MRNA (messenger ribonucleic acid) and mRNA lipid nanoparticle compound for preventing and treating triple negative breast cancer as well as preparation method and application of mRNA lipid nanoparticle compound

Abstract

The embodiment of the invention belongs to the technical field of biological medicines, and particularly relates to mRNA and mRNA lipid nanoparticle compounds for preventing and treating triple negative breast cancer as well as a preparation method and application of the mRNA and mRNA lipid nanoparticle compounds. The mRNA comprises a coding region of alpha-whey protein. The mRNA lipid nanoparticle compound comprises a nanoparticle lipid shell and the mRNA, the mRNA is encapsulated in the lipid shell, and a coding region of the alpha-whey protein has a nucleotide sequence as shown in SEQ ID NO. 6. According to the alpha-whey protein mRNA provided by the invention, mRNA for preventing and treating triple negative breast cancer is delivered to a body through a lipid nanoparticle delivery system, so that alpha-whey protein is transiently expressed, cellular response and humoral immunity of the body are activated, infiltration of CD8 positive T cells is promoted, a specific antibody is formed, and the effect of preventing or killing tumor cells is achieved; no obvious toxic or side effect exists.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to an mRNA and mRNA lipid nanoparticle complex for preventing and treating triple-negative breast cancer, and a preparation method and application thereof. Background Art

[0002] Breast cancer is one of the common malignant tumors in women, and its incidence ranks first among malignant tumors in women. Triple-negative breast cancer (TNBC) accounts for 10-15% of breast cancer. It is a subtype that is highly invasive, easily metastatic, and has a very poor prognosis. TNBC has a higher mortality rate and a shorter median survival than non-triple-negative breast cancer, and it accounts for a higher proportion in young women. Due to its special immune characteristics: the immunohistochemistry results of estrogen receptor (ER), progesterone receptor (PR) and human epidermal growth factor receptor-2 (Her-2) are all negative, TNBC is not suitable for the currently commonly used immune targeted therapy for breast cancer. Surgery combined with chemoradiotherapy is still the main treatment for early and late TNBC patients. However, usually only about 20% of patients have a good chemotherapy effect, and the side effects of chemotherapy are extremely large. Therefore, triple-negative breast cancer is in urgent need of effective treatment strategies.

[0003] mRNA vaccines deliver mRNA to host cells through vectors, and use ribosomes to produce proteins to activate immunity to achieve the purpose of treating diseases. Compared with other tumor prevention and treatment programs, mRNA vaccines have the following advantages: the synthesis process of in vitro target mRNA is simple and safe, easy to achieve mass production, and short production cycle; mRNA is not integrated into the host genome, reducing the risk of gene mutation; and the protein expressed in host cells can activate cellular immunity and humoral immunity at the same time. Therefore, mRNA vaccines are an ideal choice for treating tumors. However, mRNA has poor stability, large molecules, hydrophilicity, and negative charge. Therefore, naked mRNA cannot pass through the lipophilic cell membrane, and a stable carrier is required to transport mRNA to the host cell. At present, common delivery carriers mainly include lipid nanoparticles (LNP), polymer-based nanoparticles, and lipid-polymer hybrids, which can protect mRNA from degradation and have the characteristics of safe and efficient delivery, and are widely used as mRNA carriers. The increasingly mature mRNA delivery platform provides a good research foundation for the development of mRNA vaccines.

[0004] Triple-negative breast cancer has special biological behaviors and clinical pathological characteristics, and is more common in premenopausal women after breastfeeding and obese people. Because α-lactalbumin is a protein that can be specifically expressed in the breast during lactation, it can cause the body's immune system to respond. Therefore, α-lactalbumin can be used as a potential target for breast cancer mRNA vaccines. Compared with other innovative vaccines (such as DNA vaccines, viral vector vaccines, etc.), mRNA vaccines have the advantages of short research and development cycle, strong immunogenicity (high protection efficiency), good safety, and theoretically can encode any protein. Therefore, α-lactalbumin mRNA vaccine can be used as a safe and effective new strategy for the prevention and treatment of triple-negative breast cancer.

[0005] In summary, providing an α-lactalbumin mRNA with high expression efficiency is of great significance for the prevention and treatment of triple-negative breast cancer. Summary of the invention

[0006] The purpose of the present invention is to provide an mRNA, mRNA lipid nanoparticle complex and its preparation method and application for preventing and treating triple-negative breast cancer, so as to overcome and solve the problems in existing product technology.

