DNA tetrahedron and its use
By designing a stable DNA tetrahedral structure to bind to extracellular vesicles, the problems of DNA probe instability within cells and limited optical imaging depth were solved, enabling precise quantitative detection and imaging of targeted nucleotides and improving imaging stability and sensitivity.
Patent Information
- Application Number
- CN202411319085.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-21
- Publication Date
- 2026-03-31
- Estimated Expiration
- 2044-09-21
AI Technical Summary
Existing DNA probes are unstable in cells and are not suitable for super-resolution microscopy imaging. Traditional single-stranded DNA probes are easily degraded by nucleases, and optical imaging has limited penetration depth in in vivo imaging, making it difficult to achieve real-time dynamic monitoring of exosomes.
A DNA tetrahedral structure is designed to form a stable tetrahedral framework through complementary base pairing, carrying a fluorescent group for the capture and imaging of targeted nucleotides. Combined with extracellular vesicles derived from mesenchymal stem cells as a delivery platform, an EV-TDN complex is formed, achieving high biocompatibility and programmability.
It enables precise quantitative detection and imaging of targeted nucleotides, allowing for safe, accurate, and non-invasive tracking of the behavior and therapeutic effects of extracellular vesicles in vivo, and improving the stability and sensitivity of imaging.
Smart Images

Figure BDA0005053189090000121 
Figure HDA0005053189100000011 
Figure HDA0005053189100000012
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biological detection technology, specifically relating to a DNA tetrahedron and its applications. Background Technology
[0002] Since SEEMAN first designed the first four-armed nucleic acid junction in 1982 (SEEMAN N C. Nucleic acid junctions and lattices[J]. J Theor Biol, 1982, 99(2):237-247.), the development of DNA nanostructures has gradually progressed, and related nanomaterials have achieved significant development and wide application in the biomedical field. In recent years, third-generation nanostructures have achieved a breakthrough from two-dimensional (2D) to three-dimensional (3D) structures. As a representative of 3D DNA nanostructures, tetrahedral framework nucleic acid (tFNA) was developed by TURBERFIELD and his collaborators. It is composed of four equal-length single-stranded DNA molecules mixed in equal amounts. The tetrahedral DNA used for detection is a three-dimensional DNA nanostructure composed of four ssDNA strands (GOODMAN RP, SCHAAP IA, TARDIN CF, et al. Rapid chiral assembly of rigid DNA building blocks for molecular nanoofabrication[J]. Science, 2005, 310(5754):1661-1665.). The four ssDNA strands form a double-stranded DNA structure through base complementarity, constituting the six sides of the tetrahedral DNA. Of the four ssDNA strands, three are fixed to the sensor surface, forming the three vertices of the tetrahedral DNA. The other, longer ssDNA strand, in addition to its pairing with the other three ssDNA strands, extends a section away from the sensor surface, forming the fourth vertex of the tetrahedron, which is used to recognize its target molecule.
[0003] DNA tetrahedral nanostructures possess inherent advantages such as biocompatibility, structural stability, programmability, ease of internalization, and editability, and have broad application prospects in drug delivery and biomedical therapy (Hu Q, Li H, Wang L, et al. DNA nanotechnology-enabled drug delivery systems. Chemical Reviews, 2019, 119(10):6459-6506.). They can effectively deliver therapeutic components into cells as biological carriers, while overcoming drug instability and biological barriers, and improving their dispersibility and stability, thereby enhancing the therapeutic effect by improving the efficacy of free drugs (ZHANG XL, LIU NX, ZHOU M, et al. The application of tetrahedral framework nucleic acids as a drug carrier in biomedicine fields[J]. Curr Stem Cell Res Ther, 2021, 16(1):48-56.). The typical spatial structure of tFNA allows it to permeate the cell wall or cell membrane, effectively enhancing drug efficacy (Ye Dekai, Zuo Xiaolei, Fan Chunhai. Sensing interface regulation and biodetection applications based on DNA nanostructures [J]. Progress in Chemistry, 2017, 29(1):36-46.). Current research in this area mainly involves: 1) Biological carriers and tumor drug delivery, such as constructing novel self-assembled complexes to improve the efficacy of free drugs, carrying small RNA molecules to slow cancer progression, and precise targeted therapy using self-assembled complexes. 2) Regulating inflammation and immune responses, such as reducing inflammatory factors, treating inflammatory diseases, preventing diabetes, and acting as immunomodulators. 3) Promoting tissue regeneration, such as promoting stem cell proliferation and differentiation, promoting peripheral nerve regeneration, and promoting wound repair through angiogenesis.
[0004] DNA nanotechnology is a novel nanotechnology developed based on the high-precision base complementary pairing principle and the high designability of DNA sequences. Its high programmability is unmatched by any other material. Probes based on DNA nanotechnology have also attracted extensive research from scientists. Among them, the design of DNA probes is the key, which directly determines the luminescence performance. Generally, it is required to have both high photon density and good specificity. Traditional single-stranded DNA probes are loose and soft in structure and are easily decomposed by intracellular nucleases, which is not conducive to imaging. Moreover, due to the random excitation principle of super-resolution, they are not suitable for super-resolution microscopes such as STROM. Nanoprobes based on the tetrahedral structure of DNA have unique advantages: (1) They have good biocompatibility and can be actively taken up by cells through endocytosis and remain stable for more than 48 hours. (2) They have good programmability and can change the density of fluorescent groups by changing their size. (3) They can be flexibly designed for different biomolecules (such as DNA, microRNA, etc.) and are expected to achieve super-resolution imaging at the nucleic acid level.
