Construction method and application of MN1-BEND2 fusion gene knock-in mouse animal model

Abstract

The invention relates to a construction method of an MN1-BEND2 fusion gene knock-in mouse animal model and application of the MN1-BEND2 fusion gene knock-in mouse animal model as an astroblastoma animal model. According to the method disclosed by the invention, the MN1-BEND2 fusion gene knock-in mouse animal model can be obtained at a relatively high success rate, the expression of the MN1-BEND2 fusion gene in the obtained mouse animal model is cell-specific, and the MN1-BEND2 fusion gene positive cells have the proliferation state and characteristic molecular phenotype of the astroblastoma, so that the MN1-BEND2 fusion gene knock-in mouse animal model has the advantages that the MN1-BEND2 fusion gene knock-in mouse animal model has a good application prospect. The expression of the gene in a specific area can well simulate the astroblastoma, so that an important research tool is provided for mechanism research and drug development of the astroblastoma.

Description

Technical Field

[0001] The present invention relates to the technical field of animal models, and in particular to a method for constructing an MN1-BEND2 fusion gene knock-in mouse animal model and an application of the model as an astroblastoma animal model. Background Art

[0002] Astroblastoma is a central nervous system tumor that is common in children and adolescents. Due to the unknown pathogenesis, there is a lack of specific treatment. Currently, there are no animal models or cell models related to astroblastoma, which limits the exploration of the pathogenesis of astroblastoma and the development of related targeted drugs.

[0003] MN1:BEND2 fusion gene is the most common fusion gene mutation in astroblastoma patients and is highly expressed in patients with recurrent astroblastoma. Fusion gene mutation plays an important role in tumorigenesis, so MN1:BEND2 fusion gene mutation may be involved in the tumor progression of astroblastoma.

[0004] The Cre:Loxp-stop-Loxp transgenic mouse system can satisfy the expression of target genes in specific cell types, thereby satisfying the exploration of cell-specific functions of target genes. Summary of the invention

[0005] Purpose of the Invention

[0006] In view of the problems or needs existing in the prior art, the object of the present invention is to provide a method for constructing an MN1-BEND2 fusion gene knock-in mouse animal model and its application as an astroblastoma animal model.

[0007] Solution

[0008] In order to achieve the above object, the present invention provides the following technical solutions:

[0009] In the first aspect, the present invention provides a specific target site guide RNA (abbreviated as "gRNA") for constructing a transgenic mouse with MN1-BEND2 fusion gene knock-in, wherein the nucleotide sequence of the specific target site guide RNA is as follows:

[0010] 5'-GAACACTAGTGCACTTATCC-3' (i.e., SEQ ID NO: 1).

[0011] In a feasible embodiment, the sequence of the MN1-BEND2 fusion gene to be knocked in is shown in SEQ ID NO: 2. The MN1:BEND2 fusion gene expresses a fusion protein, which is a protein formed by the fusion of exon 1 of MN1 and exons 7-14 of BEND2.

[0012] In a feasible embodiment, the knock-in site of the MN1-BEND2 fusion gene is the H11 site of mouse chromosome 11.

[0013] In a second aspect, the present invention provides a CRISPR-Cas9 gene editing system for constructing a transgenic mouse animal model with MN1-BEND2 fusion gene knock-in, characterized in that the CRISPR-Cas9 gene editing system comprises:

[0014] The specific target site guide RNA, Cas9 mRNA, and a homologous recombination vector containing the MN1-BEND2 fusion gene to be knocked in as described in the first aspect.

[0015] In a feasible embodiment, the sequence of the MN1-BEND2 fusion gene to be knocked in is shown as SEQ ID NO:2.

[0016] In a feasible embodiment, the sequence of the Cas9 mRNA is as shown in SEQ ID NO:3.

[0017] In a feasible embodiment, in the homologous recombination vector, a LoxP-stop-LoxP element is provided between the promoter and the MN1-BEND2 fusion gene to achieve Cre-dependent expression of the MN1-BEND2 fusion gene; the LoxP-stop-LoxP element is a transcriptional silencing element, and in the absence of the Cre enzyme, its downstream gene will not be able to be expressed normally; after the Cre enzyme is introduced, the stop sequence of the transcriptional silencing element is deleted, and the downstream gene can be expressed normally, thereby achieving Cre-dependent expression of the gene.

[0018] In a feasible embodiment, the homologous recombination vector comprises a 5' homology arm and a 3' homology arm; preferably, the 5' homology arm has a sequence as shown in SEQ ID NO:4, and the 3' homology arm has a sequence as shown in SEQ ID NO:5.

[0019] In a third aspect, the present invention provides the use of the specific target site guide RNA as described in the first aspect above or the CRISPR-Cas9 gene editing system as described in the second aspect above in preparing an MN1-BEND2 fusion gene knock-in mouse animal model.

[0020] In a fourth aspect, the present invention provides a method for constructing an MN1-BEND2 fusion gene knock-in mouse animal model, the method using the specific target site guide RNA as described in the first aspect above or the CRISPR-Cas9 gene editing system as described in the second aspect above.

[0021] In a feasible specific embodiment, the method comprises:

[0022] (1) transcribe the specific target site guide RNA and Cas9 into mRNA in vitro to obtain active gRNA and Cas9 mRNA;

[0023] (2) constructing homologous recombination vector;

[0024] (3) microinjecting active gRNA, Cas9 mRNA and homologous recombination vector into the fertilized eggs of donor mice, then transplanting the fertilized eggs into recipient mice for gestation to obtain offspring mice, and screening to obtain F0 generation mice through genotyping; and

[0025] (4) The F0 generation mice were mated with wild-type mice of the opposite sex to obtain offspring mice, and the F1 generation MN1-BEND2 fusion gene knock-in heterozygous mice were screened through genotyping.