[0007] In order to achieve the above purpose, the embodiment of the present invention provides the following technical solutions:

[0008] According to a first aspect of an embodiment of the present invention, an mRNA for preventing and treating triple-negative breast cancer is provided, comprising a coding region of α-lactalbumin, wherein the coding region comprises an open reading frame of α-lactalbumin, and at least one of a 5'-cap structure, a 5'-UTR, and a 5'-polynucleotide; the coding region of α-lactalbumin has a nucleotide sequence as shown in SEQ ID NO.6.

[0009] According to a second aspect of an embodiment of the present invention, there is provided an mRNA lipid nanoparticle complex, comprising a nanoparticle lipid shell and the mRNA, wherein the mRNA is encapsulated in the nanoparticle lipid shell.

[0010] Furthermore, the mRNA lipid nanoparticle complex comprises the mRNA, ionizable amino lipids, auxiliary lipids, structural lipids and polymer-conjugated lipids;

[0011] Calculated by mass percentage, the mass percentage of the ionizable amino lipid is 15-60%, the mass percentage of the auxiliary lipid is 5-20%, the mass percentage of the structural lipid is 5-50%, and the mass percentage of the polymer conjugated lipid is 0.5-5%.

[0012] Furthermore, the mass ratio of the ionizable amino lipid to the mRNA is 1:1-50:1.

[0013] Furthermore, the structured lipid includes any one or a combination of two or more of cholesterol and cholesterol derivatives.

[0014] Furthermore, the auxiliary lipid includes any one of DOPC, DSPC, DOPE, DOPD, and DOPS, or a combination of two or more thereof.

[0015] Furthermore, the polymer conjugated lipid includes any one or a combination of two or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified dialkylamine, and PEG-modified dialkylglyceride.

[0016] According to a third aspect of an embodiment of the present invention, a method for preparing an mRNA lipid nanoparticle complex is provided, comprising the following steps:

[0017] S1, dissolving the ionizable amino lipid, structural lipid, auxiliary lipid, and polymer conjugated lipid in an organic solvent in proportion to obtain an organic phase;

[0018] S2, dissolving the mRNA in a buffer to obtain an aqueous phase;

[0019] S3. Fully mix the organic phase and the aqueous phase to obtain a mixed solution, replace the solvent in the mixed solution, and obtain the mRNA lipid nanoparticle complex.

[0020] Furthermore, the total concentration of ionizable amino lipids, structural lipids, auxiliary lipids, and polymer conjugated lipids in the organic phase is 1-30 mg / mL.

[0021] Furthermore, the mRNA concentration in the aqueous phase is 0.5-1.5 mg / mL.

[0022] Furthermore, the volume ratio of the organic phase to the aqueous phase is 1:2-6.

[0023] Furthermore, the working concentration of the mRNA lipid nanoparticle complex is 0.05-2 mg / mL.

[0024] According to a fourth aspect of an embodiment of the present invention, there is provided an mRNA vaccine for preventing and treating triple-negative breast cancer, comprising the above-mentioned mRNA or any one of the above-mentioned mRNA lipid nanoparticle complexes.

[0025] According to the fifth aspect of an embodiment of the present invention, there is provided an application of the above-mentioned mRNA for preventing and treating triple-negative breast cancer, the above-mentioned mRNA lipid nanoparticle complex, the above-mentioned method or the above-mentioned mRNA vaccine in the preparation of drugs for preventing and treating breast cancer, wherein the drugs for preventing and treating breast cancer include vaccines for preventing breast cancer and drugs for treating breast cancer.

[0026] Compared with the existing product technology, the advantages of the present invention are:

[0027] The embodiment of the present invention provides an mRNA for preventing and treating triple-negative breast cancer, an mRNA lipid nanoparticle complex, and a preparation method and application thereof, wherein the mRNA lipid nanoparticle complex comprises mRNA and lipid nanoparticles for preventing and treating triple-negative breast cancer. The mRNA lipid nanoparticle complex designed by the present invention can deliver the mRNA for preventing and treating triple-negative breast cancer to the body through a lipid nanoparticle delivery system, thereby transiently expressing α-lactalbumin, activating the body's cellular response and humoral immunity, promoting CD8-positive T cell infiltration and the formation of specific antibodies, and preventing or killing tumor cells without obvious toxic and side effects. In addition, the α-lactalbumin mRNA expression efficiency designed by the present invention is high, and the mRNA lipid nanoparticle complex of the present invention has high delivery efficiency, can effectively prevent the occurrence of breast cancer, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Various other advantages and benefits will become apparent to those of ordinary skill in the art by reading the detailed description of the preferred embodiments below. The accompanying drawings are only for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. Moreover, the same reference symbols are used throughout the accompanying drawings to represent the same components. In the accompanying drawings:

[0029] Figure 1 The comparison result of the coding region of α-lactalbumin of the present invention and the original sequence;