[0005] In vivo dynamic imaging studies of exosomes are crucial. Existing in vivo exosome imaging modalities include optical imaging, nuclear medicine imaging, magnetic resonance imaging, photoacoustic imaging, and X-ray CT imaging. Among these, optical imaging methods mainly include fluorescence imaging (FLI) and bioluminescence imaging (BLI). Optical imaging has limited penetration depth in vivo, and signal attenuation and resolution decrease with increasing imaging depth, thus having certain limitations. In vivo imaging of exosomes allows for real-time dynamic monitoring of their biological behavior, uptake mechanisms, dynamic distribution, and metabolism, providing crucial in vivo imaging information. This enables in-depth research at different levels into processes such as tumor metastasis, stem cell therapy, and drug delivery (Jiang XC, Zhang T, Gao JQ. The in vivo fate and targeting engineering of crossover vesicle-based gene delivery system[J]. Adv Drug Deliv Rev. 2022, 187:114324.), and has significant clinical implications.
[0006] Noninvasive in vivo tracing techniques for extracellular vesicles (EVs) are important tools for developing and optimizing their diagnostic and therapeutic effects. Molecular imaging techniques can provide direct information for studying the biological behavior of exogenous EVs in vivo (KIM DH, KOTHANDAN VK, KIM HW, et al. Noninvasive assessment of exosome pharmacokinetics in vivo: a review[J]. Pharmaceutics, 2019, 11(12): 649.). However, tracking exosomes (EVs) in vivo is a challenge (BETZER O, BARNOY E, SADAN T, et al. Advances inimaging strategies for in vivo tracking of exosomes[J]. Wiley Interdiscip RevNanomed Nanobiotechnol, 2020, 12(2):e1594.). Besides requiring reliable technical operation, it is also necessary to ensure the membrane integrity and bioactivity of EVs after labeling with exogenous probes (KOUREMBANAS S. Exosomes: vehicles of intercellular signaling, biomarkers, and vectors of cell therapy[J]. Annu RevPhysiol, 2015, 77:13-27.). In the ever-evolving field of nanotechnology, molecular imaging helps guide the development of EV applications in medical diagnosis and treatment. In vivo tracking of EVs can help people better understand physiological and pathological processes, promote the clinical development of EV-based drug delivery systems, and is crucial for developing reliable therapeutic and diagnostic tools. By encapsulating DNA tetrahedra targeting specific microRNAs into extracellular vesicles derived from mesenchymal stem cells, changes in fluorescence intensity can achieve both imaging and therapeutic purposes.
[0007] By utilizing chemical labeling, structural modification, and ingenious sequence design, DNA polyhedral nanostructures can serve as a universal platform for constructing various fluorescent probes. Therefore, it is essential to develop imaging probes with good biosafety, good water solubility, and high sensitivity. Summary of the Invention
[0008] This invention discovers a tetrahedral DNA TDN that is programmable, highly stable, and highly biocompatible; it can bind to specific nucleotide sequences, such as extracellular vesicles (EVs) to form an EV-TDN complex, enabling real-time visualization and monitoring of EVs. Based on this, this invention was completed.
[0009] In a first aspect, the present invention provides a DNA tetrahedral TDN, wherein the tetrahedron is composed of 6 sides made up of DNA strands, wherein at least one side is a single strand of DNA and the rest are double strands of DNA, and the single strand of DNA in the tetrahedron is complementary to the target nucleotide, thereby capturing the target nucleotide.
[0010] Furthermore, the DNA double-stranded region in the tetrahedron is formed by local complementary pairing of nucleotides as shown in SEQ ID NO.1 to 6.
[0011] Furthermore, the nucleotides shown in SEQ ID NO. 1 to 6 also include nucleotides having 80%-100% homology with them, preferably nucleotides having 90%-100% homology with them, more preferably nucleotides having 95%-100% homology with them, and even more preferably nucleotides having 99%-100% homology with them.
[0012] Furthermore, in one specific embodiment of the present invention, the DNA strand carries a fluorescent group when constituting a fluorescent probe, and the fluorescent group is located at any position on the DNA strand; preferably, the fluorescent group is located at a position where the spatial distance between the donor and acceptor molecules is 7-10 nm and the fluorescence quenching will not occur between the donor and acceptor fluorophores themselves.
[0013] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.
[0014] Furthermore, the donor is an electron-receiving fluorophore, such as Cy5.
[0015] Furthermore, the acceptor is an electron-providing fluorophore, such as Cy3.
[0016] Furthermore, when the fluorescent groups carried are Cy3 and Cy5, it is preferred that Cy3 is labeled in strand 1 of the DNA tetrahedron, Cy5 is labeled in strand 2, and Cy5 is labeled at the 3' end of strand 6.
[0017] Furthermore, the DNA sequences of strands 1, 2, and 6 are shown in SEQ ID NO. 1, 2, and 6.
[0018] Furthermore, the targeted nucleotide refers to a targeted single-stranded nucleotide; preferably a short-stranded nucleotide with a sequence length not exceeding 24 bp, such as microRNA or small interfering RNA.
[0019] Furthermore, the microRNA can be any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.
[0020] Secondly, the present invention provides a method for preparing DNA tetrahedra, the method comprising the following steps:
[0021] S1. Dissolve the nucleotides of the DNA strands shown in SEQ ID NO.1 to 6 in buffer solution and mix well;
[0022] S2. Perform PCR reaction on the solution from step S1 to obtain DNA tetrahedra.
[0023] Furthermore, the nucleotides shown in SEQ ID NO. 1 to 6 carry fluorescent groups, and the resulting DNA tetrahedron is called a fluorescent probe, used to capture target nucleotides. When the DNA strand forms the fluorescent probe, it carries a fluorescent group, which is located at any position on the DNA strand; preferably, the fluorescent group is located at a position where the spatial distance between the donor and acceptor molecules is 7 to 10 nm and where fluorescence quenching will not occur between the donor and acceptor fluorophores themselves.
