Cryophilic salt activated beta-N-acetylglucosaminidase mutant D180S and application thereof

Abstract

The invention discloses a psychrophilic salt activated beta-N-acetylglucosaminidase mutant D180S and application thereof, and relates to the technical field of gene engineering. The amino acid sequence of the mutant D180S is shown as SEQ ID NO.1, the optimum pH value of the mutant D180S is 6.0, the optimum temperature of the mutant D180S is 5 DEG C, and compared with recombinant wild beta-N-acetylglucosaminidase with the amino acid sequence shown as SEQ ID NO.5, the optimum temperature of the mutant D180S is reduced by 40 DEG C. The enzyme activity of the recombinant wild beta-N-acetylglucosaminidase opt-HJ5NagNC is reduced along with the increase of the salt concentration in a reaction system, while NaCl, NaBr, NaI, NaF and NaNO3 can activate the activity of D180S to different extents, and the mutant can be applied to the field of biotechnology under the low-temperature salt-containing environment requirement, and especially can be applied to the industries of food, brewing, washing, papermaking, sewage treatment and the like.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a psychrophilic salt-activated beta-N-acetylglucosaminidase mutant D180S and a use thereof. Background Art

[0002] Chitin can also be called chitin polysaccharide, chitosan, chitosan, and polyacetyl glucosamine. It is composed of N-acetyl-D-glucosamine connected by β-1,4 glycosidic bonds. It is widely found in the shells of marine crustaceans, the skeletons of mollusks, the wings of insects, and the cell walls of algae. Chitin is an important polysaccharide with a wide range of application values. It has a huge storage capacity in nature and belongs to the second largest category of natural polymer compounds, second only to cellulose.

[0003] β-N-acetyl-D-glucosaminidases (GlcNAcases, β-N-acetyl-D-glucosaminidases, EC3.2.1.52) can hydrolyze oligosaccharides and proteins containing N-acetylglucosamine (Zhang et al. Appl Microbiol Biot, 2018, 102(1): 93–103). Endochitinase hydrolyzes chitin to produce chitooligosaccharides, and β-N-acetylglucosamine can further hydrolyze chitooligosaccharides to produce N-acetylglucosamine (GlcNAc). GlcNAc can be used in functional foods, energy, cosmetics and other fields.

[0004] β-N-acetylglucosaminidase has low activity in low temperature environments, which greatly limits its use. Psychrophilic enzymes are still active at 0°C and can show strong activity in the field of biotechnology that requires low temperatures. At the same time, they can increase the temperature to inactivate the enzyme under mild conditions to control the industrial production process; halophilic enzymes can be used in fields such as seafood processing. Processing food in a high-salt environment can also prevent microbial contamination and save energy consumed by sterilization. Its salt-activated characteristics are also conducive to controlling the catalytic reaction by adjusting the salt concentration. Therefore, the development of a salt-tolerant and salt-loving β-N-acetylglucosaminidase is conducive to its application in food processing, brewing, washing, papermaking, sewage treatment, environmental pollution and other industries. Summary of the invention

[0005] The purpose of the present invention is to provide a psychrophilic salt-activated β-N-acetylglucosaminidase mutant having a lower optimum temperature, so as to be better applied in the biotechnology field under the requirements of low-temperature salt-containing environment.

[0006] In order to achieve the above object, the present invention provides a cold-loving salt-activated β-N-acetylglucosaminidase mutant D180S, the amino acid sequence of the mutant D180S is shown in SEQ ID NO.1, the mutant D180S has 78.41% enzyme activity at 0°C, and its activity can be activated by halogen salts and NaNO3. The mutant D180S provided by the present invention can be applied in the field of biotechnology under low temperature and salty environment requirements, including industries such as washing, papermaking or sewage treatment, and can also be used in food industries such as brewing.

[0007] The present invention also provides a gene encoding the mutant D180S, and the nucleotide sequence of the gene encoding is shown as SEQ ID NO.2.

