integrated.

[0030] In certain embodiments, the host is selected from Escherichia coli DH10B. The host can be selected from BL21 (DE3), C321.ΔA.exp (a modified strain that does have the RF-1 gene, derived from BL21), DH10B. It is more common to express in DH10B.

[0031] The present invention also provides use of the mutant described above, or the polynucleotide described above, or the nucleic acid construct described above, or the host described above in producing unnatural amino acids.

[0032] In certain embodiments, the application includes: co-transforming the recombinant vector and the target protein plasmid into competent cells for induction culture to obtain the target protein containing unnatural amino acids.

[0033] In certain embodiments, the unnatural amino acid is selected from one or more of 3-bromo-L-phenylalanine (3BrF), 3-fluoro-L-phenylalanine (3FF), 2,3-fluoro-L-phenylalanine (23FF), 2,4-fluoro-L-phenylalanine (24FF), 2,5-fluoro-L-phenylalanine (25FF), 3,4,5-fluoro-L-phenylalanine (345FF), 2,3,6-fluoro-L-phenylalanine (236FF), 5-bromo-2-chloro-L-phenylalanine (5Br2ClF), 2-chloro-L-phenylalanine (2ClF), 3,4-chloro-L-phenylalanine (34ClF), 2-thienyl-L-alanine (2ThiA), and 3-bromo-2-thienyl-L-alanine (BrThiA).

[0034] The present invention also provides a method for producing non-natural amino acids, comprising adding the mutant described above, the polynucleotide described above, the nucleic acid construct described above, or the host described above to a reaction system containing non-natural amino acids for reaction.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] 1) The pyrrolysyl-tRNA synthetase mutant of the present invention can efficiently introduce non-natural amino acids into the target protein, and the introduction efficiency is greatly improved to 45%-135.2%, and the expression amount of the recombinant protein can be increased.

[0037] 2) The pyrrolysyl-tRNA synthetase mutant of the present invention is universal to non-natural amino acids and can introduce different types of phenylalanine, such as 3-bromo-L-phenylalanine (3BrF), 3-fluoro-L-phenylalanine (3FF), 2,3-fluoro-L-phenylalanine (23FF), 2,4-fluoro-L-phenylalanine (24FF), 2,5-fluoro-L-phenylalanine (25FF), 3,4,5-fluoro-L-phenylalanine (345FF), 2,3,6-fluoro-L-phenylalanine (236FF), 5-bromo-2-chloro-L-phenylalanine (5Br2ClF), 2-chloro-L-phenylalanine (2ClF), 3,4-chloro-L-phenylalanine (34ClF), 2-thienyl-L-alanine (2ThiA), and 3-bromo-2-thienyl-L-alanine (BrThiA) into the target polypeptide. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 The figure is a structural formula of the non-natural amino acid involved in the present invention.

[0039] Figure 2 This is a comparison chart of the introduction efficiency of 3BrF by IFRS (CD: N346S / C348I) in Example 2, single-point mutation and single-point combination of IFRS, Z0-IFRS mutant, single-point combination of Z0-IFRS mutant, Z1-IFRS mutant, Z2-IFRS mutant, Z3-IFRS mutant, and Z4-IFRS mutant.

[0040] Figure 3 This is a comparison of the introduction efficiency of IFRS and Z1-IFRS in Example 2 in the control group without NCAA and the control group with 1 mM NC2, NC3, NC4, NC5, NC6, NC7, NC8, NC9, NC10, NC11, and NC12.

[0041] Figure 4It is the electrophoresis diagram of GFP protein purification in Example 3. Among them, lane 1 is pBK-IFRS+pGFP2TAG+3BrF, lane 2 is pBK-Z1-IFRS+pGFP2TAG+3BrF (sample diluted 10 times), lane 3 is pBK-Z2-IFRS+pGFP2TAG+3BrF (sample diluted 10 times), lane 4 is pBK-Z3-IFRS+pGFP2TAG+3BrF (sample diluted 10 times), and lane 5 is pBK-Z4-IFRS+pGFP2TAG+3BrF (sample diluted 10 times). DETAILED DESCRIPTION

[0042] The present invention divides the structural domain of MmPylRS into a tRNA binding domain (TBD) and a C-terminal domain (CD), and transforms the TBD region of the C-terminal mutant IFRS (N346S / C348I) of MmPylRS, combines multiple amino acid mutations, constructs and obtains a combined mutant, and greatly improves the catalytic activity of pyrrolysyl-tRNA synthetase to non-natural amino acids. On this basis, the present invention is completed.

[0043] One of the purposes of the present invention is to provide a pyrrolysyl-tRNA synthetase mutant, based on the amino acid sequence of pyrrolysyl-tRNA synthetase, wherein the mutant comprises one or more of the following mutations:

[0044] Aspartic acid at position 2 mutated to asparagine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, threonine at position 122 mutated to serine and serine at position 193 mutated to arginine;

[0045] The amino acid sequence of the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO.1.

[0046] In certain embodiments, the nucleotide sequence of the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO.2.

[0047] In certain embodiments, the pyrrolysyl-tRNA synthetase is derived from Methanosarcina mazei.