[0026] Optionally, the method further comprises:

[0027] (5) The F1 generation MN1-BEND2 fusion gene knock-in heterozygous mice obtained in step (4) are mated with mice of the opposite sex that specifically express Cre to obtain offspring mice, and the offspring are screened for mice that express both the MN1-BEND2 fusion gene and Cre through genotyping.

[0028] In a feasible embodiment, the strain of the mice is C57BL / 6J.

[0029] In a feasible embodiment, the PCR primer set for identifying the genotype of the MN1-BEND2 fusion gene of F0 and F1 generation mice includes primers as shown in SEQ ID NOs: 6, 7, 8 and 9.

[0030] In a feasible embodiment, the mouse that specifically expresses Cre is a Cre mouse that induces the expression of the fusion gene in neural stem cells in the central nervous system (for example, Nestin used in the examples). CreER mice), or Cre mice that induce the expression of the fusion gene in ventral neural stem cells (e.g., Olig2 Cre mice).

[0031] Preferably, when the mouse specifically expressing Cre is NestinCreER When the mouse specifically expressing Cre is Olig2 Cre When mice are expressed, the PCR primer set for identifying mice expressing both the MN1-BEND2 fusion gene and Cre includes primers as shown in SEQ ID NOs: 14, 15 and 16.

[0032] In a fifth aspect, the present invention provides an MN1-BEND2 fusion gene knock-in mouse animal model constructed according to the method described in the fourth aspect as an astroblastoma animal model for use in studying the occurrence and development mechanism of astroblastoma or screening therapeutic drugs for astroblastoma.

[0033] Beneficial Effects

[0034] The present invention designs a specific target site guide RNA (sgRNA) for knocking in the MN1-BEND2 fusion gene into a specific site of the mouse genome by using the CRISPR-Cas9 technology, a CRISPR-Cas9 gene editing system based on the sgRNA, and provides a method for constructing an MN1-BEND2 fusion gene knock-in mouse animal model using the sgRNA or the CRISPR-Cas9 gene editing system, as well as application of the constructed mouse animal model as an astroblastoma animal model.

[0035] The method of the present invention has a high success rate in constructing a MN1-BEND2 fusion gene knock-in mouse animal model (the positive rate of transgenic mice is above 11.6%), and the expression efficiency of the MN1-BEND2 fusion gene in the mouse animal model is high.

[0036] Furthermore, the MN1-BEND2 fusion gene knock-in mouse model constructed according to the method of the present invention is an animal model that expresses the MN1-BEND2 fusion gene in a Cre-dependent manner. When it is hybridized with a mouse that specifically expresses Cre, the cell-specific expression of the MN1-BEND2 fusion gene in a specific region can be achieved. For example, in an embodiment of the present invention, by hybridizing the MN1-BEND2 fusion gene knock-in mouse model with Nestin CreER Mouse hybridization, constructed Nestin CreER MN1:BEND2 mice, which achieved the specific expression of the MN1-BEND2 fusion gene in neural stem cells in the central nervous system; and, through the interaction with Olig2 Cre Mouse hybridization, construction of Olig2 Cre;MN1:BEDN2 mice, which achieved the specific expression of the MN1-BEND2 fusion gene in ventral neural stem cells.

[0037] According to the MN1:BEDN2 fusion gene Cre-dependent expression mouse animal model constructed by the construction method of the present invention, cells that specifically express the fusion gene MN1-BEND2 have the characteristic molecular phenotype and proliferation characteristics of astroblastoma. Therefore, the specific expression of the fusion gene MN1-BEND2 in a specific area can better simulate astroblastoma in the human body, so that it can be used as an animal model of astroblastoma for studying the occurrence and development mechanism of astroblastoma or screening therapeutic drugs for astroblastoma, which has great industrial value. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] One or more embodiments are exemplarily described by the pictures in the accompanying drawings, and these exemplary descriptions do not constitute limitations on the embodiments. The special word "exemplary" here means "used as an example, embodiment or illustrative". Any embodiment described as "exemplary" here is not necessarily interpreted as being superior or better than other embodiments.

[0039] Figure 1 Schematic diagram showing the MN1:BEND2 fusion gene targeting strategy.

[0040] Figure 2 The MN1:BEND2 fusion gene and its upstream and downstream elements in the homologous recombination vector used in the present invention are shown.

[0041] Figure 3 Schematic diagram of primer design for identifying F0 generation mice.

[0042] Figure 4 The PCR identification results of the F0 generation mice genotypes; the * marks positive mice, which are mice numbered 728-14, 728-17, 730-18, 730-21 and 734-28.

[0043] Figure 5 The PCR identification results of the F1 generation mouse genotypes; the * marks positive mice, which are mice numbered 728-14-2, 728-14-5, 728-18-1, 728-18-2, 728-18-5, 728-18-7, 728-18-9, 728-18-11, 728-18-12, 728-18-13, and 728-18-14.

[0044] Figure 6 Immunofluorescence was used to identify the MN1:BEND2 fusion gene (with HA tag) in Nestin CreER; Expression in MN1:BEND2 mice; VZ stands for ventricular zone, SVZ stands for subventricular zone, and LGE stands for lateral ganglionic eminence; red is HA staining, and blue is DAPI staining.