[0030] Figure 2 is the electrophoresis diagram of mRNA;

[0031] Figure 3 is the capillary electrophoresis detection result of mRNA;

[0032] Figure 4 The particle size, PDI and potential data of mRNA-LNPs;

[0033] Figure 5 It is a bar graph of particle size, encapsulation efficiency and PDI data of mRNA-LNPs;

[0034] Figure 6 This is the protein expression after mRNA-LNPs transfection into 293T cells;

[0035] Figure 7 The results of combined mRNA-LNPs vaccine and tumor resection treatment;

[0036] Figure 8 Results of mRNA-LNPs vaccine for preventing breast cancer;

[0037] Fig. 9To produce specific antibodies after immunization with mRNA-LNPs vaccine;

[0038] Fig.10 To promote T cell activation after mRNA-LNPs vaccine immunization;

[0039] Fig.11 mRNA-LNPs vaccines increase CD8+T cell infiltration and IFN-γ secretion in the tumor microenvironment;

[0040] Fig.12 mRNA-LNPs vaccine reduces lung metastasis of breast cancer;

[0041] Fig.13 HE staining results of kidney, spleen, lung, liver and heart tissues;

[0042] Fig.14 These are the safety evaluation results of mRNA-LNPs vaccine. DETAILED DESCRIPTION

[0043] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0044] The embodiment of the present invention provides an mRNA for preventing and treating triple-negative breast cancer, comprising a coding region of α-lactalbumin, wherein the coding region comprises an open reading frame of α-lactalbumin, and at least one of a 5'-cap structure, a 5'-UTR, and a 5'-polynucleotide; the coding region of α-lactalbumin has a nucleotide sequence as shown in SEQ ID NO.6.

[0045] The embodiment of the present invention further provides an mRNA lipid nanoparticle complex, comprising a nanoparticle lipid shell and the mRNA, wherein the mRNA is encapsulated in the nanoparticle lipid shell.

[0046] In some embodiments, the mRNA lipid nanoparticle complex comprises the mRNA, ionizable amino lipids, auxiliary lipids, structural lipids and polymer-conjugated lipids;

[0047] Calculated by mass percentage, the mass percentage of the ionizable amino lipid is 15-60%, the mass percentage of the auxiliary lipid is 5-20%, the mass percentage of the structural lipid is 5-50%, the mass percentage of the polymer conjugated lipid is 0.5-5%, and the remainder is mRNA. Other ingredients can also be added as needed, all of which are within the scope of protection of this application.

[0048] In some embodiments, the mass ratio of the ionizable amino lipid to the mRNA is 1:1-50:1. The structural lipid includes any one or a combination of two or more of cholesterol and cholesterol derivatives. The auxiliary lipid includes any one or a combination of two or more of DOPC, DSPC, DOPE, DOPD, and DOPS. The polymer conjugated lipid includes any one or a combination of two or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified dialkylamine, and PEG-modified dialkylglyceride.

[0049] The present invention also provides a method for preparing an mRNA lipid nanoparticle complex, comprising the following steps:

[0050] S1, dissolving the ionizable amino lipid, structural lipid, auxiliary lipid, and polymer conjugated lipid in an organic solvent in proportion to obtain an organic phase; the organic solvent includes ethanol, but is not limited thereto;

[0051] S2, dissolving the mRNA in a buffer to obtain an aqueous phase; the buffer comprises a citrate buffer or a sodium acetate buffer;

[0052] S3. Fully mix the organic phase and the aqueous phase to obtain a mixed solution, replace the solvent in the mixed solution, and obtain the mRNA lipid nanoparticle complex.

[0053] In some embodiments, the total concentration of ionizable amino lipids, structural lipids, auxiliary lipids, and polymer-conjugated lipids in the organic phase is 1-30 mg / mL, preferably 10-20 mg / mL, and more preferably 12-15 mg / mL.

[0054] In some embodiments, the mRNA concentration in the aqueous phase is 0.5-1.5 mg / mL.

[0055] In some embodiments, the volume ratio of the organic phase to the aqueous phase is 1:2-6. Preferably, the volume ratio of the organic phase to the aqueous phase is 1:3.

[0056] In some embodiments, the working concentration of the mRNA lipid nanoparticle complex is 0.05-2 mg / mL.

[0057] In specific use, the administration methods of the mRNA lipid nanoparticle complex include intravenous injection, subcutaneous injection, intradermal injection, and intramuscular injection, and the preferred methods are intravenous injection and intramuscular injection.