[0008] The present invention also provides a recombinant plasmid comprising the above coding gene, wherein the recombinant plasmid is selected from vectors of the PET series, preferably pET-22b(+).

[0009] The present invention also provides a recombinant bacterium comprising the above encoding gene, wherein the recombinant bacterium is selected from Escherichia coli, preferably from BL21 (DE3).

[0010] The psychrophilic salt-activated β-N-acetylglucosaminidase mutant D180S provided by the present invention solves the problems of poor low-temperature activity of wild β-N-acetylglucosaminidase and insensitivity to salt-added regulation of activity, and has the following advantages:

[0011] Compared with the recombinant wild β-N-acetylglucosaminidase opt-HJ5NagNC, the mutant D180S provided by the present invention has changed thermal activity and activity in different concentrations of halogen salts and NaNO3. The optimum temperature of the mutant D180S is 5°C, and the activity is improved under low temperature conditions. In addition, halogen salts and NaNO3 have an activating effect on the enzyme activity of the enzyme. The optimum temperature of the purified recombinant wild enzyme opt-HJ5NagNC is 45°C, and the enzyme activity is only 2.3% at 0°C; the optimum temperature of the mutant D180S is 5°C, and the enzyme activity is still 78.41% at 0°C. The enzymatic reactions were carried out in final concentrations of 0.1-3.5M NaCl, NaBr, NaNO3 and 0.1-1M NaI, respectively. The activity of the recombinant wild enzyme opt-HJ5NagNC was inhibited to varying degrees, while the activity of D180S was activated to varying degrees, among which NaCl and NaBr had the most obvious activation effects on D180S: in a salt-free system, the specific activity of D180S was about 2.26U / mg; in a final concentration of 1.5M NaCl, the specific activity of D180S was the highest, with the activity increased by about 234 times; in a final concentration of 0.5M NaBr system, the specific activity of D180S was the highest, with the activity increased by about 232 times; in a final concentration of 0.7M NaNO3, the specific activity of D180S was the highest, with the activity increased by about 66 times; in a final concentration of 0.3M NaI, the specific activity of D180S was the highest, with the activity increased by about 29 times. In addition, in the NaF system with a final concentration of 0.4 M, the specific activity of D180S is the highest, with the activity increased by about 44 times. The activation effects of the five anions tested in the present invention on D180S are Cl - >Br - >NO3 - >F - >I - .

[0012] The mutant D180S provided by the present invention can be applied to the field of biotechnology under low-temperature and saline environment requirements, especially to industries such as food, brewing, washing, papermaking, sewage treatment, etc., and has significant application value. In the food industry, halophilic enzymes can be used in seafood processing, kimchi and sauce making, and salty foods. In addition, halophilic esterases and lipases are used in industry to synthesize unsaturated fatty acids and short-chain fatty acids as dietary supplements. In the brewing industry, halophilic enzymes can be used in high-salt dilute soy sauce fermentation. The fermented soy sauce has good color, outstanding flavor, and rich freshness and fragrance. In the washing industry, NaCl is a component of detergents. The enzymes used in detergents can only work if they remain active under salt conditions. The halophilic lipase derived from Aspergillus niger MH079049.1 has been used in detergent formulations (AlabdalallAH et al. Scientific Reports, 2021, 11(1): 19670). In the sewage treatment industry, NaCl is the main inorganic salt in high-salt sewage, especially in high-salt food processing wastewater. Adding halophilic enzymes to high-salt sewage can improve the biological treatment efficiency of sewage. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 The results of SDS-PAGE analysis of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in the present invention.

[0014] Figure 2 These are the activity test results of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in the present invention at different pH values.

[0015] Figure 3 These are the results of thermal activity determination of the recombinant wild enzyme opt-HJ5NagNC and the mutant D180S in the present invention.

[0016] Figure 4 The activities of the recombinant wild enzyme opt-HJ5NagNC (a) and mutant D180S (b) in the present invention in a final concentration of 0-3.5 M NaCl.