[0045] Figure 7 Immunofluorescence was used to identify the MN1:BEND2 fusion gene (with HA tag) in Olig2 Cre ; Expression in MN1:BEND2 mice; MGE ​​represents the middle ganglionic eminence, LGE represents the lateral ganglionic eminence, and Ctx represents the cortex; E13.5 means embryonic day 13.5; red is HA staining and blue is DAPI staining.

[0046] Figure 8 Shown on Nestin CreER ; MN1:BEDN22 expression in MN1:BEND2 mice promotes the proliferation of neural stem cells in the ventral ganglionic eminence; Figure A shows the results of immunofluorescence staining, in which green is KI6 staining and blue is DAPI staining; Figure B shows the statistical results of the number of KI67+ cells in each field of view, in which the significant difference between the two groups was p-value 0.025.

[0047] Fig. 9 Shown in Olig2 Cre ; MN1:BEDN2 expression in MN1:BEND2 mice promotes cell proliferation in the cortical region; Figure A shows the results of immunofluorescence staining, in which green is KI67 staining and blue is DAPI staining; Figure B shows the statistical results of the number of KI67+ cells in each field of view, in which the significant difference between the two groups was p-value 0.0004.

[0048] Fig.10 Display Olig2 Cre MN1:BEND2;AI14 mice (i.e., MN1:BEND2 in the figure) + ) and Olig2 Cre ; Single-cell UMAP image of brain tissue of AI14 mice (i.e., Ctrl in the figure).

[0049] Fig.11 Display Olig2 Cre MN1:BEND2;AI14 mice (i.e., MN1:BEND2 in the figure) + ) and Olig2 Cre ; Pseudo-time analysis results of single-cell sequencing results of brain tissue of AI14 mice (i.e., Ctrl in the figure).

[0050] Fig.12 Display Olig2 Cre; Heat map of astroblastoma-characteristic gene expression in MN1:BEDN2-positive cells in MN1:BEND2 mice. DETAILED DESCRIPTION

[0051] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.

[0052] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0053] In order to make the present invention more easily understood, some technical terms are specifically defined as follows. Unless otherwise clearly defined in other parts of this article, the technical terms used herein have the meanings commonly understood by ordinary technicians in the field to which the present invention belongs.

[0054] The term "about" when used in conjunction with a numerical value is meant to encompass the numerical value within a range having a lower limit that is 5% less than the specified numerical value and an upper limit that is 5% greater than the specified numerical value, including but not limited to ±5%, ±2%, ±1%, and ±0.1%, as such variations are appropriate for performing the disclosed methods.

[0055] The term "and / or" should be understood to mean any one of the optional items or a combination of any two or more of the optional items.

[0056] As used herein, the term "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one of the numbers or elements in the list, but also including more than one, and optionally, additional unlisted items. Only when terms are clearly indicated to the contrary, such as "only one" or "exactly one" or when "consisting of..." is used in the claims, it will refer to only one number listed or one element of the list.

[0057] The term "nucleic acid" or "polynucleotide" refers to deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) and polymers thereof in either single- or double-stranded form.

[0058] The preferred embodiments of the present invention will be described in detail below in conjunction with examples. It should be understood that the following examples are provided only for the purpose of illustrating the present invention and are not intended to limit the scope of the present invention. Those skilled in the art may make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0059] Example 1: Construction of MN1:BEND2 fusion gene knock-in mice

[0060] In this embodiment, C57BL / 6J mice were used to construct an MN1:BEND2 fusion gene knock-in mouse animal model using the CRISPR / Cas9 gene targeting strategy. The C57BL / 6J mice used were purchased from the Animal Center of Beijing Brain Science and Brain-Inspired Research Center. C57BL / 6J female mice were superovulated at 4 weeks of age, co-housing with male mice over 8 weeks of age for one night, and then fertilized eggs were obtained. The gene editing components were microinjected into the fertilized eggs, and then the microinjected fertilized eggs were transplanted into pseudo-pregnant 8-week-old ICR female mice. The schematic diagram of the MN1:BEND2 fusion gene targeting strategy is shown in Figure 1 shown.

[0061] The specific process of gene editing is as follows:

[0062] (1) obtaining active sgRNA (whose nucleotide sequence is shown in SEQ ID NO: 1) and Cas9 mRNA (whose template DNA sequence is shown in SEQ ID NO: 3) by in vitro transcription;

[0063] (2) Constructing a homologous recombination vector; the backbone source of which is CMV-LSL-Prnp-H11, into which the expression element comprising the 5' homology arm, LoxP-stop-LoxP element, MN1:BEND2 fusion gene sequence and 3' homology arm is introduced, thereby obtaining a homologous recombination vector; the composition diagram of the above expression element is shown in Figure 2 , wherein the MN1:BEND2 fusion gene sequence is shown in SEQ ID NO:2, the 5' homology arm sequence is shown in SEQ ID NO:4, and the 3' homology arm sequence is shown in SEQ ID NO:5;

[0064] (3) Cas9 mRNA, sgRNA and homologous recombination vectors were microinjected into fertilized eggs of C57BL / 6J mice (a total of 15 donor mice, about 200-250 fertilized eggs), and then the microinjected fertilized eggs were transplanted into the oviducts of surrogate mice to obtain founder mice; then, the genomic DNA of the mice was extracted for PCR identification; the schematic diagram of the primer design for PCR identification of F0 generation mice is shown in the figure. Figure 3 As shown, the primers include:

[0065] MN1-BEND2-PCR2-F: TAGTTGCCAGCCATCTGTTG (SEQ ID NO: 6);

[0066] MN1-BEND2-PCR2-R: GGCATAGTCTACCACATCCACTGAGG (SEQ ID NO:7);

[0067] MN1-BEND2-Fusion-F:CGCAGATCCAGCTACAGAGG (SEQ ID NO:8);

[0068] MN1-BEND2-Fusion-R: GAAGAGGCTGGATATGGGGC (SEQ ID NO:9).