[0048] In certain embodiments, the mutant further comprises one or more of mutations A1)-A5):

[0049] A1) Asparagine at position 7 was mutated to tyrosine (N7Y);

[0050] A2) The histidine at position 63 is mutated to leucine or isoleucine (H63L or H63I);

[0051] A3) Lysine at position 67 was mutated to asparagine (K67N);

[0052] A4) the valine at position 74 is mutated to tryptophan or phenylalanine (V74W or V74F);

[0053] A5) Aspartic acid at position 76 was mutated to asparagine or histidine (D76N or D76H).

[0054] In certain specific embodiments, the mutant comprises three or more of the above-mentioned mutations.

[0055] Preferably, there are three combinations, such as the combination formed by N7Y, H63L and K67N; the combination formed by N7Y, H63L and V74W; the combination formed by N7Y, H63L and D76N (or D76H); the combination formed by H63L, K67N and V74W; the combination formed by H63L, K67N and D76N (or D76H); the combination formed by H63L, V74W and D76N (or D76H); and the combination formed by K67N, V74W and D76N (or D76H).

[0056] Preferably, there are four combinations, such as a combination of N7Y, H63L, K67N and V74W; a combination of N7Y, H63L, K67N and D76N (or D76H); a combination of N7Y, K67N, V74W and D76N (or D76H); a combination of N7Y, H63L, V74W (or V74F) and D76N (or D76H); a combination of H63L, K67N, V74W and D76N (or D76H). Specifically, it is a combination of N7Y, H63L, K67N and V74W.

[0057] Furthermore, the mutant contains four mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine and valine at position 74 mutates to tryptophan, and is named Z1-IFRS mutant. The Z1-IFRS mutant has the following mutations:

[0058] D2N / N7Y / V31I / T56P / R61K / H62Y / H63L / K67N / V74W / T122S / S193R.

[0059] The amino acid sequence of the Z1-IFRS mutant is SEQ ID No.3; the nucleotide sequence of the Z1-IFRS mutant is SEQ ID No.4.

[0060] Furthermore, the mutant contains four mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to isoleucine, lysine at position 67 mutates to asparagine and valine at position 74 mutates to phenylalanine, and is named Z4-IFRS mutant. The Z4-IFRS mutant has the following mutations:

[0061] D2N / N7Y / V31I / T56P / R61K / H62Y / H63I / K67N / V74F / T122S / S193R

[0062] The amino acid sequence of the Z4-IFRS mutant is SEQ ID No.9; the nucleotide sequence of the Z4-IFRS mutant is SEQ ID No.10.

[0063] Preferably, there are 5 combinations, such as a combination of N7YA, H63L, K67N, V74W and D76N or D76H.

[0064] Further, the mutant contains 5 mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine, valine at position 74 mutates to tryptophan and aspartic acid at position 76 mutates to asparagine, and is named Z2-IFRS mutant. The Z2-IFRS mutant has the following mutations:

[0065] D2N / N7Y / V31I / T56P / R61K / H62Y / H63L / K67N / V74W / D76N / T122S / S193R.

[0066] The amino acid sequence of the Z2-IFRS mutant is SEQ ID No.5; the nucleotide sequence of the Z2-IFRS mutant is SEQ ID No.6.

[0067] Further, the mutant contains 5 mutations, namely, asparagine at position 7 mutates to tyrosine, histidine at position 63 mutates to leucine, lysine at position 67 mutates to asparagine, valine at position 74 mutates to tryptophan and aspartic acid at position 76 mutates to histidine, and is named Z3-IFRS mutant. Z3-IFRS mutant has the following mutations:

[0068] D2N / N7Y / V31I / T56P / R61K / H62Y / H63L / K67N / V74W / D76H / T122S / S193R.

[0069] The amino acid sequence of the Z3-IFRS mutant is SEQ ID No.7; the nucleotide sequence of the Z3-IFRS mutant is SEQ ID No.8.

[0070] A second object of the present invention is to provide an isolated polynucleotide encoding the pyrrolysyl-tRNA synthetase mutant as described above.

[0071] In certain embodiments, the nucleotide sequence of the polynucleotide is selected from one or more of the sequences shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, and SEQ ID NO.10.

[0072] The nucleotide sequences of mutants Z1-IFRS, Z2-IFRS, Z3-IFRS and Z4-IFRS are shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.6 and SEQ ID NO.10, respectively.

[0073] The third object of the present invention is to provide a nucleic acid construct comprising the polynucleotide as described above.

[0074] A fourth object of the present invention is to provide a host comprising the nucleic acid construct or gene as described above into which the polynucleotide as described above is integrated.

[0075] In certain embodiments, the host is selected from Escherichia coli DH10B. The host can be selected from BL21 (DE3), C321.ΔA.exp (a modified strain with RF-1 gene, derived from BL21), DH10B, specifically DH10B.

[0076] A fifth object of the present invention is to provide use of the mutant as described above, or the polynucleotide as described above, or the nucleic acid construct as described above, or the host as described above in producing non-natural amino acids.

[0077] In certain embodiments, the application includes: co-transforming the recombinant vector and the target protein plasmid into competent cells for induction culture to obtain the target protein containing unnatural amino acids.