[0058] An embodiment of the present invention provides an application of the above-mentioned mRNA for preventing and treating triple-negative breast cancer, the above-mentioned mRNA lipid nanoparticle complex or the above-mentioned method in the preparation of drugs for preventing and treating breast cancer. The drugs for preventing and treating breast cancer include vaccines for preventing breast cancer and drugs for treating breast cancer.

[0059] An embodiment of the present invention provides an mRNA vaccine for preventing and treating triple-negative breast cancer, comprising the above-mentioned mRNA or any one of the above-mentioned mRNA lipid nanoparticle complexes.

[0060] An embodiment of the present invention also provides an application of the above-mentioned mRNA for preventing and treating triple-negative breast cancer, the above-mentioned mRNA lipid nanoparticle complex, the above-mentioned method or the above-mentioned mRNA vaccine in the preparation of drugs for preventing and treating breast cancer, wherein the drugs for preventing and treating breast cancer include vaccines for preventing breast cancer and drugs for treating breast cancer.

[0061] In order to better understand the technical solution of the present invention, it is discussed in detail below in conjunction with specific embodiments.

[0062] Example 1. Preparation of mRNA

[0063] (1) Construction of mRNA template plasmid:

[0064] The sequence containing the promoter, 5' / 3'-UTR (from Moderna's new crown vaccine) and polyA structure was ligated between HindIII and EcoRI of the pUC57 vector plasmid. This step was commissioned to General Biotechnology (Anhui) Co., Ltd. to obtain a universal framework vector plasmid that can efficiently translate and express mRNA, named pIVT.

[0065] T7 promoter (SEQ ID NO.1):

[0066] TAATACGACTCACTATA;

[0067] 5'UTR (SEQ ID NO.2):

[0068] GGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACC CCGGCGCCGCCACC;

[0069] 3'UTR (SEQ ID NO.3):

[0070] TGATGAGCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCC TCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGTCTTT GAATAAAGTCTGAGTGGGCGGC;

[0071] plyA(120) (SEQ ID NO.4):

[0072] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGAATTC (EcoR1 restriction site).

[0073] (2) Based on the pIVT empty vector constructed in step (1), the candidate antigen and gene sequence are optimized and synthesized, that is, the optimized α-lactalbumin gene CDS sequence is cloned into the pIVT universal framework vector plasmid constructed in step (1) by seamless cloning technology (for specific operation methods, see the Bio-Tech Seamless Cloning Kit). This step is entrusted to General Biotech (Anhui) Co., Ltd. The optimized sequence is as follows:

[0074] α-lactalbumin gene CDS original sequence (SEQ ID NO.5):

[0075] tatttcatac cagtggctac gacacacaag ctgttgtcaa cgacaacggcagcacagagtacggactctt ccagatcagt gacagatttt ggtgtaaaag tagtgagttc cccgagtcggagaacatctgtggcatctcc tgtgacaagt tattggatga cgagttggat gatgacatag cgtgtgccaagaagatcctggctatcaaag gaatcgacta ctggaaagcc tacaagccca tgtgctctga gaagcttgaacagtggcgttgtgagaagcc ctga

[0076] The α-lactalbumin gene CDS sequence of the present invention (SEQ ID NO.6):

[0077] ATGCACTTCGTGCCTCTGTTCCTGGTGTGCATCCTGTCCCTGCCCGCCTTCCAGGCCACCGAGCTGACCAAGTGCAAGGTGAGCCACGCCATCAAGGACATCGACGGCTACCAGGGCATCTCCCTGCTGGAATGGGCCTGCGTGCTGTTTCATACATCCGGCTACGACACCCAGGCCGTGGTGAATGACAATGGCAGCACAGAGTACGGCCTGT TCCAGATCAGCGACAGATTCTGGTGCAAGAGCAGCGAGTTCCCCGAGAGCGAGAACATCTGCGGAATTTCCTGTGACAAACTGCTGGACGACGAACTGGATGACGACATTGCCTGTGCTAAAAAGATTCTGGCCATCAAGGGCATCGACTACTGGAAGGCCTACAAGCCCATGTGCAGCGAGAAGCTGGAGCAGTGGAGATGCGAGAAGCCCTGA

[0078] Figure 1 The comparison result of the coding region of α-lactalbumin of the present invention and the original sequence; the present invention optimizes the original sequence of CDS of α-lactalbumin gene, firstly improves the GC content, and after optimization, the GC content of its CDS region is increased from 46.9 to 57.1%; and the possible I and II class transcription termination sequences are also modified to reduce potential interruption RNA transcription byproducts; and the sequence with the number of consecutive bases "A" ≥6 is codon modified to reduce the erroneous sliding of ribosomes during protein translation. In addition, the present invention modifies the structure of RNA-quadruplex (RG4) ≥2.0 in the original RNA sequence.