[0069] The transgenic fragment amplified by the MN1-BEND2-PCR2 primer pair is 1615 bp, while no amplified fragment is obtained for endogenous genes that have not been integrated with the transgenic gene; the transgenic fragment amplified by the MN1-BEND2-Fusion primer pair is 430 bp, while no amplified fragment is obtained for endogenous genes that have not been integrated with the transgenic gene. Therefore, if the MN1-BEND2-PCR2 primer pair can amplify a 1615 bp fragment and the MN1-BEND2-Fusion primer pair can amplify a 430 bp fragment, it proves that the transgenic mouse is successfully constructed.

[0070] PCR identification results Figure 4 shown.

[0071] Through the above PCR identification, it was confirmed that 5 F0 generation MN1:BEND2 fusion gene knock-in mice with correct homologous recombination (hereinafter referred to as F0 generation positive mice) were obtained, and their numbers were: 728-14, 728-17, 730-18, 730-21 and 734-28.

[0072] (4) The F0 generation positive mice are mated with wild-type mice of the opposite sex to obtain offspring mice, and the genomic DNA of the offspring mice is extracted for PCR identification; the primers used for PCR identification of the F1 generation mice are the same as the identification primers of the F0 generation mice mentioned above.

[0073] PCR identification results Figure 5 shown.

[0074] Among them, the F0 male mouse numbered 730-21 was put into a cage with a wild-type female mouse, and a total of 8 offspring were produced. Through PCR genotyping, 2 of them were positive, and they were numbered 728-14-2 and 728-14-5 respectively; the F0 male mouse numbered 730-18 was mated with a wild-type female mouse, and a total of 15 offspring were produced. Through PCR genotyping, 9 positive offspring were obtained, and they were numbered 728-18-1, 728-18-2, 728-18-5, 728-18-7, 728-18-9, 728-18-11, 728-18-12, 728-18-13, and 728-18-14 respectively. These positive offspring are called F1 positive mice.

[0075] Example 2: Nestin CreER ; MN1:BEND2 mice, Olig2 Cre MN1:BEND2 mice and Olig2 Cre Construction of MN1:BEND2;AI14 mice

[0076] The F1 positive mice obtained in Example 1 were respectively inoculated with the opposite sex Nestin CreER Mice (provided by Shi Songhai Laboratory, Tsinghua University, the preparation method of which can be found in the paper of Imayoshi I et al.: Temporal regulation of Crerecombinase activity in neural stem cells. Genesis, 44(5): 233-8(2006). 16652364) or heterosexual Olig2 Cre Mice (The Jackson Laboratory, JAX 025567) were caged together and mated to obtain offspring mice. Genomic DNA of the offspring mice was extracted for PCR identification, and mice expressing both the MN1-BEND2 fusion gene and Cre were screened.

[0077] For identification of transgenic mice Nestin CreER PCR primers for genotyping include:

[0078] NestincreER-Mutant-F CGCCGCTACTTCTTTTCAAC(SEQ ID NO:10) NestincreER-Mutant-R ATGCAGGCAAATTTTGGTGT(SEQ ID NO:11) NestincreER-WT-F AGTGGCCTCTTCCAGAAATG(SEQ ID NO:12) NestincreER-WT-R TGCGACTGTGTCTGATTTCC(SEQ ID NO:13)

[0079] Among them, the gene fragment amplified using the above-mentioned NestincreER-Mutant-F and NestincreER-Mutant-R primer pairs is a transgenic fragment with a fragment length of 150bp; and the gene fragment amplified using the NestincreER-WT-F and NestincreER-WT-R primer pairs is a wild-type gene fragment (i.e., the endogenous gene without the integration of the transgenic gene) with a fragment length of 521bp. Therefore, if a 150bp fragment can be amplified, it proves that the above-mentioned transgenic mouse is successfully constructed; among them, if a 150bp fragment can be amplified without a 521bp fragment, it proves that the genotype of the transgenic mouse is homozygous Nestin CreER If the 150 bp fragment and the 521 bp fragment can be amplified, it proves that the genotype of the transgenic mouse is heterozygous Nestin CreER .

[0080] Combined with the identification method for the MN1-BEND2 fusion gene in Example 1, the expression of the MN1-BEND2 fusion gene and Nestin CreER The mouse is Nestin CreER ;MN1:BEND2 mice.

[0081] For identification of transgenic mice Olig2 Cre PCR primers for genotyping include:

[0082] Olig2Cre-Mutant-F TTACGGCGCTAAGGATGACT(SEQ ID NO:14) WT-F GGATCATTCGAGAGCTTAGATCA(SEQ ID NO:15) Common-R CTTTCTTGGTGGAAGACGTG(SEQ ID NO:16)

[0083] Among them, the gene fragment amplified by the above Olig2Cre-Mutant-F and Common-R primer pair is a transgenic fragment with a fragment length of 400bp; and the gene fragment amplified by the WT-F and Common-R primer pair is a wild-type gene fragment (i.e., the endogenous gene without the integration of the transgenic gene) with a fragment length of 323bp. Therefore, if a 400bp fragment can be amplified, it proves that the above transgenic mouse is successfully constructed; among them, if a 400bp fragment can be amplified without a 323bp fragment, it proves that the genotype of the transgenic mouse is homozygous Olig2 Cre If the 400 bp fragment and the 323 bp fragment can be amplified, it proves that the transgenic mouse genotype is heterozygous Olig2 Cre .