[0078] In certain embodiments, the unnatural amino acid is selected from one or more of 3-bromo-L-phenylalanine (3BrF), 3-fluoro-L-phenylalanine (3FF), 2,3-fluoro-L-phenylalanine (23FF), 2,4-fluoro-L-phenylalanine (24FF), 2,5-fluoro-L-phenylalanine (25FF), 3,4,5-fluoro-L-phenylalanine (345FF), 2,3,6-fluoro-L-phenylalanine (236FF), 5-bromo-2-chloro-L-phenylalanine (5Br2ClF), 2-chloro-L-phenylalanine (2ClF), 3,4-chloro-L-phenylalanine (34ClF), 2-thienyl-L-alanine (2ThiA), and 3-bromo-2-thienyl-L-alanine (BrThiA).

[0079] The sixth object of the present invention is to provide a method for producing non-natural amino acids, wherein the mutant as described above, the polynucleotide as described above, the nucleic acid construct as described above, or the host as described above is added to a reaction system containing non-natural amino acids for reaction.

[0080] In certain embodiments, the reaction system further comprises an inducer, and the inducer is arabinose.

[0081] In certain embodiments, based on the total volume of the reaction system, the concentration of the unnatural amino acid is 0.05-2 mM.

[0082] The present invention will be further described below in conjunction with specific embodiments. The following are only specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto.

[0083] The plasmid and gene information used in the following examples of this application are as follows:

[0084] 1) DH10B was purchased from Thermo Fisher Scientific (Therm).

[0085] 2) Gene synthesis, primer synthesis and sequence sequencing of MmPylRS and GFP were completed by Qingke Biotechnology Co., Ltd., in which the serine triplet codon sequence at the second site of GFP was mutated to an amber stop codon (TAG) (the nucleotide sequence is shown in SEQ ID NO.8).

[0086] 3) pBK and pGFP vectors were gifts from Cambridge University.

[0087] 4) Genome extraction kit and DpnI were purchased from TaKaRa and Takara Biotechnology (Dalian) Co., Ltd.

[0088] 5) Seamless cloning kit was purchased from Shanghai Biotech Biotechnology Co., Ltd.

[0089] 6) Plasmid extraction kit and DNA recovery and purification kit were purchased from Axygen Hangzhou Co., Ltd. The usage of the above reagents refers to the product instructions.

[0090] 7) Unnatural amino acids were purchased from Bethesda Pharmaceuticals, with a stock solution concentration of 100 mM and a final concentration of 1 mM.

[0091] 8) Pyrrolysyl-tRNA synthetase from Methanosarcina mazei.

[0092] 9) The inducer is arabinose, and the concentration used is 0.2%.

[0093] 10) The antibiotics were kanamycin (Kan, final concentration was 50 μg / mL) and tetracycline (Tet, final concentration was 12.5 μg / mL).

[0094] Example 1

[0095] In this embodiment 1, the tRNA binding part is transformed on the basis of IFRS, and the mutation of the designed IFRS TBD region is constructed into the IFRS gene by whole plasmid PCR using the method of site-directed mutagenesis, and 4 pyrrolysyl-tRNA synthetase mutants are obtained, namely Z1-IFRS, Z2-IFRS, Z3-IFRS, and Z4-IFRS. At the same time, the serine at the second site of the green fluorescent protein GFP is mutated into the amber stop codon TAG to detect the introduction efficiency of non-natural amino acids. Each mutant and GFP are transformed into competent cells respectively, and the introduction efficiency of non-natural amino acids is investigated by detecting the relative fluorescence intensity. The experimental process is as follows:

[0096] 1.1. pBK plasmid containing IFRS gene and verification

[0097] The gene sequence of pyrrolysyl-tRNA synthetase IFRS (CD: N346S / C348I) was synthesized by Qingke Biotechnology Co., Ltd., and its nucleotide sequence is shown in SEQ ID NO.1, and it was inserted into the restriction sites NdeI and Pst I of the vector pBK to obtain the recombinant plasmid pBK-IFRS. The recombinant plasmid pBK-IFRS was then transformed into DH10B competent cells by heat shock method, and the plasmid containing the IFRS gene was obtained after sequencing verification.

[0098] 1.2. Point mutation based on IFRS

[0099] According to the primers in Table 1, site-directed mutagenesis of IFRS was performed. The specific method is as follows:

[0100] 1.2.1. Whole plasmid PCR

[0101] Using the recombinant plasmid pBK-IFRS obtained in step 1.1 as a template, upstream and downstream primers covering the mutation sites were designed (Table 1) for whole plasmid PCR. On the basis that both the CD region contained N346S (asparagine at position 346 mutated to serine) and C348I (cysteine ​​at position 348 mutated to leucine), mutants containing mutation sites in the TBD region were obtained. The constructed mutants were: 12 mutants with 1 mutation site, 2 mutants with 3 mutation sites, 2 mutants with 4 mutation sites and 1 mutant with 5 mutation sites.

[0102] The mutants of the 12 single mutation sites are: D2N mutant, K3N mutant, R19H mutant, H29R mutant, V31I mutant, T56P mutant, R61K mutant, H62Y mutant, H63Y mutant, A100E mutant, T122S mutant, and S193S mutant.

[0103] There are two mutants with three mutation sites: R61K / H63Y / S193R mutant and R19H / H29R / T122S mutant.

[0104] Two mutants with four mutation sites: D2N / K3N / T56P / H62Y mutant and V31I / T56P / H62Y / A100E mutant.