[0079] (3) Using the plasmid in (2) as a template, the plasmid extraction kit (DP117, see the instructions for steps) of Tiangen Biotechnology was used for digestion with EcoRI restriction endonuclease (Nearbank protein), and finally the linearized plasmid was separated and purified using DNA purification magnetic beads (Novozyme, RNaseFree), and finally dissolved in enzyme-free water for later use.

[0080] (4) In vitro transcription: 1 mL in vitro transcription system:

[0081]

[0082] After mixing, place at 37°C for 1 hour, add 75uL of DNase I and eliminate DNA at 37°C for half an hour. Take out and mix once during the process, and finally add 1.8 times the volume of RNA purification magnetic beads (Novozyme) to purify the synthesized RNA.

[0083] (5) RNA capping reaction: 10 mL capping reaction system:

[0084]

[0085] After flicking to mix, place at 37°C for 30 minutes, remove and mix once, and finally add 0.5 times the volume of RNA purification magnetic beads (Novozyme) to purify the capped RNA.

[0086] (6) Oligo(dT)25 affinity filler (Thermo) was used to purify RNA products that were interrupted by transcription and degraded. The specific purification steps are as follows:

[0087] 1) Equilibrate the column with 5 column volumes of buffer (10 mm Tris-HCl, 0.5 M NaCl, 1 mm EDTA, pH 7.4).

[0088] 2) The RNA sample purified by RNA affinity magnetic beads (NoviZan) was dissolved in a buffer (10 mM Tris-HCl, 0.5 M NaCl, 1 mM EDTA, pH 7.4).

[0089] 3) Load the sample onto the chromatographic column at a speed of 50-150 cm / h, and control the column temperature at 65°C.

[0090] 4) Wash the column with an additional 5 column volumes of buffer (10 mM Tris-HCl, 0.5 M NaCl, 1 mm EDTA, pH 7.4), and then elute impurities that are unstable with the filler with different salt ion buffers (containing 10 mM Tris-HCl, 100-300 mm NaCl, 1 mm EDTA, pH 7.4) until the conductivity stabilizes.

[0091] 5) The eluate of step (4) is eluted with enzyme-free sterile water. The main peak at UV 260nm is the mRNA with a polyA structural sequence. The collected mRNA sample is purified using RNA affinity magnetic beads, or it can be equivalently amplified and concentrated and purified using tangential flow or the like.

[0092] (7) mRNA quality detection: First, the synthesized PSMA, PSA, PAP, and ERG mRNAs were subjected to preliminary quality detection by agarose gel electrophoresis. The specific process was as follows: 0.5 μg of each mRNA was added to 2× RNA loading buffer and mixed evenly. After heating and denaturing at 85°C for 2 minutes, the mRNA was immediately placed on ice for 2 minutes. The mRNA was then electrophoresed at 100 V for 30 minutes in a 1.5% agarose gel. RNA marker (Thermo, SM1821) was used to indicate the size of the sample RNA. The results are shown in Table 1. Figure 2 ; This indicates that the quality of the in vitro transcribed mRNA is good. At the same time, a capillary electrophoresis instrument (Agilent 5200) was used to test the integrity of the prepared mRNA (taking PSMA as an example). The results are shown in Figure 3 , indicating that the synthesized mRNA has good integrity.

[0093] Example 2. Preparation and characterization of mRNA-LNPs lipid nanoparticles

[0094] (1) A protonable cationic lipid (E7C71A9, see patent publication number CN114105799A) is dissolved in anhydrous ethanol at a molar mass ratio of 47.5:41:10:1.5, respectively, and after the four components are uniformly mixed, anhydrous ethanol is added to make the cationic lipid concentration in the range of 0.01M-0.5M. Taking the preparation of 10 mg cationic lipid, 4 mg cholesterol, 4 mg auxiliary lipid, and 2.5 mg polymer conjugated lipid as an example, the amounts of anhydrous ethanol added to the four components are 200uL, 200uL, 400uL, and 100uL, respectively; then 84.25uL of cationic lipid, 126.70uL cholesterol, 126.49uL auxiliary lipid, and 24.1uL polymer conjugated lipid are added to 318.46uL of anhydrous ethanol to prepare an ethanol phase solution with a volume of 680uL. Then, a microfluidic preparation system (Mianna, INano E) was used to mix the obtained ethanol phase solution and acetic acid-sodium acetate acidic solution (pH = 5.0, 25mM) or citric acid-sodium citrate acidic solution (pH = 5.0, 25mM) dissolved with mRNA in a volume ratio of 1:3 in a microfluidic chip at a flow rate of 12mL / h to obtain a crude solution of lipid nanoparticles. The obtained solution was then diluted 10 times with PBS solution and ultrafiltered at 1500rcf for 15 minutes at 4°C using a 15mL or 50mL ultrafiltration centrifuge tube (Millipore, 100K). The ultrafiltration was performed three times in total, and finally the molar ratio of ionizable lipids to vaccine mRNA was approximately 6:1 to obtain mRNA-LNPs lipid nanoparticles.