[0084] Combined with the identification method for the MN1-BEND2 fusion gene in Example 1, the expression of the MN1-BEND2 fusion gene and Olig2 Cre mice, namely Olig2 Cre ;MN1:BEND2 mice.

[0085] In the above construction process, Nestin CreER The mice are mice that specifically express Cre in neural stem cells in the central nervous system. When co-expressed with the LoxP-stop-LoxP-MN1-BEND2 fusion gene, the MN1-BEND2 fusion gene can be induced to specifically express in neural stem cells in the central nervous system. The Olig2 Cre The mouse is a mouse that specifically expresses Cre in ventral neural stem cells, and when co-expressed with the LoxP-stop-LoxP-MN1-BEND2 fusion gene, the specific expression of the MN1-BEND2 fusion gene in the ventral neural stem cells can be induced.

[0086] In addition, Olig2 Cre MN1:BEND2 mice were placed in cages with Ai14 (The Jackson Laboratory, JAX007914) mice of the opposite sex and mated to obtain offspring mice; genomic DNA of the offspring mice was extracted for PCR identification, and mice expressing the MN1-BEND2 fusion gene, Olig2Cre and Ai14 at the same time were screened and obtained, namely Olig2 Cre MN1:BEND2;AI14 mice; In a similar manner, Olig2 Cre The mice were placed in cages with Ai14 mice of the opposite sex and mated. The offspring mice were identified and the mice expressing both Olig2Cre and Ai14 were screened, which were Olig2 Cre ; AI14 mice.

[0087] The PCR primers used to identify the Ai14 genotype of transgenic mice include:

[0088] oIMR9020 AAGGGAGCTGCAGTGGAGTA(SEQ ID NO:17) oIMR9021 CCGAAAATCTGTGGGAAGTC(SEQ ID NO:18) oIMR9103 GGCATTAAAGCAGCGTATCC(SEQ ID NO:19) oIMR9105 CTGTTCCTGTACGGCATGG(SEQ ID NO:20)

[0089] Among them, the gene fragment amplified using the above-mentioned oIMR9020 and oIMR9021 primer pairs is a transgenic fragment with a fragment length of 196bp; and the gene fragment amplified using the oIMR9103 and oIMR9105 primer pairs is a wild-type gene fragment (i.e., the endogenous gene of the transgenic gene is not integrated), with a fragment length of 297bp. Therefore, if a 196bp fragment can be amplified, it proves that the above-mentioned transgenic mouse is successfully constructed; among them, if a 196bp fragment can be amplified without a 297bp fragment, it proves that the genotype of the transgenic mouse is homozygous Ai14; if a 196bp fragment and a 297bp fragment can be amplified, it proves that the genotype of the transgenic mouse is heterozygous Ai14.

[0090] Combining the identification method for the MN1-BEND2 fusion gene in Example 1 and the above-mentioned identification method for Olig2Cre, mice expressing the MN1-BEND2 fusion gene, Olig2Cre and Ai14 at the same time were obtained, namely Olig2 Cre ;MN1:BEND2;AI14 mice.

[0091] In addition, a similar identification method was used to screen and obtain mice that simultaneously expressed Olig2Cre and Ai14, namely Olig2 Cre ; AI14 mice.

[0092] In the above construction process, the Ai14 mouse used is a commonly used fluorescent reporter mouse. When co-expressed with Cre protein, it can induce cells to specifically express tdTomato red fluorescence. Therefore, the constructed Olig2 Cre MN1:BEND2; AI14 mice specifically express MN1:BEND2 fusion protein in Olig2 lineage cells, and the cells have red fluorescence; in addition, the constructed Olig2 Cre ; AI14 mice also have red fluorescence in Olig2 lineage cells. Therefore, flow cytometry can be used to separate Olig2 Cre ;MN1:BEND2;AI14 mice and Olig2 Cre ; Cells expressing red fluorescence were specifically sorted in AI14 mice for subsequent detection.

[0093] Example 3: Identification of Nestin by Immunofluorescence CreER MN1:BEND2 mice and Olig2 Cre Cell-specific expression of the MN1:BEND2 fusion gene in MN1:BEND2 mice

[0094] For Nestin CreER ; Identification of cell-specific expression of the MN1:BEND2 fusion gene in MN1:BEND2 mice, and the expression of Nestin CreER / + and MN1:BEND2 / + were mated and examined for pregnancy plugs. The day of pregnancy plug appearance was regarded as embryonic day 0.5. On embryonic day 13.5 of the female mice, 10 mg / kg tamoxifen was injected intraperitoneally to induce Nestin CreER ;

[0095] MN1:BEND2 fetuses expressed MN1:BEND2 in the Nestin-positive cell lineage, and then the fetuses were harvested on embryonic day 18.5 for genotyping. CreER; MN1:BEND2 genotype mice were stained for frozen sections. The perfused embryos were fixed in 4% PFA at 4°C for 2 hours, dehydrated in 30% sucrose, embedded in OCT and frozen at -80. The frozen brain tissue was frozen into 20um thick brain slices. The frozen brain tissue sections were blocked with 5% donkey serum and then stained. The staining process was to stain with the primary antibody HA-rabbit (1:500) overnight at 4°C, wash the primary antibody, and then stain with the secondary antibody donkey antirabbit Cyanine Cy3 (1:500) at room temperature for 2 hours. After washing the secondary antibody, the slides were sealed with a sealing agent containing DAPI, and then scanned with an Olympus VS120, with an image magnification of 20 times.