[0105] 1 mutant with 7 mutation sites: D2N / V31I / / T56P / R61K / H62Y / T122S / S193R mutant, marked as Z0-IFRS mutant.

[0106] Z0-IFRS mutant: The mutation points in its TBD region include: D2N (aspartic acid at the second position mutates to asparagine), V31I (valine at the 31st position mutates to isoleucine), T56P (threonine at the 56th position mutates to proline), R61K (arginine at the 61st position mutates to lysine), H62Y (histidine at the 62nd position mutates to tyrosine), T122S (threonine at the 122nd position mutates to serine) and S193R (serine at the 193rd position mutates to arginine); the mutation points in its CD region include: N346S (asparagine at the 346th position mutates to serine) and C348I (cysteine ​​at the 348th position mutates to isoleucine).

[0107] Table 1 Primers used for constructing single-point and combined mutations of TBD based on IFRS

[0108] Primer Name Primer Sequence (5’ to 3’) Sequence Number D2N_F GATGAATAAAAAGCCGCTGAACACCCTGATTT 12 D2N_R GCGGCTTTTTATTCATCATATGGGATTCCTCAAAGC 13 K3N_F GATGGACAATAAGCCGCTGAACACCCTGATTT 14 K3N_R GCGGCTTATTGTCCATCATATGGGATTCCTCAA 15 R19H_F GATGAGCCATACGGGTACGATTCATAAAATTAAACA 16 R19H_R TACCCGTATGGCTCATCCACAGCCCGGTCGCC 17 H29R_F AACACCGTGAAGTTTCGCGTAGCAAAATTTAC 18 H29R_R CGAAACTTCACGGTGTTTAATTTTATGAATCGTACCCG 19 V31I_F CCACGAAATTTCGCGTAGCAAAATTTACATTGA 20 V31I_R TACGCGAAATTTCGTGGTGTTTAATTTTATGAATCG 21 T56P_F TAGTAGCCGTCCGGCACGTGCACTG 22 T56P_R GTGCCGGACGGCTACTACGACTATTGTTGACA 23 R61K_F CGTGCACTGAAACATCATAAATACCGCAAAACATGTAA 24 R61K_R TGATGTTTCAGTGCACGTGCGGTACGGCTACT 25 H62Y_F CACTGCGCTACCATAAATACCGCAAAACATGTAAACG 26 H62Y_R TATGGTAGCGCAGTGCACGTGCGGTAC 27 H63Y_F CCATTATAAATACCGCAAAACATGTAAACGT 28 H63Y_R ATTTATAATGGCGCAGTGCACGT 29 A100E_F TGTAAGCGAACCGACCCGCACCAAAAAGGC 30 A100E_R GGTCGGTTCGCTTACAACTTTCACTTTAACGCTG 31 T122S_F GGAAAACAGCGAAGCAGCACAGGCACAGCCGA 32 T122S_R CTGCTTCGCTGTTTTCCAGCGGTTTCGGTGCA 33 S193R_F GACCAAACGTCAAACCGATCGTCTGGAAGTTC 34 S193R_R CGGTTTGACGTTTGGTCAGTGCTGGTGCGCTT 35 D2N / K3N_F TGATGAATAATAAGCCGCTGAACACCCTGA 36 D2N / K3N_R GCGGCTTATTATTCATCATATGGGATTCCTCAAAGC 37 R61K / H63Y_F GTGCACTGAAACATTATAAATACCGCAAAACATGTAAACGT 38 R61K / H63Y_R TTATAATGTTTCAGTGCACGTGCGGTACGG 39

[0109] The mutants of the 12 single mutation sites were obtained by amplifying the corresponding primers in Table 1, such as the D2N mutant was amplified by D2N_F and D2N_R; the K3N mutant was amplified by K3N_F and K3N_R.

[0110] The R61K / H63Y / S193R mutant was amplified by primers R61K / H63Y_F / R and S193R_F / R.

[0111] The R19H / H29R / T122S mutant was amplified by primers R19H_F / R, H29R_F / R and T122S_F / R.

[0112] The D2N / K3N / T56P / H62Y mutant was amplified by primers D2N / K3N_F / R, T56P_F / R and H62Y_F / R.

[0113] The V31I / T56P / H62Y / A100E mutant was amplified by primers V31I_F / R, T56P_F / R, H62Y_F / R and A100E_F / R.

[0114] The Z0-IFRS mutant was constructed using mutant D2N as a template using primers V31I_F / R, T56P_F / R, and R61K / H62Y_F / R to construct the D2N_V31_T56P_R61K_H62Y mutant, and then amplified using D2N_V31_T56P_R61K_H62Y as a template using primers T122S_F / R and S193R_F / R.

[0115] 1.3. Construction of mutants based on Z0-IFRS mutant

[0116] Using the Z0-IFRS mutant obtained in step 1.2 as a template, upstream and downstream primers covering the mutation site were designed (Table 2) for whole plasmid PCR. Using Z0-IFRS as a benchmark, 8 mutants with 1 mutation site, 2 mutants with 4 mutation sites, and 2 mutants with 5 mutation sites were obtained.