[0017] Figure 5 The activities of the recombinant wild enzyme opt-HJ5NagNC (a) and mutant D180S (b) in the present invention in a final concentration of 0-3.5 M NaBr.

[0018] Figure 6 The activities of the recombinant wild enzyme opt-HJ5NagNC (a) and mutant D180S (b) in the present invention in a final concentration of 0-3.5M NaNO3.

[0019] Figure 7The activities of the recombinant wild enzyme opt-HJ5NagNC (a) and mutant D180S (b) in the present invention in a final concentration of 0-0.7 M NaF.

[0020] Figure 8 The activities of the recombinant wild enzyme opt-HJ5NagNC (a) and mutant D180S (b) in the present invention in a final concentration of 0-1.0 M NaI. DETAILED DESCRIPTION

[0021] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0022] Description: The wild-type β-N-acetylglucosaminidase HJ5Nag mentioned in the embodiment of the present invention has an amino acid sequence as shown in SEQ ID NO.3, and its GenBank accession number is ARJ33352.1; the gene encoding the enzyme is the β-N-acetylglucosaminidase gene hj5nag, and its nucleotide sequence is shown in SEQ ID NO.4, and its GenBank accession number is KX400857.1.

[0023] Some experimental materials and reagents used in this invention:

[0024] 1) Recombinant expression strain: The recombinant expression strain that can express hj5nag is preserved by Yunnan Normal University.

[0025] 2) Strains and vectors: Escherichia coli BL21 (DE3) was purchased from Beijing Biomed Gene Technology Co., Ltd.; pET-22b (+) expression vector was from Jiangsu Suzhou Hongxun Biotechnology Co., Ltd.

[0026] 3) Other reagents: pNP-GlcNAc was purchased from Shanghai Yuanye Biotechnology Co., Ltd.; Nickel-NTA protein purification resin was purchased from Qiagen; plasmid mini-extraction kit was purchased from Omega; QuickMutation TM The gene site-directed mutagenesis kit was purchased from Biotechnology Co., Ltd.; IPTG was purchased from Solebow Technology Co., Ltd.; and the low molecular weight standard protein marker was purchased from Takara Biotechnology Co., Ltd.

[0027] 4) LB liquid medium: NaCl (w / v = 1%) 5 g, Peptone (w / v = 1%) 5 g, Yeast extract (w / v = 0.5%) 2.5 g, add ddH2O to make up to 500 mL, pH is about 7.0; LB solid culture containing ampicillin (Amp): NaCl (w / v = 1%) 5 g, Peptone (w / v = 1%) 5 g, Yeast extract (w / v = 0.5%) 2.5 g, agar (w / v = 2%) 10 g, add ddH2O to make up to 500 mL, sterilize at 121°C, high pressure steam for 30 min, and then add 500 μL of 100 mg / mL Amp after cooling.

[0028] Note: The molecular biology experimental methods not specifically described in the following examples are all carried out with reference to the specific methods listed in the book Molecular Cloning Experiment Guide (3rd Edition) by J. Sambrook, or according to the kits and product instructions.

[0029] Experimental Example 1 Construction and transformation of mutant D180S expression vector

[0030] The nucleotide sequence of the N-acetylglucosaminidase gene hj5nag, whose GenBank accession number is KX400857, is codon-optimized after deleting the coding sequence (5'-ATGAATCGTCGCCGAGGACGGGCCATCGCCGCCGCCACGGTGCTC GCCGCGTCGCTGGCG-3') of its signal peptide (MNRRRGRAIAAATVLAASLA), and at the same time, a coding sequence 7 is introduced after its start codon, and its nucleotide sequence is shown in SEQ ID NO.7, and a coding sequence 8 is introduced before its stop codon, and its nucleotide sequence is shown in SEQ ID NO.8, as shown in detail as follows:

[0031] Coding sequence 7 (SEQ ID NO.7):

[0032] 5′-GAATTGGCACTT-3′;

[0033] Coding sequence 8 (SEQ ID NO.8):

[0034] 5′-AAGGGACAATTC-3′.