[0096] For Olig2 Cre ; Identification of cell-specific expression of the MN1:BEND2 fusion gene in MN1:BEND2 mice, Cre / + and MN1:BEND2 / + were mated and examined for pregnancy plugs. The day of pregnancy plug appearance was considered as embryonic day 0.5. The fetuses were taken for genotyping on embryonic day 13.5 of the mother mouse. Cre MN1:BEND2 genotype mice were used for frozen section staining. The frozen section, staining and image scanning methods were as above.

[0097] The results are as follows:

[0098] Nestin CreER In MN1:BEND2 mice, the expression of MN1:BEND2 fusion gene in the ventricular zone (VZ), subventricular zone (SVZ) and lateral ganglionic eminence (LGE) is shown in Figure 2. Figure 6 ; Figure 6 The results showed that almost all DAPI-positive nuclei in the ventricular zone (VZ), subventricular zone (SVZ) and lateral ganglionic eminence (LGE) expressed HA-tagged protein, proving that the MN1:BEND2 gene is expressed in Nestin CreER ; It has higher expression efficiency in MN1:BEND2 mice.

[0099] Olig2 Cre In MN1:BEND2 mice, the expression of MN1:BEND2 fusion gene in the middle ganglionic eminence (MGE), lateral ganglionic eminence (LGE) and cortex (Ctx) is shown in Figure 2. Figure 7 ; Figure 7 Display, in Olig2 CreIn MN1:BEND2 mice, HA-tagged protein was mainly expressed in the intermediate ganglion eminence, indicating that Olig2 lineage cells were specifically expressed in the intermediate ganglion eminence at embryonic day E13.5, and that MN1:BEND2 fusion mutant protein was highly expressed at this location. Cre ;MN1:BEND2 mice can specifically and efficiently express MN1:BEND2 fusion protein in neural stem cells in the intermediate ganglionic eminence.

[0100] Example 4: Nestin CreER MN1:BEND2 mice and Olig2 Cre ; Determination of the proliferation status of MN1:BEND2 fusion gene positive cells in MN1:BEND2 mice

[0101] For Nestin CreER ; The proliferation status of MN1:BEND2 fusion gene positive cells in the intermediate ganglion eminence of mice in the embryonic period was determined. On embryonic day 13.5 of the mother mouse, 10 mg / kg tamoxifen was intraperitoneally injected to induce the expression of MN1:BEND2 fusion protein in the Nestin-positive cell lineage. Then, on embryonic day 16.5, the fetal brain tissue was collected and fixed, dehydrated, and sectioned for staining. The steps for fixing and dehydrating sections of fetal brain tissue were as above, and the staining scheme was the primary antibody KI67-rat (1:500), TTF1-rabbit (1:500); the secondary antibody donkey anti rat Alexa Fluor 488 (1:500), donkey anti rabbit Cyanine Cy3 (1:500). The slides were scanned with a 20x microscope and then counted. TTF1 (Thyroid Transcription Factor-1) thyroid transcription factor is a marker protein that is specifically and highly expressed in the intermediate ganglion eminence during the development of the central nervous system and is used to indicate the location of the intermediate ganglion eminence. KI67 protein is closely related to cell proliferation. It is expressed during cell mitosis and intermittent phase, and is used to indicate whether the cell is in a proliferative state. For the statistics of the number of proliferating cells in the ventricular zone at the intermediate ganglion eminence, the range within 60um from the intermediate ganglion eminence to the edge of the ventricle is defined as the ventricular zone, and then the number of KI67-positive cells at this location is counted. CreER MN1:BEND2 mice and control mice were counted separately, and half or whole brains of 3 mice in each group were taken for statistics.

[0102] For Olig2 Cre MN1:BEND2 mice cerebral cortex proliferation status, collected 4 days after birth Olig2 CreMN1:BEND2 mice and littermate control mice brain tissues were fixed, embedded and sectioned for staining. The staining scheme was primary antibody KI67-rat (1:500); secondary antibody donkey anti rat Alexa Fluor 488 (1:500). The slides were scanned at 20 times and the data were counted. Olig2 Cre The number of KI67-positive cells in the cerebral cortex of MN1:BEND2 mice and control mice was counted within a 520um width range, and half or whole brains of three mice in each group were taken for statistics.

[0103] The results are as follows:

[0104] Nestin CreER In MN1:BEND2 mice, the proliferation status of cells in the midventricular zone of the intermediate ganglionic eminence is as follows Figure 8 As shown in Figures A and B in the figure; Figure 8 Figure A shows the immunofluorescence staining results of cells in the midventricular zone of the interganglionic eminence, which showed that Nestin CreER MN1:BEND2 mice showed an abnormal increase in the intermediate ganglion eminence, suggesting that cells in the intermediate ganglion eminence may have abnormally proliferated, causing this region to not regress during the development of the central nervous system. Figure 8 Figure B shows the number of KI67+ proliferating cells in the ventricular zone of the interganglionic eminence, which indicates that Nestin CreER MN1:BEND2 mice have a significantly increased number of proliferating cells in the ventricular zone of the intermediate ganglion eminence, leading to Nestin CreER MN1:BEND2 mice develop abnormally enlarged intermediate ganglion eminence on embryonic day 13.5.