[0117] The eight mutations containing one mutation site are: Z0-N7Y-IFRS mutant, Z0-H63L-IFRS mutant, Z0-H63I-IFRS mutant, Z0-V74W-IFRS mutant, Z0-K67N-IFRS mutant, Z0-D76N-IFRS mutant, and Z0-D76H-IFRS mutant. Using N7Y_F and N7Y_R in Table 2 as primers and Z0-IFRS as a template, the Z0-N7Y-IFRS mutant was obtained; using H63L_F and H63L_R as primers and Z0-IFRS as a template, the Z0-H63L-IFRS mutant was obtained; using H63I_F and H63I_R as primers and Z0-IFRS as a template, the Z0-H63I-IFRS mutant was obtained; using V74F_F and V74F_R as primers and Z0-IFRS as a template, the Z0-V74F-IFRS mutant was obtained; using V74W_F and V74W_R as primers and Z0-IFRS as a template, the Z0- RS was used as a template to obtain the Z0-V74W-IFRS mutant; K67N_F and K67N_R were used as primers and Z0-IFRS was used as a template to obtain the Z0-K67N-IFRS mutant; D76N_F and D76N_R were used as primers and Z0-IFRS was used as a template to obtain the Z0-D76N-IFRS mutant; D76H_F and D76H_R were used as primers and Z0-IFRS was used as a template to obtain the Z0-D76H-IFRS mutant; V74W_F and V74W_R were used as primers and Z0-IFRS was used as a template to obtain the Z0-V74W-IFRS mutant, etc.

[0118] Two mutants containing four mutation sites: Z1-IFRS mutant and Z4-IFRS mutant. Compared with Z0-IFRS mutant, Z1-IFRS mutant also contains: N7Y, H63L, K67N, V74W; compared with Z0-IFRS mutant, Z4-IFRS mutant also contains: N7Y, H63I, K67N, V74F. Z1-IFRS mutant was obtained by using N7Y_F / R, H63L / K67N_F / R, V74W_F / R in Table 2 as primers and Z0-IFRS as template; Z4-IFRS mutant was obtained by using N7Y_F / R, H63I / K67N_F / R, V74F_F / R in Table 2 as primers and Z0-IFRS as template.

[0119] Two mutants containing 5 mutation sites: Z2-IFRS mutant and Z3-IFRS mutant. Compared with Z0-IFRS mutant, Z2-IFRS mutant also contains: N7Y, H63L, K67N, V74W, D76N; compared with Z0-IFRS mutant, Z4-IFRS mutant also contains: N7Y, H63L, K67N, V74W, D76H. Z1-IFRS mutant was obtained using N7Y_F / R, H63L / K67N_F / R and V74W / D76N_F / R in Table 2 as primers and Z0-IFRS as template; Z4-IFRS mutant was obtained using N7Y_F / R, H63L / K67N_F / R and V74W / D76H_F / R in Table 2 as primers and Z0-IFRS as template.

[0120] Table 2 Primers for constructing mutants Z1-IFRS, Z2-IFRS, Z3-IFRS, and Z4-IFRS based on Z0-IFRS

[0121] Primer Name Primer Sequence (5’ to 3’) Sequence Number N7Y_F CCGCTGTATACCCTGATTTCGGCGACCGGGCT 40 N7Y_R ATCAGGGTATACAGCGGCTTTTTGTCCATCAT 41 H63L_F GTGCACTGAAATACCTGAAATACCGCAAAACATGTAAACGT 42 H63L_R CAGGTATTTCAGTGCACGTGCCGGACGGCTAC 43 H63I_F GTGCACTGAAATACATTAAATACCGCAAAACATGTAAACGT 44 H63I_R AATGTATTTCAGTGCACGTGCCGGACGGCTAC 45 K67N_F CCGCAATACATGTAAACGTTGTCGTGTGAGCG 46 K67N_R GTTTACATGTATTGCGGTATTTATGGTATTTCAGTGC 47 V74W_F TTGTCGTTGGAGCGATGAGGATCTGAATAAATTTC 48 V74W_R CATCGCTCCAACGACAACGTTTACATGT 49 V74F_F CGTTGTCGTTTTAGCGATGAGGATCTGAATAAATTTC 50 V74F_R TCGCTAAAACGACAACGTTTACATGT 51 D76N_F TGTGAGCAATGAGGATCTGAATAAATTTCTGACCAA 52 D76N_R GATCCTCATTGCTCACACGACAACGTTTACATG 53 D76H_F TGTGAGCCATGAGGATCTGAATAAATTTCTGACCAA 54 D76H_R GATCCTCATGGCTCACACGACAACGTTTACATG 55 H63L / K67N_F GGCACGTGCACTGAAATATCTGAAATACCGCAATACATGTAAACGTTGTCGT 56 H63L / K67N_R TATTTCAGTGCACGTGCCGGACGGCTACTACGACTATTGTTGACA 57 H63I / K67N_F GGCACGTGCACTGAAATATATTAAATACCGCAATACATGTAAACGTTGTCGT 58 H63I / K67N_R TATTTCAGTGCACGTGCCGGACGGCTACTACGACTATTGTTGACA 59 V74W / D76N_F TCGTTGGAGCAATGAGGATCTGAATAAATTTCTGACCAA 60 V74W / D76N_R CCTCATTGCTCCAACGACAACGTTTACATGT 61 V74W / D76H_F TGTCGTTGGAGCCATGAGGATCTGAATAAATTTCTGACCAA 62 V74W / D76H_R TCATGGCTCCAACGACAACGTTTACATGT 63

[0122] The mutation information and corresponding PCR primers of Z1-IFRS mutant, Z2-IFRS mutant, Z3-IFRS mutant and Z4-IFRS mutant are shown in Table 3.