[0035] The introduced coding sequences 7 and 8 correspond to the nucleotide fragments of the amino acid fragments 'ELAL and KGQF', respectively, corresponding to the amino acids on the original vector pEasy-E2 during the sequence recombination process (Zhou JP et al. BMC Biotechnol. 2017Apr 11, 17(1):37).

[0036] After optimization, the N-acetylglucosaminidase optimized gene opt-hj5nagNC with a nucleotide sequence as shown in SEQ ID NO.6 was obtained. The optimized gene opt-hj5nagNC was synthesized by Suzhou Hongxun Biotechnology Co., Ltd., and opt-hj5nagNC was constructed between the NdeI and XhoI restriction sites in the vector pET-22b(+), and the ATG on NdeI was used as the start codon. After sequencing verification, a recombinant expression plasmid pET-22b(+)-opt-hj5nagNC containing the optimized gene opt-hj5nagNC was obtained. The recombinant expression plasmid pET-22b(+)-opt-hj5nagNC was transferred into BL21(DE3) by heat shock method to obtain a recombinant expression bacterium containing the optimized gene. The protein expressed by the optimized gene opt-hj5nagNC is the optimized wild enzyme opt-HJ5NagNC, and its amino acid sequence is shown in SEQ ID NO.5.

[0037] The recombinant strain containing the recombinant plasmid pET-22b(+)-opt-hj5nagNC was inoculated into LB medium (containing 0.1% 100 mg / mL ampicillin) at 0.1% (v / v), cultured overnight at 37°C and 180 rpm / min, and the plasmid was extracted using a plasmid mini-extraction kit.

[0038] Two mutant primers (F and R) were designed using CE Design software. Amplification using the mutant primers can mutate the aspartic acid at position 180 of the optimized wild enzyme opt-HJ5NagNC to serine. The specific sequences of the mutant primers are shown below.

[0039] The mutation primer sequences are as follows (5'→3'):

[0040] F (SEQ ID NO.9):

[0041] GCATCTGCATCTGTCTGACTCTCAGGGTGGCG;

[0042] R (SEQ ID NO.10):

[0043] AGAGTCAGACAGATGCAGATGCAGTGCGTTCAGTTTCA.

[0044] Using the recombinant plasmid pET-22b(+)-opt-hj5nagNC as a template, the QuickMutation TMThe mutation was performed using a gene site-directed mutagenesis kit. The PCR reaction parameters were: pre-denaturation at 95°C for 3 min; then denaturation at 95°C for 30 sec, annealing at 65°C for 30 sec, extension at 68°C for 7 min, 20 cycles; and incubation at 68°C for 15 min. PCR amplification obtained a linearized recombinant plasmid pET-22b(+)-d180s containing a coding gene d180s as shown in SEQ ID NO.2, and the coding gene encoded a mutant D180S, whose amino acid sequence is shown in SEQ ID NO.1

[0045] The PCR products were digested with Dpn1 enzyme at 37°C for 3 h.

[0046] The digestion product was transferred into Escherichia coli BL21 (DE3) by heat shock to obtain the recombinant expression bacteria BL21 (DE3) / d180s containing the D180S coding gene d180s.

[0047] Experimental Example 2 Preparation of recombinant wild-type β-N-acetylglucosaminidase opt-HJ5NagNC and mutant D180S

[0048] 1) Two recombinant expression bacteria containing the wild enzyme opt-HJ5NagNC and the mutant D180S encoding genes were inoculated in LB (containing 0.1% 100 mg / mL ampicillin) liquid culture medium at an inoculum size of 0.1% (v / v), and activated by shaking at 37°C and 180 rpm / min for 12 h.