[0024] Furthermore, the nucleotides shown in SEQ ID NO. 1 to 6 also include nucleotides having 80%-100% homology with them, preferably nucleotides having 90%-100% homology with them, more preferably nucleotides having 95%-100% homology with them, and even more preferably nucleotides having 99%-100% homology with them.
[0025] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.
[0026] Furthermore, the donor is an electron-receiving fluorophore, such as Cy5.
[0027] Furthermore, the acceptor is an electron-providing fluorophore, such as Cy3.
[0028] Furthermore, when the fluorescent groups carried are Cy3 and Cy5, it is preferred that Cy3 is labeled in strand 1 of the DNA tetrahedron, Cy5 is labeled in strand 2, and Cy5 is labeled at the 3' end of strand 6.
[0029] Furthermore, the DNA sequences of strands 1, 2, and 6 are shown in SEQ ID NO. 1, 2, and 6.
[0030] Furthermore, the targeted nucleotide refers to a targeted single-stranded nucleotide; preferably a short-stranded nucleotide with a sequence length not exceeding 24 bp, such as microRNA or small interfering RNA.
[0031] Furthermore, the microRNA can be any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.
[0032] Thirdly, the present invention provides an extracellular vesicle DNA tetrahedral (EV-TDN) complex, wherein the complex is composed of one or more single strands of TDN and complementary nucleotides inside one or more EVs, wherein the TDN can capture nucleotides inside the EV.
[0033] Furthermore, the DNA double-stranded region in the tetrahedron is formed by local complementary pairing of nucleotides as shown in SEQ ID NO.1 to 6.
[0034] Furthermore, the nucleotides shown in SEQ ID NO. 1 to 6 also include nucleotides having 80%-100% homology with them, preferably nucleotides having 90%-100% homology with them, more preferably nucleotides having 95%-100% homology with them, and even more preferably nucleotides having 99%-100% homology with them.
[0035] Furthermore, when the DNA strand forms a fluorescent probe, it carries a fluorescent group, which is located at any position on the DNA strand; preferably, the spatial distance between the fluorescent group donor and acceptor molecules is 7-10 nm and the position between the donor and acceptor fluorophores themselves will not cause fluorescence quenching.
[0036] Furthermore, the carried fluorescent group is a conjugated fluorescent group, such as CFP-YFP; CFP-dsRED; BFP-GFP; GFP-dsRED; YFP-dsRED; Cy3-Cy5; Alexa488-Alexa555; Alexa488-Cy3; FITC-Rhodamine (TRITC); YFP-TRITC; YFP-Cy; preferably Cy3 and Cy5.
[0037] Furthermore, the donor is an electron-receiving fluorophore, such as Cy5.
[0038] Furthermore, the acceptor is an electron-providing fluorophore, such as Cy3.
[0039] Furthermore, when the fluorescent groups carried are Cy3 and Cy5, it is preferred that Cy3 is labeled in strand 1 of the DNA tetrahedron, Cy5 is labeled in strand 2, and Cy5 is labeled at the 3' end of strand 6.
[0040] Furthermore, the DNA sequences of strands 1, 2, and 6 are shown in SEQ ID NO. 1, 2, and 6.
[0041] Furthermore, the targeted nucleotide refers to a targeted single-stranded nucleotide; preferably a short-stranded nucleotide with a sequence length not exceeding 24 bp, such as microRNA or small interfering RNA.
[0042] Furthermore, the microRNA can be any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.
[0043] Furthermore, the extracellular vesicles are derived from umbilical cord mesenchymal stem cells, adipose-derived mesenchymal stem cells, and / or bone marrow mesenchymal stem cells.
[0044] Fourthly, the present invention provides the use of a DNA tetrahedral structure (TDN) as described in the first aspect as a probe for detecting target nucleotides.
[0045] Furthermore, the targeted nucleotide refers to a targeted single-stranded nucleotide; preferably a short-stranded nucleotide with a sequence length not exceeding 24 bp, such as microRNA or small interfering RNA.
[0046] Furthermore, the microRNA can be any microRNA, such as microRNA 23a, microRNA 125b, microRNA 145 and / or microRNA 21; preferably microRNA 21.
[0047] Fifthly, the present invention provides the use of DNA tetrahedron as a targeted nucleotide molecular imaging agent as described in the first aspect, wherein when one or more single strands of TDN are complementary to one or more targeted nucleotides, the fluorescence of TDN itself can undergo a specific spectral change after the fluorescent group is excited by external excitation light.
[0048] Furthermore, the targeted nucleotide molecular imaging agent is used for extracellular vesicle imaging, cell imaging, and / or imaging of free nucleotides in body fluids.
[0049] Furthermore, when the fluorescent groups are Cy3 and Cy5, TDN itself fluoresces red after excitation by excitation light; TDN-labeled extracellular vesicles fluoresce yellow.
[0050] Furthermore, the excitation wavelength is 440-720nm, preferably 488-525nm; preferably 550-560nm; preferably 570-580nm; preferably 660-700nm.
[0051] Furthermore, the extracellular vesicles are derived from umbilical cord mesenchymal stem cells, adipose-derived mesenchymal stem cells, and / or bone marrow mesenchymal stem cells.
[0052] Furthermore, the extracellular vesicle imaging is in vivo imaging and / or ex vivo imaging.