[0123] Table 3

[0124]

[0125] 1.3. Construction of pGFP2TAG plasmid containing GFP

[0126] The gene sequence of GFP (nucleotide sequence as shown in SEQ ID NO.11) with the serine at the second site mutated to the amber stop codon TAG was commissioned to Qingke Biotechnology Co., Ltd., and inserted into the restriction sites NdeI and Pst I of the vector pBK to obtain the recombinant plasmid pBK-GFP. The recombinant plasmid pBK-IFRS was then transformed into DH10B competent cells using the heat shock method, and the plasmid containing the GFP gene was obtained after sequencing verification.

[0127] Using the obtained recombinant plasmid pBK-GFP as a template, upstream and downstream primers covering the mutation site were designed (Table 4) to perform whole plasmid PCR.

[0128] Table 4 Mutation primers designed for position 2 of GFP

[0129]

[0130]

[0131] PCR amplification system:

[0132]

[0133] PCR amplification conditions: 1) pre-denaturation: 95℃3min; 2) denaturation: 95℃10s; annealing: 60℃15s; extension: 72℃1min; 33 cycles in total; 3) post-extension: 72℃5min; 4) storage at 4℃.

[0134] The pGFP2TAG amplification product was obtained.

[0135] 1.2.2 Conversion and Verification

[0136] Using the heat shock method, 10 μL of the PCR product obtained in step 1.2 was directly transferred to the DH10B competent cells melted on ice. The centrifuge tube was placed in a 42°C water bath for 90 seconds, and then placed on ice for 2 minutes before adding 700 μL of LB medium. After incubation on a 37°C shaker for 60 minutes, it was spread on a solid medium containing the corresponding resistance (pBK plasmid is kanamycin resistance, and pGFP plasmid is tetracycline resistance). Cultured at 37°C for 12 hours, picked bacteria, and sent for sequencing after 8 hours of culture. After sequencing verification, the IFRSTBD region mutant strains Z1-IFRS, Z2-IFRS, Z3-IFRS, Z4-IFRS and pGFP2TAG recombinant plasmid were obtained.

[0137] 1.3. Liveness Detection

[0138] 1) The pGFP2TAG recombinant plasmid was co-transformed with IFRS: 12 mutants with 1 mutation site, 2 mutants with 3 mutation sites, 2 mutants with 4 mutation sites and 1 mutant with 5 mutation sites, Z0-IFRS, single-point mutations based on Z0-IFRS (Z0-N7Y-IFRS mutant, Z0-H63L-IFRS mutant, Z0-H63I-IFRS mutant, Z0-V74W-IFRS mutant, Z0-K67N-IFRS mutant, Z0-D76N-IFRS mutant, Z0-D76H-IFRS mutant), and Z1-IFRS mutant, Z2-IFRS mutant, Z3-IFRS mutant, and Z4-IFRS mutant into DH10B Escherichia coli competent cells, spread on LB solid medium plates containing kanamycin (Kan) and tetracycline (Tet), and cultured overnight at 37°C.

[0139] 2) Four single bacteria were selected from each resistance plate and placed in 5 mL of liquid LB medium containing Kan and Tet, and cultured at 37°C, 300 rpm in a shaker for 8 h. The OD 600 Around 0.6.

[0140] 3) Then centrifuge at 4000 rpm for 10 min, resuspend in GMML medium (containing 50 μg / mL Kan, 12.5 μg / mL Tet, 0.2% Ara) and transfer to a 96-well plate. The final volume of each well is 200 μL. Adjust the OD 600 At 0.2-0.3.

[0141] A control group with a final concentration of 1 mM NCAA (specifically 3BrF) and a control group without NCAA were set up, and the culture was continued at 37°C and 800 rpm for 12 h. The OD was measured using an enzyme marker. 600 and fluorescence intensity (excitation: 485nm, emission: 515nm), and relative fluorescence intensity (fluorescence intensity vs. OD 600 The results are shown in Table 5 and Figure 2 .

[0142] Table 5 Relative fluorescence intensity of 3BrF by single and combined mutations of IFRS

[0143]

[0144]

[0145] from Figure 2 As shown in Table 5, compared with the IFRS group, the introduction efficiency of 3BrF in the Z1-IFRS group, the Z2-IFRS group, the Z3-IFRS group and the Z4-IFRS group were greatly improved, and the expression level of the wild-type GFP was reached.

[0146] The ratio of the relative fluorescence intensity measured with 1 mM NCAA to the relative fluorescence intensity of wild-type GFP is the introduction efficiency.

[0147] As can be seen from Table 5, the introduction efficiency of IFRS is only 4.2%; the introduction efficiency of the Z0-IFRS mutant is 45%; the introduction efficiency of single-point mutation based on the Z0-IFRS mutant is between 50.9% and 67.3%; the introduction efficiency of the Z1-IFRS mutant, Z2-IFRS mutant, Z3-IFRS mutant and Z4-IFRS mutant formed on the basis of the Z0-IFRS mutant are 114.9%, 104.5%, 108.2% and 103.2% respectively.