[0049] 2) The activated bacterial solution in 1) was inoculated into fresh LB (containing 0.1% 100 mg / mL ampicillin) liquid culture medium at a 1% (v / v) inoculation rate, and cultured in a shaking incubator at 37°C and 180 rpm / min for about 3 h (OD600 reached 0.6-1.0), and then IPTG was added at a final concentration of 0.7 mM for induction, and cultured in a shaking incubator at 20°C and 160 rpm / min for about 20 h to induce the production of recombinant protein.

[0050] 3) Centrifuge at 4°C, 6000rpm / min for 8min to collect the cells. Suspend the cells with an appropriate amount of 0.2M McIlvaine buffer, pH=7.0, and then disrupt the cells by ultrasonic wave in a low-temperature water bath. Centrifuge the above intracellular concentrated crude enzyme solution at 4°C, 12000rpm / min for 30min, aspirate the supernatant, and use Nickel-NTA Agarose and 0-500mM imidazole for affinity and purification of the target protein, respectively. The SDS-PAGE results of the two purified proteins are as follows: Figure 1As shown in the figure, M is a protein marker; opt-HJ5NagNC is the purified wild enzyme opt-HJ5NagNC; D180S is the purified mutant D180S. The results show that both the wild enzyme opt-HJ5NagNC and the mutant D180S were purified, and the product was a single band.

[0051] 4) Prepare a dialysate (pH=7.0McIlvaine buffer) with a volume 100 times that of the protein sample, and put the purified recombinant wild enzyme opt-HJ5NagNC and mutant D180S obtained in 3) into dialysis bags respectively, leaving 3-5 cm of length at both ends of the dialysis bag to be clamped with dialysis clips. Place the dialyzed sample in the dialysis buffer and dialyze at 4°C for 6 hours, changing the dialysis solution every 2 hours for 3 times.

[0052] Experimental Example 3 Determination of properties of recombinant wild-type β-N-acetylglucosaminidase opt-HJ5NagNC and mutant D180S

[0053] The enzyme activity was determined by the pNP method: p-nitrophenyl-β-DN-acetylglucosaminide (pNP-GlcNAc) was used as a substrate to determine the activity of the recombinant wild enzyme opt-HJ5NagNC and the mutant D180S. pNP-GlcNAc was dissolved in citric acid-sodium hydrogen phosphate buffer to a final concentration of 2 mM; the substrate with a final concentration of 2 mM was preheated at the reaction temperature for 5 min, 50 μL of appropriately diluted enzyme solution was added to react for 10 min, and finally 2 mL of 1M Na2CO3 was added to terminate the reaction. After cooling to room temperature, the amount of pNP released was measured at a wavelength of 405 nm; 1 enzyme activity unit (U) is defined as: under certain conditions, the amount of enzyme required to decompose the substrate to produce 1 μmol pNP per minute. The protein mass concentration was measured using the Yazyme BCA protein quantification kit. The calculation formulas for enzyme activity (A), relative enzyme activity and specific activity are as follows:

[0054] Enzyme activity [A(U / mL)] = c*n / (t*V)

[0055] Relative activity (%) = treatment activity / control activity * 100

[0056] Relative activity (folds) = treatment activity / control activity

[0057] Specific activity

Specific activity(U / mg)

[0058] Wherein: c is the amount of p-nitrophenol released after the enzyme reaction calculated by the p-nitrophenol standard equation (μmol); n is the dilution factor of the enzyme; t is the reaction time of the enzyme and the substrate (min); V is the volume of the enzyme solution involved in the reaction (mL); C is the protein mass concentration (mg / mL).

[0059] 1) Activity determination of the recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S at different pH values

[0060] At 30°C, the buffer was 0.1M McIlvaine buffer (pH=5.0, 5.5, 6.0, 6.5, 7.0, 8.0) and 0.1M glycine–NaOH (pH=9.0), pNP-GlcNAc was used as substrate, and the reaction lasted for 10 min. The enzyme activities of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S were determined. Figure 2 The results showed that the optimum pH for both the wild enzyme opt-HJ5NagNC and the mutant D180S was 6.0, and both enzymes could maintain more than 60% of their activity at pH 5.5-7.0.