[0053] Beneficial effects
[0054] The DNA tetrahedral fluorescent probe prepared in this invention is a microRNA targeting probe based on DNA plasticity. Different types of miRNAs cause significant differences in DNA tetrahedral fluorescence, meaning that the DNA tetrahedral structure (TDN) can be used as a probe to detect targeted nucleotides. Utilizing the inherent biocompatibility, structural stability, programmability, ease of internalization, and editability of DNA tetrahedral nanostructures, an EV-TDN complex can be synthesized using extracellular vesicles derived from mesenchymal stem cells as a delivery platform. This complex improves safety, enhances the target organ / systemic signal ratio, and accurately and quantitatively tracks the behavior of EVs in mice for seven consecutive days without affecting their regenerative capacity or therapeutic efficacy. The DNA tetrahedral fluorescent probe TDN designed in this application can be used to detect targeted nucleotides; it can safely, accurately, non-invasively, in real-time, and quantitatively characterize the fate and therapeutic effects of EVs in lung organs and even vital systems, and can be applied to biosensing and disease diagnostic research. Attached Figure Description
[0055] Figure 1 Fluorescence spectra of DNA tetrahedra after co-incubation with different types of miR-21-5p for 2 hours.
[0056] Figure 2 DNA tetrahedron detection of nucleic acid - linearity data. (A) Fluorescence spectra of DNA tetrahedrons after co-incubation with different concentrations of miR-21-5p for 2 h; (B) Fluorescence intensity of DNA tetrahedrons after co-incubation with different concentrations of miR-21-5p for 2 h at 570 nm; (C) Corresponding calibration curves. (n=3, mean±sd).
[0057] Figure 3 DNA tetrahedral probes were characterized by 5% agarose gel electrophoresis. (A) TDN probe; (B) TDN probe bound to miR-21.
[0058] Figure 4 Atomic force microscopy characterizes TDN and a TDN probe bound to miR-21. (A) TDN probe; (B) TDN probe bound to miR-21; (C) Size comparison.
[0059] Figure 5 Fluorescence changes of TDN probes and TDN probes bound to miR-21.
[0060] Figure 6 The effect of changes in the position and number of Cy5 fluorophores on the fluorescence intensity of TDN probes. (A) Fluorescence intensity of TDN probes carrying fluorophores on chains 2, 5, and 6; (B) Schematic diagram of the position of TDN fluorophores; (C) Emission peaks (Cy3 emission peak / Cy5 emission peak) at different positions and numbers of Cy5 fluorophores.
[0061] Figure 7 PMT voltage setting diagram.
[0062] Figure 8 Nanoflow cytometry results of unlabeled extracellular vesicles (A) and extracellular vesicles labeled with different concentrations of DNA tetrahedral probes (5 uM (B), 10 uM (C), 15 uM (D)). (E) Nanoflow cytometry results of DiO labeled extracellular vesicles. (F) Statistical graph of the results of the above labeling methods.
[0063] Figure 9 Fluorescence stability and labeling efficiency of EV-TDN. (A) Fluorescence stability of 15 μM TDN probe and DiO labeled extracellular vesicles after 12 days; (B) Labeling efficiency of extracellular vesicles labeled with different concentrations of TDN probe and DiO.
[0064] Figure 10 Efficiency and fluorescence stability of EV labeled with TDN probes of different sizes.
[0065] Figure 11Cellular imaging results of EV-TDN (EV-TDN uptake in RAW247.6 cells). Note: Laser confocal microscopy image, cell nuclei labeled with DAPI (blue signal), EV-TDN (red signal), scale bar 25 μm.
[0066] Figure 12 Results of frozen sections of EV-TDN-labeled lung tissue. Note: Laser confocal microscopy images of frozen sections of lung tissue from mice 7 days after EV-TDN injection. EV-TDN is indicated by a yellow signal. Scale bar: 250 μm. Detailed Implementation
[0067] The specific embodiments of the present invention will be further described below. It should be noted that these descriptions are for the purpose of aiding understanding the present invention, but do not constitute a limitation thereof. Furthermore, the technical features involved in the embodiments described below can be combined with each other as long as they do not conflict with each other.
[0068] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods, and the experimental materials used in the following embodiments are all available through conventional commercial channels.
[0069] the term
[0070] RAW264.7 cells are a cell line derived from the rat small intestinal cell line, originating from tumors induced by Abelson's murine leukemia virus; they are negative for sIg-, Ia-, and Thy-1.2 surface antigens. RAW 264.7 cells do not secrete detectable viral particles and are negative for the XC spot formation assay. RAW 264.7 cells can pinocytose neutral red blood cells and phagocytose latex particles and yeast glycans, and can antibody-dependently break down sheep erythrocytes and tumor target cells. Treatment with LPS or PPD for 2 days can induce erythrocyte breakdown in RAW 264.7 cells, but has no effect on tumor target cells.
[0071] Extracellular vesicles (EVs): EVs are heterogeneous groups of membrane structures secreted by cells and enclosed in a lipid bilayer, containing tiny particles secreted by the cell. EVs vary in biological origin and size: exosomes are smaller vesicles, approximately 50-150 nm in diameter, formed within endosomes, organelles responsible for endocytosis and breakdown of intracellular substances; microvesicles are larger vesicles, ranging from 50-500 nm to 1000 nm in diameter, formed through cell membrane shedding and maturing and separating via protrusions on the cell membrane; apoptotic bodies are larger vesicles formed during cell death, exceeding 1000 nm in diameter, released when cells enter the apoptosis (programmed cell death) process. Extracellular vesicles are cell-derived nanoscale vesicles that mediate intercellular communication by transporting bioactive molecules, and therefore play an important role under various physiological and pathological conditions.