[0095] (2) Characterization of particle size, PDI and encapsulation efficiency: The particle size and PDI of the prepared mRNA-LNPs lipid nanoparticles were measured by Nano-ZSZEN3600 (Malvern). 20uL of mRNA-LNPs solution (RNA concentration was 100μg / mL) was taken for particle size or potential measurement, the stabilization time was 120s, and the cycle was repeated three times, with 10 cycles each time. The results are shown in Figure 4 , 5 As shown, the particle size of the prepared mRNA-LNPs lipid nanoparticles is about 80nm and the PDI is less than 0.2. The mRNA concentration before and after x-100 demulsification was measured according to the standard procedure of the Quant-iT RiboGreen RNA kit, and the encapsulation efficiency of the LNP was calculated. The mRNA concentration was calculated according to the standard curve. The results showed that the encapsulation efficiency of mRNA-LNPs was greater than 90%, ( Figure 5 ), the nucleic acid concentration is about 0.15 mg / mL.

[0096] (3) Quality detection after RNA encapsulation: The concentration of mRNA-LNPs was measured according to the encapsulation rate, and the final concentration of mRNA-LNPs was adjusted to 100 ng / ml. 10 uL of mRNA-LNPs was taken for capillary electrophoresis to detect the purity and secondary structure of RNA. The capillary results showed that the RNA purity was 83.7%. The RNA peak was obvious and concentrated, with a peak value of 897 nt, which was consistent with the size of whey protein RNA. The results are shown in Figure 3 .

[0097] (4) Detection of α-lactalbumin mRNA expression in cells by ELISA and Western Blot: 293T cells purchased from Wuhan Pronocell Co., Ltd. were cultured in T25 culture flasks in 1640 medium containing 10% FBS at 37°C and 5% CO2. After the cell density reached 80%, the cells were digested with trypsin for 3 min, and digestion was terminated by 1640 complete medium containing 10% FBS. The cells were centrifuged at 1000 rpm for 5 min, the supernatant was discarded, the cells were resuspended in complete medium, and the cells were counted. 2×10 5 / well was inoculated in a 12-well plate, and the cells were transfected at a ratio of 1ug mRNA per well. After 24 hours, the cell supernatant was collected and concentrated by centrifugation using a 3kd ultrafiltration tube. 50uL of the supernatant concentrate was added with 10uL 5×SDS loading and denatured at 100℃ for 10 minutes, and then a Western-blot experiment was performed to detect the expression of whey protein. At the same time, the supernatant was tested by ELISA. 50uL of the supernatant concentrate was added with 50uL coating solution, added to a 96-well plate, incubated at 4℃ overnight, blocked with 5% BSA at 37℃ for 1h, incubated with α-lactalbumin antibody (1:800) for 4h, washed three times with PBST, incubated with a secondary antibody (1:2000) for 1h, and the OD450 value was detected after adding the colorimetric solution. The results of ELISA and Western Blot both showed that α-lactalbumin mRNA can be expressed in 293T cells. The results are shown in Figure 6 ELISA and Western Blot experiments verified that the translation and expression efficiency of the whey protein mRNA shown in SEQ ID NO.6 of the present invention was significantly improved.

[0098] Example 3: Animal experiment on the effect of mRNA vaccine

[0099] 1. Immunization of female Balb / c mice with mRNA-LNPs to evaluate the efficacy of vaccine in treating tumors

[0100] 4-5 week old male Balb / c mice were purchased from Jiangsu Jicui Yaokang Biotechnology Co., Ltd. The day of tumor inoculation was recorded as day 0, and the tumor was located subcutaneously on the right back of the mouse. Immunization was performed on days 7, 12, and 17, respectively, with a dosage of 5ug / mice. The PBS group was used as a control, and the immunization injection site was the right hind limb of the mouse. The injection method was intramuscular injection, and the injection volume was 100uL. Subsequently, the tumor growth was observed, and the tumor volume was measured, and the calculation method was: volume V = 1 / 2 × length × width × width. The results indicate that the vaccines of the present invention can effectively inhibit tumor growth. The specific steps are as follows:

[0101] (1) Mouse breast cancer cell line 4T1 cells (purchased from Wuhan Pronocell Co., Ltd.) were cultured in T25 culture flasks. When the cell density reached about 80%, the cells were digested with trypsin for 2 min, and the digestion was terminated by 1640 complete medium containing 10% FBS. The cells were centrifuged at 1000 rpm for 5 min, the supernatant was discarded, the cells were resuspended in complete medium and counted. The number of tumor cells was 2×10 5 / mouse, subcutaneous tumor size about 50mm on the 7th day 3 ,Then the mice were randomly divided into 2 groups, PBS group and α-lactalbumin mRNA-LNPs group (hereinafter referred to as α-LNP), with 10 mice in each group.