[0148] Example 2

[0149] In this example, the Z1-IFRS mutant obtained in Example 1 was used as an example to investigate the efficiency of introducing different phenylalanine derivatives into the polypeptide, including the following:

[0150] 2.1. NCAA preparation

[0151] The concentrations of different phenylalanine derivatives were prepared into a stock solution with a concentration of 100 mM, which was diluted 100 times before use, with a final concentration of 1 mM.

[0152] The non-natural amino acids involved in this example are NC2, NC3, NC4, NC5, NC6, NC7, NC8, NC9, NC10, NC11, and NC12.

[0153] NC2 is 3-fluoro-L-phenylalanine (3FF), NC3 is 2,3-fluoro-L-phenylalanine (23FF), NC4 is 2,4-fluoro-L-phenylalanine (24FF), NC5 is 2,5-fluoro-L-phenylalanine (25FF), NC6 is 3,4,5-fluoro-L-phenylalanine (345FF), NC7 is 2,3,6-fluoro-L-phenylalanine (236FF), NC8 is 5-bromo-2-chloro-L-phenylalanine (5Br2ClF), NC9 is 2-chloro-L-phenylalanine (2ClF), NC10 is 3,4-chloro-L-phenylalanine (34ClF), NC11 is 2-thienyl-L-alanine (2ThiA), and NC12 is 3-bromo-2-thienyl-L-alanine (BrThiA).

[0154] 2.2. Liveness Verification

[0155] The activity detection method of Z1-IFRS mutant is the same as the activity detection method in step 1.3 of Example 1. The results are as follows Figure 3 , Table 6.

[0156] At the same time, IFRS is used as a comparison.

[0157] Table 6 Activity data of IFRS and Z1-IFRS against various phenylalanine analogs

[0158]

[0159] from Figure 3 As shown in Table 6, the introduction efficiency of Z1-IFRS for NC2, NC3, NC4, NC5, NC6, NC7, NC8, NC9, NC10, NC11 and NC12 was greatly improved compared with IFRS, with the introduction efficiency ranging from 27.5% to 135.2%. Among them, the introduction efficiency of NC3, NC5, NC6 and NC10 reached a level close to that of wild-type GFP, which were 135.2%, 91.1%, 92.2% and 93%, respectively.

[0160] In addition, Z1-IFRS also significantly increased the fluorescence intensity of the control group without NCAA, indicating that the mutation in the TBD region has no substrate specificity for non-natural amino acids and plays a direct role in improving the binding efficiency of tRNA and aminoacyl-AMP.

[0161] Example 3 Expression and purification of unnatural amino acids

[0162] The present invention evolves four PylRS mutants with multi-site mutations in the TBD region, namely, Z1-IFRS mutant, Z2-IFRS mutant, Z3-IFRS mutant, and Z4-IFRS mutant, and verifies in Examples 1 and 2 that the introduction efficiency in a small volume LB medium is greatly improved.

[0163] For further verification, an amplified culture experiment using 200 mL of LB medium was performed in this example to further highlight the effect of the mutation in the TBD region by purifying the GFP yield containing different unnatural amino acids.

[0164] 3.1. Expression and purification of GFP protein using mutants introduced into 3BrF

[0165] The expression and purification method is as follows:

[0166] 1) Plasmid IFRS, plasmid Z1-IFRS, plasmid Z2-IFRS, plasmid Z3-IFRS and plasmid Z4-IFRS obtained in Example 1 were co-transformed into DH10B competent cells with plasmid pGFP2TAG, and after heat shock incubation, they were spread on LB solid culture medium plates containing Kan and Tet, and inverted and cultured at 37° C. overnight;

[0167] 2) Pick a single colony and transfer it to 5 mL of LB liquid medium containing Kan and Tet, and culture it at 37°C and 220 rpm for 10 h;

[0168] 3) Transfer 2 mL of each to 200 mL of LB liquid medium containing Kan and Tet, culture at 37°C, 220 rpm, and then add Ara (arabinose, final concentration 0.2%) and 3-bromo-L-phenylalanine (3BrF) (final concentration 1 mM). Continue induction culture at 30°C, 220 rpm for 16 hours;

[0169] 4) After the culture is completed, the bacterial cells are collected by centrifugation at 4000 rpm for 20 min, the centrifuged cells are resuspended in PBS buffer, and the cells are broken by ultrasonic disruptor;

[0170] 5) The cell lysate was then centrifuged at 8000 rpm for 20 min and the supernatant was collected and passed through a membrane for later use;

[0171] 6) Ni-NTA affinity column purification: Rinse the Ni-NTA affinity column with 10 column volumes of deionized water, and balance the affinity column with 10 column volumes of 20mM imidazole solution. Load the supernatant obtained in step 5) onto the column. Rinse the affinity column with 15 column volumes of 50mM imidazole solution to remove foreign proteins. Rinse the affinity column with 2 column volumes of 250mM imidazole to elute the target protein, and collect the eluate and store it on ice. After rinsing with 10 column volumes of 500mM imidazole and 10 column volumes of deionized water, preserve the Ni-NTA affinity column with 20% ethanol and store it at 4°C.