[0105] Olig2 Cre In MN1:BEND2 mice, the proliferation status of cells in the cortical region is as follows Fig. 9 As shown in Figures A and B in the figure; Fig. 9 Figure A shows the immunofluorescence staining results of cells in the cortical area. Fig. 9 Panel B shows the statistical results of the number of KI67+ proliferating cells in each field of view, which shows that compared with control mice, Olig2 Cre ; The number of proliferating cells in the cerebral cortex of MN1:BEND2 mice was significantly increased, suggesting that expressing MN1:BEDN2 fusion protein in the ventral neural stem cells of the intermediate ganglionic eminence will lead to enhanced cell proliferation.

[0106] Example 5: Olig2 CreMN1:BEND2 fusion protein positive cells and Olig2 in MN1:BEND2 mice Cre ; Single-cell sequencing dimensionality reduction clustering and pseudo-time series analysis of AI14 mouse brain tissue

[0107] Olig2 on day 3 after birth Cre ;MN1:BEND2;AI14 mice and Olig2 Cre ; Single cell suspensions were extracted from the brain tissues of AI14 mice, and AI14 positive cells were obtained by FACS flow cytometry sorting and single cell sequencing was performed. Cre MN1:BEDN2 positive cells in the sequencing results of AI14 mouse brain tissue were defined as MN1:BEDN2+ cells, and Olig2 Cre ; All cells in the AI14 mouse brain tissue sequencing results are defined as ctrl. The single-cell sequencing results were subjected to dimensionality reduction clustering analysis, and cell types were defined based on the gene expression patterns in each group of cells. The single-cell UMAP map is shown in Fig.10 As shown. Then in Olig2 Cre MN1:BEND2;AI14 and Olig2 Cre In AI14 cells, IP-IN and NSC-like1 cell populations were defined as root nodes for pseudo-sequential analysis. The results are shown in Fig.11 shown.

[0108] The results are analyzed as follows:

[0109] Olig2 Cre ;MN1:BEND2;AI14 mice and Olig2 Cre ; AI14 mouse brain tissue single cell UMAP map see Fig.10 ; Fig.10 Display, Olig2 CreSingle cells in AI14 mouse brain tissue were divided into 7 categories based on gene expression patterns, namely IP-IN (Intermediate Progenitors that generate GABAergic Inhibitory Neurons), IN1 (Inhibitory Neuron-type1), IN2 (Inhibitory Neuron-type2), IN3 (Inhibitory Neuron-type3), OPC (Oligodendrocyte Precursor Cell), PriOPC (Primitive OPC) and As (Astrocyte). Cre MN1:BEND2; Single cells in the brain tissue of AI14 mice were divided into 7 categories based on gene expression patterns, namely NSC-like1 (neural stem cell-like cell 1), NSC-like2 (neural stem cell-like cell 2), NSC-like3 (neural stem cell-like cell 3), EN-like (Excitatory Neuron-like, excitatory neuron-like cell), IN-like (Inhibitory Neuron-like, inhibitory neuron-like cell), OPC-like (Oligodendrocyte Precursor Cell-like, oligodendrocyte precursor cell-like cell) and AS-like (Astrocyte-like, astrocyte-like cell). The UMAP map showed that compared with the control cells, the proportion of neural stem cells in MN1:BEND2 positive cells increased, while the proportion of mature and differentiated neurons decreased, and the cell differentiation lineage was confused.

[0110] In addition, the single-cell sequencing results were analyzed in reverse time and space, and the results were as follows Fig.11 As shown; Fig.11 The results showed that compared with the control cells, the neural stem cell-like cells, oligodendrocyte precursor cell-like cells and astrocyte-like cells in the MN1:BEND2-positive cells were in the early stages of the pseudo-time series analysis, indicating that the overexpression of the MN1:BEND2 fusion protein can inhibit the differentiation of neural stem cells and cause them to stagnate in the early stages of differentiation, which is consistent with the characteristics of astroblastoma.

[0111] Example 6: Olig2 Cre;MN1:BEND2;AI14 mice in MN1:BEND2 fusion protein positive cells of astroblastoma characteristic gene expression profile determination

[0112] Based on the results of transcriptome sequencing of tumor tissues of astroblastoma patients in published literature, the characteristic gene expression profile of astroblastoma was analyzed, which contained 34 characteristic expression genes of astroblastoma. In the control group, IP-IN cells were defined as Prog (Progenitor Cell, neural stem cells), PriOPC, OPC and AS cells were defined as Glia (Glia Cell, glial cells), IN1, IN2 and IN3 cells were defined as N (Neuron, neurons). Olig2 Cre ; In MN1:BEND2 mice, NSC-like1, NSC-like2, and NSC-like3 cells in MN1:BEND2 positive cells were defined as Prog (Progenitor Cell, neural stem cells), OPC-like and AS-like cells were defined as Glia (GliaCell, glial cells), and EN-like and IN-like cells were defined as N (Neuron, neurons). The average expression levels of astroblastoma characteristic genes in neural stem cells, glial cells, and neurons in control cells and MN1:BEND2 positive cells were analyzed and heat maps were drawn.