[0102] (2) Immunize mice on days 7, 12, and 17, and observe and measure tumor volume every other day

[0103] The results suggest that the α-LNP vaccine combined with surgical resection treatment can slow down the tumor growth rate and greatly prolong the survival time of mice ( Figure 8 ). Immunofluorescence experiments found that there were more CD8 positive T cells and macrophages infiltrating in the tumor tissue of the α-LNP group, indicating that the α-LNP vaccine prepared by the present invention can effectively improve the tumor microenvironment and increase the infiltration of cytotoxic T cells and macrophages. In addition, the vaccine prepared by the present invention can also promote the secretion of IFN-γ in the tumor microenvironment ( Fig.11 ).

[0104] 2. Female Balb / c mice were immunized with α-LNP vaccine to evaluate the effectiveness of the vaccine in preventing tumor occurrence.

[0105] The first vaccination of mice was recorded as day 1, and the vaccine was administered three times on day 1, day 7, and day 14, with a dosage of 0.15 g / kg; the injection site was the right hind limb of the mouse, the injection method was intramuscular injection, and the injection volume was 100 uL. On day 21, the tumor (mouse breast cancer cell line 4T1 cells) was implanted in the subcutaneous right posterior part of the mouse's back, and the whey protein antibody titer in the serum was detected at the same time. The results showed that the maximum dilution multiple of the antibody in the serum of the immunized mice ranged from 1000 to 10000 ( Fig. 9 ); then observe the tumor growth and measure the tumor volume, which is calculated as follows: volume V = 1 / 2 length × width × width. The results suggest that α-LNP vaccine can effectively slow down tumor growth and prolong the survival time of mice ( Figure 8 ).

[0106] At the end of the experiment, the mouse lung tissue was removed and fixed with 4% paraformaldehyde for 48 hours, then paraffin-embedded, sectioned, and HE (hematoxylin-eosin) stained. The results showed that compared with the control group, there was no tumor metastasis in the mice in the α-LNP immunization group ( Fig.12 ), indicating that α-LNP can effectively reduce lung metastasis of breast cancer.

[0107] 3. In vitro killing experiments were used to evaluate the ability of α-LNP to activate effector T cells.

[0108] (1) Obtaining spleen T cells from immunized mice: 4-5 week old male Balb / c mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. and immunized on days 7, 12, and 17, respectively, with a dosage of 5ug / mice; and the PBS group was used as a control. The immunization injection site was the right hind limb of the mouse, and the injection method was intramuscular injection with an injection volume of 100uL. Obtaining mouse spleen T cells is roughly as follows: 1) Add an appropriate amount of PBS buffer containing 5% FBS to the culture dish, peel off the spleen, tear it up with tweezers and scrape out the spleen cells, filter it with 50μm, and prepare a spleen single cell suspension. 2) Centrifuge at 500g for 10 minutes, discard the supernatant, resuspend with 1mL ACK red blood cell lysis buffer, and place at 37℃ for 1 minute. Add 3mL PBS buffer containing 5% FBS to stop red blood cell lysis, centrifuge at 500g for 10 minutes, and discard the supernatant. 3) After the last centrifugation, discard the supernatant, add PBS buffer, resuspend the cells, take a drop of cell suspension and mix it with a drop of 0.2% trypan blue dye, and calculate the cell concentration on a hemocytometer.

[0109] (2) Preparation of immune-activated mouse dendritic cells: Evaluation of the activation effect of α-LNP vaccine on the body's immune system.

[0110] Balb / c-derived IL-4 and GM-CSF (Peprotech) were used to induce bone marrow-derived monocytes to differentiate into dendritic cells at a working concentration of 800 U / mL. After 7 days, suspended and semi-adherent cells were collected for subsequent experiments. Dendritic cells were then transfected with α-LNP for 24 hours and co-cultured with T cells for 24 hours. The ratio of T cells to dendritic cells was 4:1. The cells were cultured in 96-well plates (with PDVF membrane at the bottom) with RPMI-1640 culture medium. After the co-culture, the expression of IFN-γ by T cells was detected using the Elispot kit of Dayou. Fig.10 The above results indicate that α-LNP effectively activates dendritic cells and induces effective activation of T cell immunity and expression of IFN-γ.