[0061] 2) Thermal activity assay of the recombinant wild-type enzyme opt-HJ5NagNC and its mutant D180S

[0062] In a buffer solution at pH 6.0, pNP-GlcNAc was used as a substrate at 0-60°C for 10 min, and the enzyme activities of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S were determined. Figure 3 The results showed that the optimum temperatures of the wild enzyme opt-HJ5NagNC and mutant D180S were 45℃ and 5℃, respectively. The wild enzyme opt-HJ5NagNC had only 2.3% enzyme activity at 0℃, while the mutant D180S still had 78.41% enzyme activity at 0℃. Compared with the recombinant wild enzyme opt-HJ5NagNC, the optimum temperature of mutant D180S dropped by 40℃.

[0063] 3) Activity determination of the recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaCl

[0064] NaCl was added to the enzymatic reaction system at final concentrations of 0.1, 0.3, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, and 3.5 M, respectively, and the enzymatic reaction was carried out at pH = 6.0 and 30° C. pNP-GlcNAc was used as a substrate, and the reaction lasted for 10 min. The activity of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S in NaCl was determined.

[0065] The activity test results of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in NaCl were obtained as follows Figure 4 As shown, a in the figure is the recombinant wild enzyme opt-HJ5NagNC, and b in the figure is the mutant D180S. The results show that when NaCl with a final concentration of 0.1-3.5M is added to the reaction system, the enzyme activity of the recombinant wild enzyme opt-HJ5NagNC decreases as the NaCl concentration increases, while the enzyme activity of the mutant D180S is significantly improved, and has the highest specific activity in the final concentration of 1.5M NaCl, with the maximum activity increased by about 234 times.

[0066] 4) Activity determination of recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaBr

[0067] NaBr with final concentrations of 0.1, 0.3, 0.5, 0.7, 1.0, 1.5, 2.0, 2.5, 3.0, and 3.5 M was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 30° C. pNP-GlcNAc was used as a substrate, and the reaction lasted for 10 min. The activity of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S in NaBr was determined.

[0068] The activity test results of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in NaBr were obtained as follows Figure 5 As shown, a in the figure is the recombinant wild enzyme opt-HJ5NagNC, and b in the figure is the mutant D180S. The results show that when NaBr with a final concentration of 0.1-3.5M is added to the reaction system, the enzyme activity of the recombinant wild enzyme opt-HJ5NagNC decreases as the NaBr concentration increases, while the enzyme activity of the mutant D180S increases, and has the highest specific activity in the final concentration of 0.5M NaBr, with the maximum activity increased by about 232 times.

[0069] 5) Activity determination of the recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaNO3

[0070] NaNO3 with a final concentration of 0.1, 0.3, 0.5, 0.7, 1.0, 1.5, 2.0, 2.5, 3.0, and 3.5 M was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 30°C. pNP-GlcNAc was used as a substrate, and the reaction lasted for 10 min. The activity of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S in NaNO3 was determined.

[0071] The activity test results of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in NaNO3 were obtained as follows Figure 6 As shown, a in the figure is the recombinant wild enzyme opt-HJ5NagNC, and b in the figure is the mutant D180S. The results show that when NaNO3 with a final concentration of 0.1-3.5M is added to the reaction system, the activity of the recombinant wild enzyme opt-HJ5NagNC decreases as the concentration of NaNO3 increases, while the enzyme activity of the mutant D180S is activated, and has the highest specific activity in the final concentration of 0.7M NaNO3, with the maximum activity increased by about 66 times.

[0072] 6) Activity determination of the recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaF

[0073] NaF with a final concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, and 0.7 M was added to the enzymatic reaction system, and the enzymatic reaction was carried out at pH = 6.0 and 30° C. pNP-GlcNAc was used as a substrate, and the reaction lasted for 10 min. The activity of the purified recombinant wild enzyme opt-HJ5NagNC and the mutant D180S in NaF was determined.