[0072] microRNAs (miRNAs, miRs) are small, non-coding RNA molecules, approximately 18–25 nucleotides in length. They bind to target mRNAs through complete or incomplete complementarity, leading to the degradation of the target mRNA or repression of translation. They play a crucial role in the post-transcriptional regulation of eukaryotic gene expression and are involved in physiological processes such as individual growth and development. Recent studies have found that aberrant expression of microRNAs may play an important role in the development and progression of tumors (such as proliferation, differentiation, and apoptosis).
[0073] miR-21 is one of the earliest miRNAs discovered and identified in mammals, and it has been found in various tissues and cells of 31 species. Like other miRNAs, miR-21 is encoded by the miR-21 gene, which is transcribed in the cell nucleus by RNA polymerase II to produce the initial transcript pri-miR-21. This transcript then undergoes a two-step orderly modification process to form the mature miR-21.
[0074] Mesenchymal stem cells (MSCs) are important members of the stem cell family, belonging to adult stem cells. They originate from the mesoderm and ectoderm in early development. MSCs were first discovered in bone marrow by Friedenstein in 1968 and have attracted increasing attention due to their multi-lineage differentiation potential, hematopoietic support and promotion of stem cell implantation, immune regulation, and self-replication. Under specific induction conditions in vivo or in vitro, MSCs can differentiate into various tissue cells such as fat, bone, cartilage, muscle, tendon, ligament, nerve, liver, myocardium, and endothelial cells. Even after continuous passage culture and cryopreservation, they retain their multi-lineage differentiation potential and can serve as ideal seed cells for the repair of tissue and organ damage caused by aging and disease.
[0075] Example
[0076] Example 1: DNA Tetrahedral Detection of Nucleic Acids - Detection Linear Data
[0077] 1.1 Quantification of Single-Stranded DNA Concentration
[0078] The dry powder of 6 single-stranded DNAs (such as the nucleotides shown in SEQ ID NO.1 to 6) was synthesized by Sangon Biotech, and the concentration of the single-stranded DNA was quantified to 50 μM using a UV-Vis spectrophotometer.
[0079] 1.2 DNA Tetrahedral Synthesis
[0080] (1) DNA tetrahedron synthesis was performed using a 100 μL system, as shown in Table 1:
[0081] Table 1. DNA tetrahedral synthesis system (100 μL)
[0082] DEPC water 78μL 10X™ Buffer 10μL 50μM single-stranded DNA 2μL
[0083] (2) PCR reaction: react at 95℃ for 10 min, then cool down to 4℃;
[0084] (3) The final concentration of the synthesized DNA tetrahedron was 1 μM.
[0085] 1.3 Preparation of miR-21-5p solutions of different concentrations
[0086] miR-21-5p dry powder was synthesized by Sangon Biotech, and the concentration of miR-21-5p was quantified to 50 μM using a UV-Vis spectrophotometer.
[0087] The following miR-21-5p solutions were prepared by dilution:
[0088] 0 nM, 2 nM, 10 nM, 20 nM, 100 nM, 200 nM, 1 μM, 2 μM, 4 μM, 10 μM, 20 μM, 30 μM, 40 μM and 50 μM.
[0089] 1.4 DNA tetrahedra were co-incubated with different concentrations of miR-21-5p in buffer.
[0090] (1) The composition of the 120 μL incubation system is shown in Table 2:
[0091] Table 2. DNA tetrahedral incubation system (120 μL)
[0092] DEPC water 2μL 10XPBS 12μL 1μM DNA tetrahedron 100μL miR-21-5p 6μL
[0093] (2) Add different concentrations of miR-21-5p to the above incubation system respectively.
[0094] The miR-21-5p concentrations were changed to:
[0095] 0 nM, 0.1 nM, 0.5 nM, 1 nM, 5 nM, 10 nM, 50 nM, 100 nM, 200 nM, 500 nM, 1 μM, 1.5 μM, 2 μM and 2.5 μM;
[0096] (3) Incubation conditions: react at 37℃ for 2 hours, and rotate at 350 rpm.
[0097] 1.5 Fluorescence value determination
[0098] 120 μL of DNA tetrahedron-miR-21-5p binding buffer was transferred to a 96-well plate, and the fluorescence intensity was measured using a multi-functional microplate reader.
[0099] For obtaining the fluorescence spectrum: the fluorescence value of 500-700 nm was detected by spectral scanning under 488 nm excitation;
[0100] For quantitative analysis comparison: the fluorescence value at 570 nm under 488 nm excitation was detected by endpoint kinetics.
[0101] 1.6 Data Analysis: Data processing and plotting are performed using Origin software.
[0102] 1.7 Test Results
[0103] Figure 1 A shows the fluorescence spectra of DNA tetrahedra after co-incubation with different concentrations of miR-21-5p for 2 hours. Fluorescence values from 500 to 700 nm were detected, with the highest peak around 570 nm.
[0104] Figure 1B represents the fluorescence intensity at 570 nm of DNA tetrahedra co-incubated with different concentrations of miR-21-5p for 2 hours. Figure 1 C represents the corresponding calibration curve. Experimental results show that within the concentration range of 0–2 μM, the fluorescence intensity continuously increases with the increase of miR-21-5p concentration. Specifically, within the concentration range of 0–1 μM, the fluorescence intensity increases linearly with the increase of concentration. However, after the concentration exceeds 2 μM, the fluorescence intensity no longer increases even with the increase of miR-21-5p concentration.
[0105] In summary, this demonstrates that DNA tetrahedrons exhibit a good linear relationship with miR-21-5p, with a linear detection range of 0–1 μM, indicating that DNA tetrahedrons can be used for nucleic acid detection.
[0106] Example 2 DNA Tetrahedral Detection of Nucleic Acids - Selectivity Data
[0107] 2.1 Quantification of Single-Stranded DNA Concentration
[0108] Six single-stranded DNA powders were synthesized by Sangon Biotech, and the concentration of the single-stranded DNA was quantified to 50 μM using a UV-Vis spectrophotometer.