[0113] The results are as follows:

[0114] Olig2 Cre The heat map of the average expression of astroblastoma characteristic genes in MN1:BEND2 fusion protein positive cells in MN1:BEND2; AI14 mice is shown in Fig.12 . Fig.12 It was shown that compared with cells in the control group, the expression of characteristic genes in astroblastoma patients was upregulated in MN1:BEDN2-positive cells, especially in the MN1:BEDN2-positive cells of the neural stem cell population, where the characteristic genes of astroblastoma patients were significantly highly expressed.

[0115] The above results indicate that the expression of MN1:BEDN2 fusion protein in ventral neural stem cells, especially in the Olig-positive intermediate ganglion eminence neural stem cells, inhibits the normal differentiation of neural stem cells, causing the cells to stagnate in the neural stem cell state and highly express characteristic genes in astroblastoma patients. This suggests that the expression of MN1:BEDN2 in Olig2 lineage cells will induce astroblastoma-like changes in the cell state.

[0116] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A specific target site guide RNA for constructing a transgenic mouse with MN1-BEND2 fusion gene knock-in, characterized in that: The nucleotide sequence of the specific target site guide RNA is shown in SEQ ID NO:

1.

2. The target-specific guide RNA according to claim 1, characterized in that The sequence of the MN1-BEND2 fusion gene to be knocked in is shown in SEQ ID NO: 2; The knock-in site of the MN1-BEND2 fusion gene is the H11 site on mouse chromosome 11.

3. A CRISPR-Cas9 gene editing system for constructing a transgenic mouse animal model with MN1-BEND2 fusion gene knock-in, characterized in that: The CRISPR-Cas9 gene editing system includes: The specific target site guide RNA as claimed in claim 1, Cas9 mRNA, and a homologous recombination vector comprising the MN1-BEND2 fusion gene to be knocked in.

4. The CRISPR-Cas9 gene editing system according to claim 3, characterized in that The sequence of the MN1-BEND2 fusion gene is shown in SEQ ID NO: 2; And / or, the sequence of the Cas9 mRNA is as shown in SEQ ID NO: 3; and / or, the homologous recombination vector has a LoxP-stop-LoxP element between the promoter and the MN1-BEND2 fusion gene to achieve Cre-dependent expression of the MN1-BEND2 fusion gene; And / or, the homologous recombination vector comprises a 5' homology arm and a 3' homology arm; preferably, the 5' homology arm has a sequence as shown in SEQ ID NO:4, and the 3' homology arm has a sequence as shown in SEQ ID NO:

5.

5. Use of the specific target site guide RNA as described in claim 1 or 2 or the CRISPR-Cas9 gene editing system as described in claim 3 or 4 in preparing an MN1-BEND2 fusion gene knock-in mouse animal model.

6. A method for constructing an MN1-BEND2 fusion gene knock-in mouse animal model, characterized in that: The method uses the specific target site guide RNA as described in claim 1 or 2 or the CRISPR-Cas9 gene editing system as described in claim 3 or 4.

7. The method according to claim 6, characterized in that The method comprises: (1) transcribe the specific target site guide RNA and Cas9 into mRNA in vitro to obtain active gRNA and Cas9 mRNA; (2) constructing homologous recombination vector; (3) Active gRNA, Cas9 mRNA and homologous recombination vector are microinjected into the fertilized eggs of donor mice, and then the fertilized eggs are transplanted into recipient mice for gestation to obtain offspring mice. The F0 generation of mice is screened through genotyping; (4) mating F0 mice with wild-type mice of the opposite sex to obtain offspring mice, and screening F1 generation MN1-BEND2 fusion gene knock-in heterozygous mice through genotyping; and, Optionally, (5) the F1 generation MN1-BEND2 fusion gene knock-in heterozygous mice obtained in step (4) are inbred to obtain offspring mice, and the F2 generation MN1-BEND2 fusion gene knock-in homozygous mice are screened and obtained through genotyping.

8. The method according to claim 7, characterized in that The method further comprises: (6) The F1 generation MN1-BEND2 fusion gene knock-in heterozygous mice obtained in step (4) or the F2 generation MN1-BEND2 fusion gene knock-in homozygous mice obtained in step (5) are mated with mice of the opposite sex that specifically express Cre to obtain offspring mice, and the offspring are screened for mice that express both the MN1-BEND2 fusion gene and Cre through genotyping.

9. The method according to any one of claims 6 to 8, characterized in that: The mice were all of C57BL / 6J strain; and / or, a PCR primer set for identifying the genotype of the MN1-BEND2 fusion gene of F0 and F1 generation mice comprises primers as shown in SEQ ID NOs: 6, 7, 8 and 9; And / or, the mouse specifically expressing Cre is a Cre mouse that induces the expression of the fusion gene in neural stem cells in the central nervous system, preferably Nestin CreER or a Cre mouse that induces the expression of the fusion gene in ventral neural stem cells, preferably Olig2 Cre Mice; Preferably, when the mouse specifically expressing Cre is Nestin CreER When mice are used, the PCR primer set for identifying mice expressing both the MN1-BEND2 fusion gene and Cre includes primers as shown in SEQ ID NOs: 10, 11, 12, and 13; When mice specifically expressing Cre are Olig2 Cre When mice are expressed, the PCR primer set for identifying mice expressing both the MN1-BEND2 fusion gene and Cre includes primers as shown in SEQ ID NOs: 14, 15 and 16.

10. Use of the MN1-BEND2 fusion gene knock-in mouse animal model constructed by the method according to any one of claims 6 to 9 as an astroblastoma animal model in studying the occurrence and development mechanism of astroblastoma or screening therapeutic drugs for astroblastoma.

Images