[0111] 4. Safety evaluation of mRNA-LNPs on the body.

[0112] After two injections of the vaccine, non-tumor-bearing mice (4-5 week-old female Balb / c mice) were injected with the vaccine. On the second day, the mouse serum was collected to test liver function, kidney function and other indicators. At the same time, kidney, spleen, lung, liver and heart tissues were taken for HE staining to observe the physiological morphology of the tissues. The control group was injected with PBS. The results showed that the vaccine did not affect the normal physiological morphology of kidney, spleen, lung, liver and heart tissues ( Fig.13 ), and had no significant effect on liver and kidney function indicators ( Fig.14 ).

[0113] In summary, the α-lactalbumin mRNA-LNP vaccine designed by the present invention can effectively activate the body's immune system, produce specific α-lactalbumin antibodies, promote CD8-positive T cells and macrophages to enter the tumor, and improve the secretion capacity of IFN-γ in the tumor microenvironment, which can prevent or kill tumors without obvious toxic side effects, and has good application prospects.

[0114] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. An mRNA for preventing and treating triple-negative breast cancer, characterized in that: The invention comprises a coding region of alpha-lactalbumin, wherein the coding region comprises an open reading frame of alpha-lactalbumin and at least one of a 5'-cap structure, a 5'-UTR and a 5'-polynucleotide, and the coding region of alpha-lactalbumin has a nucleotide sequence as shown in SEQ ID NO.

6.

2. An mRNA lipid nanoparticle complex, characterized in that: The invention comprises a nanoparticle lipid shell and the mRNA according to claim 1, wherein the mRNA is encapsulated in the nanoparticle lipid shell.

3. The mRNA lipid nanoparticle complex according to claim 2, characterized in that: Comprising the mRNA of claim 1, ionizable amino lipids, auxiliary lipids, structural lipids and polymer conjugated lipids; Calculated by mass percentage, the mass percentage of the ionizable amino lipid is 15-60%, the mass percentage of the auxiliary lipid is 5-20%, the mass percentage of the structural lipid is 5-50%, and the mass percentage of the polymer conjugated lipid is 0.5-5%; the mass ratio of the ionizable amino lipid to the mRNA is 1:1-50:

1.

4. The mRNA lipid nanoparticle complex according to claim 3, characterized in that: The structural lipids include any one or a combination of two or more of cholesterol and cholesterol derivatives; The auxiliary lipid includes any one or a combination of two or more of DOPC, DSPC, DOPE, DOPD, and DOPS; The polymer conjugated lipid includes any one or a combination of two or more of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified dialkylamine, and PEG-modified dialkylglyceride.

5. A method for preparing the mRNA lipid nanoparticle complex according to any one of claims 2 to 4, characterized in that: The following steps are involved: S1, dissolving the ionizable amino lipid, structural lipid, auxiliary lipid, and polymer conjugated lipid in an organic solvent in proportion to obtain an organic phase; S2. dissolving the mRNA according to claim 1 in a buffer to obtain an aqueous phase; S3. Fully mix the organic phase and the aqueous phase to obtain a mixed solution, replace the solvent in the mixed solution, and obtain the mRNA lipid nanoparticle complex.

6. The method for preparing the mRNA lipid nanoparticle complex according to claim 5, characterized in that: The total concentration of ionizable amino lipids, structural lipids, auxiliary lipids and polymer conjugated lipids in the organic phase is 1-30 mg / mL; the mRNA concentration in the aqueous phase is 0.5-1.5 mg / mL.

7. The method for preparing the mRNA lipid nanoparticle complex according to claim 6, characterized in that: The volume ratio of the organic phase to the aqueous phase is 1:2-6.

8. The method for preparing the mRNA lipid nanoparticle complex according to claim 5, characterized in that: The working concentration of the mRNA lipid nanoparticle complex is 0.05-2 mg / mL.

9. An mRNA vaccine for preventing and treating triple-negative breast cancer, characterized in that: It comprises the mRNA of claim 1 or the mRNA lipid nanoparticle complex of any one of claims 2-4.

10. Use of the mRNA for preventing and treating triple-negative breast cancer as claimed in claim 1, the mRNA lipid nanoparticle complex as claimed in any one of claims 2-4, the method as claimed in any one of claims 5-8 or the mRNA vaccine as claimed in claim 9 in the preparation of drugs for preventing and treating breast cancer, wherein the drugs for preventing and treating breast cancer include vaccines for preventing breast cancer and drugs for treating breast cancer.

Images