[0109] 2.2 DNA Tetrahedral Synthesis
[0110] (1) DNA tetrahedron synthesis was performed using a 100 μl system, as shown in Table 3:
[0111] Table 3. DNA tetrahedral synthesis system (100 μL)
[0112] DEPC water 78μL 10X™ Buffer 10μL 50μM single-stranded DNA 2μL
[0113] (2) PCR reaction: react at 95℃ for 10 min, then cool down to 4℃;
[0114] (3) The final concentration of the synthesized DNA tetrahedron was 1 μM.
[0115] 2.3 DNA tetrahedrons were co-incubated with different types of miRNAs in buffer solution.
[0116] (1) The composition of the 120 μL incubation system is shown in Table 4:
[0117] Table 4. DNA tetrahedral incubation system (120 μL)
[0118] DEPC water 2μL 10XPBS 12μL 1μM DNA tetrahedron 100μL miRNA 6μL
[0119] (2) Different types of miRNAs were added to the incubation system described above. The types and sequences of the miRNAs are shown in Table 5.
[0120] Table 5. Types and sequences of miRNAs
[0121] miRNA types sequence miR21-5nt UAGCU miR21-10nt UAGCUUAUCA miR21-15nt UAGCUUAUCAGACUG miR21-20nt UAGCUUAUCAGACUGAUGUU mixture GAUUAGGCUUACUUCGAUAUAU miss1 UAGCUUAUCAGACUGAUAUUGA miss2 UAGCUUAUCAGACCGAUAUUGA miss3 UAGCUUAUCAGACCGAUAUCGA miR-21-5p UAGCUUAUCAGACUGAUGUUGA
[0122] (3) Incubation conditions: react at 37℃ for 2 hours, and rotate at 350 rpm.
[0123] 2.4 Fluorescence value determination
[0124] 120 μL of DNA tetrahedron-miRNA binding solution was transferred to a 96-well plate, and the fluorescence intensity was measured using a multi-functional microplate reader.
[0125] For obtaining the fluorescence spectrum: the fluorescence value of 500-700 nm was detected by spectral scanning under 488 nm excitation;
[0126] For quantitative analysis comparison: the fluorescence value at 570 nm under 488 nm excitation was detected by endpoint kinetics.
[0127] 2.5 Data Analysis: Data processing and plotting were performed using Origin software.
[0128] 2.6 Test Results
[0129] To confirm the recognition specificity between DNA tetrahedrons and miRNA 21, different lengths of miRNAs, such as miR21-5nt, miR21-10nt, miR21-15nt, and miR21-20nt (with the same bases as miRNA 21 but different numbers); mixture miRNAs with the same bases as miRNA 21 but different base sequences; and miss1 and miss2 miRNAs with the same number of bases as miRNA 21 but mutated by 1 and 2 bases, respectively, were co-incubated for 2 hours before fluorescence spectra were measured (e.g., ...). Figure 2 (As shown).
[0130] The results showed that different types of miRNAs caused significant differences in DNA tetrahedral fluorescence, which can be used for nucleic acid detection.
[0131] Example 3: Synthesis of DNA Tetrahedral Probes
[0132] 3.1 Test Methods
[0133] (1) Provide six tetrahedral single strands of DNA (2uL) targeting a specific microRNA, including single strands with fluorescent groups, dissolved in buffer and mixed.
[0134] (2) After the PCR reaction, the temperature should be rapidly reduced;
[0135] (3) Add microRNA21 to the system in (2), mix well and incubate; the DNA tetrahedron that binds miR-21 in vitro is TDN-miR21, in which the miR-21 sequence is (5'-3'):
[0136] (4) DNA tetrahedral gel running verification: The gel was stained with gel red, and the DNA tetrahedral synthesis effect was imaged and analyzed by a gel imaging system.
[0137] 3.2 DNA Sequence
[0138] Six tetrahedral single-stranded DNA molecules targeting specific microRNAs, including single strands with fluorescent groups, are shown in Table 6 when the fluorescent groups are Cy3 and Cy5.
[0139] Table 6. Single-stranded DNA sequences with tetrahedral fluorescent groups
[0140]
[0141] 3.3 Test Results
[0142] like Figure 3 As shown, agarose gel electrophoresis confirmed that the TDN probe consists of six DNA single strands and can bind to miR-21 in vitro. Figure 3 Agarose gel electrophoresis in A showed that with the addition of the TDN body structure sequence (chains 1 to 6), the electrophoretic migration rate significantly changed from slowing down to speeding up under the combined effect of DNA single-strand molecular weight and negative charge carrying capacity, and the six DNA single strands synthesized TDN. Figure 3 B-type agarose gel electrophoresis showed that the electrophoretic migration rate of miR-21 slowed down significantly after its addition, indicating that the DNA tetrahedral probe had bound to miR-21. In summary, this confirms that the TDN probe was successfully synthesized and can bind to miRNA.
[0143] like Figure 4 As shown in the atomic force microscopy (AFM) scan, the prepared TDN probe is well dispersed and has a tetrahedral spatial structure. Even after binding to miR-21, the TDN probe retains its tetrahedral spatial structure. The size statistics plot indicates that the TDN probe successfully binds to miR-21 and undergoes a significant size change.
[0144] like Figure 5 As shown, the fluorescence spectrophotometer indicated that the TDN probe exhibited a peak emission at 560-570 nm after excitation at 550 nm. Compared to the free DNA tetrahedral probe, the miR-21-bound TDN probe showed a higher emission peak at 560-570 nm, indicating that the structural change of the TDN probe after miR-21 binding can enhance the fluorescence intensity of the probe and amplify the detection signal.