[0172] 7) Take 40 μL of the collected GFP protein (obtained by elution) (in order to control the protein bands within the appropriate range, the GFP protein containing the TBD region mutation group was diluted 10 times), add 10 μL of 5× SDS-PAGE protein loading buffer, mix well and heat at 100°C for 10 min. Use 4-20% protein precast gel for protein electrophoresis, load 20 μL per well (160V, 50 min), then stain with Coomassie Brilliant Blue, and take pictures after decolorization.

[0173] Coomassie brilliant blue staining results are shown in Figure 4 .

[0174] from Figure 4 It can be seen that around the molecular weight of the target protein of 28 kDa, obvious protein bands can be seen. Even if the GFP protein of the TBD region mutation group is diluted 10 times, the bands in lane 1 are much narrower than those in lanes 2, 3, 4 and 5. The thicker the bands, the higher the yield of the unnatural amino acid, indicating that the efficiency of the mutant in introducing the unnatural amino acid is also high. This fully demonstrates that when the TBD mutation is added, the efficiency of IFRS in introducing the unnatural amino acid 3BrF is greatly improved.

Claims

1. A pyrrolysyl-tRNA synthetase mutant, characterized in that Based on the amino acid sequence of pyrrolysyl-tRNA synthetase, the mutant includes one or more of the following mutations: Aspartic acid at position 2 mutated to asparagine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, threonine at position 122 mutated to serine and serine at position 193 mutated to arginine; The amino acid sequence of the pyrrolysyl-tRNA synthetase comprises the sequence shown in SEQ ID NO.

1.

2. The mutant according to claim 1, characterized in that The mutant also includes one or more of mutations A1)-A5): A1) Asparagine at position 7 was mutated to tyrosine; A2) The histidine at position 63 is mutated to leucine or isoleucine; A3) Lysine at position 67 was mutated to asparagine; A4) Valine at position 74 is mutated to tryptophan or phenylalanine; A5) Aspartic acid at position 76 was mutated to asparagine or histidine.

3. The mutant according to claim 1, characterized in that The mutants also include one or more of the following mutations: 1) Aspartic acid at position 2 mutated to asparagine, asparagine at position 7 mutated to tyrosine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, histidine at position 63 mutated to leucine, lysine at position 67 mutated to asparagine, valine at position 74 mutated to tryptophan, threonine at position 122 mutated to serine, and serine at position 193 mutated to arginine; 2) Aspartic acid at position 2 mutated to asparagine, asparagine at position 7 mutated to tyrosine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, histidine at position 63 mutated to leucine, lysine at position 67 mutated to asparagine, valine at position 74 mutated to tryptophan, aspartic acid at position 76 mutated to asparagine, threonine at position 122 mutated to serine, and serine at position 193 mutated to arginine; 3) Aspartic acid at position 2 mutated to asparagine, asparagine at position 7 mutated to tyrosine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, histidine at position 63 mutated to leucine, lysine at position 67 mutated to asparagine, valine at position 74 mutated to tryptophan, aspartic acid at position 76 mutated to histidine, threonine at position 122 mutated to serine, and serine at position 193 mutated to arginine; 4) Aspartic acid at position 2 mutated to asparagine, asparagine at position 7 mutated to tyrosine, valine at position 31 mutated to isoleucine, threonine at position 56 mutated to proline, arginine at position 61 mutated to lysine, histidine at position 62 mutated to tyrosine, histidine at position 63 mutated to isoleucine, lysine at position 67 mutated to asparagine, valine at position 74 mutated to phenylalanine, threonine at position 122 mutated to serine and serine at position 193 mutated to arginine.

4. An isolated polynucleotide, characterized in that Encoding the pyrrolysyl-tRNA synthetase mutant according to any one of claims 1 to 3.

5. The polynucleotide according to claim 4, characterized in that The nucleotide sequence of the polynucleotide is selected from one or more of the sequences shown in SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8 and SEQ ID NO.

10.

6. A nucleic acid construct, characterized in that Comprising the polynucleotide according to claim 4 or 5.

7. A host, characterized in that The nucleic acid construct or gene according to claim 6 is integrated with the polynucleotide according to claim 4 or 5.

8. Use of the mutant according to claim 1, the polynucleotide according to claim 4, the nucleic acid construct according to claim 6, or the host according to claim 7 in producing unnatural amino acids.

9. A method for producing unnatural amino acids, characterized in that The steps include: The mutant according to claim 1 or the polynucleotide according to claim 4 or the nucleic acid construct according to claim 6 or the host according to claim 7 is added to a reaction system containing a non-natural amino acid for reaction.

10. The method according to claim 9, characterized in that The reaction system further comprises an inducer, and the inducer is arabinose; and / or, based on the total volume of the reaction system, the concentration of the unnatural amino acid is 0.05 to 2 mM; And / or, the non-natural amino acid is selected from one or more of 3-bromo-L-phenylalanine, 3-fluoro-L-phenylalanine, 2,3-fluoro-L-phenylalanine, 2,4-fluoro-L-phenylalanine, 2,5-fluoro-L-phenylalanine, 3,4,5-fluoro-L-phenylalanine, 2,3,6-fluoro-L-phenylalanine, 5-bromo-2-chloro-L-phenylalanine, 2-chloro-L-phenylalanine, 3,4-chloro-L-phenylalanine, 2-thienyl-L-alanine and 3-bromo-2-thienyl-L-alanine.

Images