[0145] like Figure 6 As shown, extracellular vesicles derived from mesenchymal stem cells were obtained by ultracentrifugation. The extracellular vesicles were negatively stained with uranium acetate. Transmission electron microscopy results showed that the extracellular vesicles extracted from mesenchymal stem cells exhibited a typical spherical cup-shaped structure. Nanoparticle tracking analysis showed that the diameter of the extracellular vesicles was 191.5±125.7 nm.
[0146] Example 4: DNA tetrahedrons enter extracellular vesicles derived from mesenchymal stem cells.
[0147] DNA tetrahedra can be introduced into extracellular vesicles of mesenchymal stem cell-derived cells through overnight incubation at 37 degrees Celsius / electroporation, as detailed below:
[0148] 4.1 Obtaining extracellular vesicles derived from mesenchymal stem cells
[0149] (1) Mesenchymal stem cells were cultured in a medium containing extracellular vesicles removed;
[0150] (2) Perform continuous centrifugation to remove cells, apoptotic bodies and cell debris respectively;
[0151] (3) Harvesting extracellular vesicles by centrifugation;
[0152] (4) The precipitate was resuspended and ultraconcentrated to remove contaminating proteins and obtain extracellular vesicles derived from mesenchymal stem cells.
[0153] 4.2 DNA tetrahedrons were incubated overnight at 37 degrees Celsius and then introduced into extracellular vesicles derived from mesenchymal stem cells.
[0154] The synthesized DNA tetrahedrons can be incubated overnight at 37°C and enter extracellular vesicles derived from mesenchymal stem cells. 4.3 Electroporation of DNA tetrahedrons into extracellular vesicles derived from mesenchymal stem cells.
[0155] (1) The synthesized tetrahedrons were concentrated using an ultrafiltration tube as needed to obtain a concentration of 15 μM;
[0156] (2) Pre-cooling of the electric rotary cup;
[0157] (3) Prepare electroporation solution (82 μL Nucloefector) TM Add 20 μL of DNA tetrahedron and 2 μL of extracellular vesicles at a concentration of 25 μg / μL to the electroporation buffer (Solution + 18 μL Supplement), and mix the system thoroughly.
[0158] (4) Transfer the liquid to the electrostatic transfer cup;
[0159] (5) Idling;
[0160] (6) Electro-rotation;
[0161] (7) Cooling after electro-rotation;
[0162] (8) Transfer the liquid in the electroporation cup to the ultrafiltration tube and remove the DNA tetrahedrons that have not entered the extracellular vesicles by ultrafiltration.
[0163] (9) Collect the product in the ultrafiltration tube, rinse the ultrafiltration tube, transfer the rinsing solution to the product collection tube, and obtain the DNA tetrahedrons that have been electroporated into extracellular vesicles derived from mesenchymal stem cells.
[0164] Example 5: Efficiency detection of DNA tetrahedral fluorescent probe dye labeling of extracellular vesicles
[0165] 5.1 Test Procedure
[0166] (1) Using nanoflow cytometry, the PMT voltage setting is as follows: Figure 7 As shown;
[0167] (2) Refer to the instructions for the mixed microspheres to determine the distribution of 110, 180, 240, 300, 500, 590, 880, and 1300 nm standard microspheres; after determining the analytical parameters, determine the size and position by running the standard mixed microspheres.
[0168] (3) Keep the system clean;
[0169] (4) Run the EV-TDN sample, and the sample concentration for analysis is 104-106 / ul;
[0170] (5) Collect and analyze event / s and event / μL;
[0171] (6) Analyze the data. The percentage of the gated area is calculated using the denominator of the total events.
[0172] 5.2 Results
[0173] like Figure 8 AD nanoflow cytometry results showed that unlabeled extracellular vesicles had no fluorescent signal, while TDN-labeled extracellular vesicles showed fluorescent signal and obvious clustering.
[0174] Figure 8 F showed that the labeling efficiency of 10 μM and 15 μM DNA tetrahedral TDN probes was higher than that of 5 μM (P<0.05), confirming that the concentration was positively correlated with the EV labeling efficiency.
[0175] Figure 8 BF confirmed that the labeling efficiency of the 5, 10, and 15 μM DNA tetrahedral probes was higher than that of Dio (P<0.001).
[0176] Therefore, compared to the traditional membrane dye DiO, TDN has high labeling efficiency.
[0177] like Figure 9 Nanoscale flow cytometry analysis showed that the proportion of TDN-labeled extracellular vesicles with fluorescence positivity decreased with increasing number of days.
[0178] Figure 9 B shows that the proportion of 5, 10, and 15 μM EV-TDN fluorescence positivity decreased by no more than 20% within 12 days, indicating that EV-TDN has good fluorescence stability and TDN-labeled materials have high stability.
[0179] like Figure 10 Nano-flow cytometry analysis showed that the proportion of fluorescently positive TDN-labeled extracellular vesicles at 39 nt and 45 nt fluctuated but did not decrease significantly with increasing days, indicating that EV-TDN has good fluorescence stability.
[0180] Figure 10 B shows that 27nt TDN marking is the most efficient, and 39nt TDN marking is more efficient than 45nt.
[0181] Example 6: Application of EV-TDN in Cell Imaging
[0182] 6.1 Test Procedure
[0183] (1) RAW264.7 cells were seeded into cell crawling slides in culture medium;
[0184] (2) Add extracellular vesicles labeled with different concentrations of DNA tetrahedrons (5 μM, 10 μM, 15 μM) and incubate;
[0185] (3) Remove the supernatant and wash the cells;
[0186] (4) Fix the cells and then wash them;
[0187] (5) Incubate the fixed cells with the primary antibody against CD31 overnight;
[0188] (6) Incubate with Alexa Fluor 488 goat anti-mouse IgG or Alexa Fluor 594 goat anti-mouse IgG;
[0189] (7) The cell nuclei were counterstained with 4,6-diamidinyl-2-phenylindole (DAPI) and excited at 520 nm and 530 nm using CLSM.
[0190] Imaging at -700nm signal collection.
[0191] 6.2 Results
[0192] like Figure 11As shown, confocal laser microscopy revealed the colocalization of red fluorescent images (EV-TDN) and blue fluorescent images (DAPI) in RAW247.6 cells. The red fluorescent images (EV-TDN) were aggregated in the perinuclear region, indicating that RAW247.6 cells successfully engulfed EV-TDN, while EV-TDN was mostly distributed in the cytoplasm.
[0193] Example 7: Application of EV-TDN in live imaging
[0194] 7.1 Test Procedure
[0195] (1) Anesthetize C57BL / 6 mice and place them on an animal plate;
[0196] (2) Inject EV-TDN solution into healthy mice;
[0197] (3) Imaging the material distribution in the lung tissue of EV-TDN in mice;
[0198] (4) Light with a center wavelength of 488 nm was selected as the excitation source, and in vivo spectral imaging from 500 nm to 700 nm was performed with an exposure time of 200 m for each image frame. The intensity of the fluorescence signal was quantified by the average radiance of the fixed area region of interest (ROI) from the lung.
[0199] (5) At specified time intervals, mice injected with EV-TDN were sacrificed, and brain tissue was obtained after cardiac perfusion and fixed. Major organs (heart, liver, spleen, lung, and kidney) were separated and in vitro fluorescence imaging was performed using an imaging system.
[0200] (6) The obtained lung tissue was processed, fixed, embedded in an OCT compound, frozen sectioned and imaged under 488nm excitation and 500-700nm signal collection.
[0201] 7.2 Results
[0202] like Figure 12 As shown, yellow dotted and aggregated signals (EV-TDN) were still clearly detected in lung tissue cells on day 7, indicating the stable labeling properties of EV-TDN in mice.
Claims
1. A DNA tetrahedron (TDN) consisting of 6 edges of DNA strands, the nucleotide sequences of the DNA strands are shown as SEQ ID NO. 1~6; when the single DNA strand in the tetrahedron is complementary to a target nucleotide, the target nucleotide can be captured; characterized in that, The preparation method of the DNA tetrahedron TDN comprises the following steps: S1. Dissolve the nucleotides of the DNA chains shown in SEQ ID NO. 1-6 in a buffer solution and mix well; S2. Perform PCR reaction on the solution in step S1. to obtain the DNA tetrahedron.
2. The DNA tetrahedron TDN of claim 1, wherein the targeting nucleotide is a targeting single-stranded nucleotide; the single-stranded nucleotide is a short-chain nucleotide with a sequence length of not more than 24 bp, and the short-chain nucleotide with a sequence length of not more than 24 bp is microRNA and / or small interfering RNA.
3. The DNA tetrahedron TDN of claim 1, wherein the DNA chain carries a fluorescent group when constituting the TDN, the carried fluorescent group is conjugated fluorescence, and the conjugated fluorescence is Cy3-Cy5; the No. 1 chain of the DNA tetrahedron is labeled with Cy3, the No. 2 chain is labeled with Cy5, and the 3' end of the No. 6 chain is labeled with Cy5; the DNA sequences of the No. 1 chain, the No. 2 chain and the No. 6 chain are shown in SEQ ID NO. 1, 2 and 6.
4. A preparation method of the DNA tetrahedron TDN according to any one of claims 1-3, comprising the following steps: S1. Dissolve the nucleotides of the DNA chains shown in SEQ ID NO. 1-6 in a buffer solution and mix well; S2. Perform PCR reaction on the solution in step S1. to obtain the DNA tetrahedron TDN.
5. An extracellular vesicle DNA tetrahedron (EV-TDN) complex, which is composed of one or more single strands of TDN and one or more nucleotides inside the EV, and the TDN can capture the nucleotides inside the EV; the TDN is composed of six edges of DNA chains, and when the single-stranded DNA in the tetrahedron is complementary to the targeting nucleotide, the targeting nucleotide is captured; the preparation method of the DNA tetrahedron TDN comprises the following steps: S1. Dissolve the nucleotides of the DNA chains shown in SEQ ID NO. 1-6 in a buffer solution and mix well; S2. Perform PCR reaction on the solution in step S1. to obtain the DNA tetrahedron TDN.
6. Use of the DNA tetrahedron TDN according to any one of claims 1-3 in the preparation of a probe for detecting a targeting nucleotide.
7. Use of the DNA tetrahedron TDN according to any one of claims 1-3 in the preparation of a targeting nucleotide molecular imaging agent.
8. The use of claim 7, wherein the imaging agent is applied in extracellular vesicle imaging, cell imaging and / or free nucleotide imaging in body fluid; the source of the extracellular vesicle includes umbilical cord mesenchymal stem cells, adipose tissue mesenchymal stem cells and bone marrow mesenchymal stem cells; the extracellular vesicle imaging is in vivo imaging and / or ex vivo imaging; when the fluorescent group is Cy3 and Cy5, the TDN itself is red fluorescence after excitation by excitation light; the extracellular vesicle labeled with the TDN is yellow fluorescence; and the wavelength of the excitation light is selected from 488-525 nm.
Citation Information
Patent Citations
DNA tetrahedron capable of carrying oligonucleotides and nucleic acid analogues as well as preparation method and application of DNA tetrahedron
CN120272471A