[0074] The results of the activity assay of the recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaF are shown in Figure 7 As shown, a in the figure is the recombinant wild enzyme opt-HJ5NagNC, and b in the figure is the mutant D180S. The results show that when NaF with a final concentration of 0.1-0.7M is added to the reaction system, the activity of the recombinant wild enzyme opt-HJ5NagNC shows a trend of first decreasing, then increasing, and then decreasing. 0.5M NaF makes the specific activity of opt-HJ5NagNC exceed the specific activity of the original enzyme and reach the maximum value, and then the enzyme activity gradually decreases with the increase of NaF concentration; while the enzyme activity of the mutant D180S shows a trend of first increasing to the maximum value and then decreasing, and has the highest specific activity in the final concentration of 0.4M NaF, with the maximum activity increased by about 44 times.

[0075] 7) Activity determination of recombinant wild-type enzyme opt-HJ5NagNC and mutant D180S in NaI

[0076] NaI was added to the enzymatic reaction system at a final concentration of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, and 1.0 M, respectively, and the enzymatic reaction was carried out at pH 6.0 and 30° C. pNP-GlcNAc was used as a substrate, and the reaction lasted for 10 min, and the activity of the purified recombinant wild enzyme opt-HJ5NagNC and mutant D180S in NaI was determined.

[0077] The activity test results of the recombinant wild enzyme opt-HJ5NagNC and mutant D180S in NaI were obtained as follows: Figure 8 As shown, a in the figure is the recombinant wild enzyme opt-HJ5NagNC, and b in the figure is the mutant D180S. The results show that when NaI with a final concentration of 0.1-1M is added to the reaction system, the enzyme activity of the recombinant wild enzyme opt-HJ5NagNC decreases with the increase of NaI concentration, while the enzyme activity of the mutant D180S increases, and has the highest specific activity in the final concentration of 0.3M NaI, with the maximum activity increased by about 29 times.

[0078] In summary, the salt-activated β-N-acetylglucosaminidase mutant D180S provided by the present invention has 78.41% enzyme activity at 0°C and an optimum temperature of 5°C. Compared with the wild enzyme opt-HJ5NagNC, it is more suitable for cold weather and can be applied to the biotechnology field under low temperature and salty environment requirements, especially to the food, brewing, washing, papermaking, sewage treatment and other industries. The activity of D180S can be activated by halogen salts and NaNO3, and the activation effect size is Cl - >Br - >NO3 - >F - >I - That is, in a normal reaction system, the activity of the mutant is extremely low, but after adding halogen salts or NaNO3, the enzyme specific activity of the mutant increases rapidly. This characteristic makes it possible to not only improve the efficiency of the enzymatic reaction by adding salts in practical applications, but also to control the reaction rate of the enzyme by adjusting the concentration of the added salt, which is conducive to real-time regulation of the enzymatic reaction and has significant application potential and value.

[0079] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be appreciated that the above description should not be considered as a limitation of the present invention. After reading the above content, it will be apparent to those skilled in the art that various modifications and substitutions of the present invention will occur. Therefore, the protection scope of the present invention should be limited by the appended claims.

Claims

1. A psychrophilic salt-activated β-N-acetylglucosaminidase mutant D180S, characterized in that: The amino acid sequence of the mutant D180S is shown in SEQ ID NO.

1. The mutant D180S has an enzyme activity of 78.41% at 0° C., and its activity can be activated by halogen salts and NaNO 3 .

2. The gene encoding the psychrophilic salt-activated β-N-acetylglucosaminidase mutant D180S according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO.

2.

3. A recombinant plasmid comprising the coding gene as claimed in claim 2.

4. The recombinant plasmid according to claim 3, characterized in that The recombinant plasmid is selected from pET-22b(+).

5. A recombinant bacterium comprising the coding gene as claimed in claim 2.

6. The recombinant bacterium according to claim 5, characterized in that The recombinant bacteria are selected from Escherichia coli BL21 (DE3).

7. Use of the psychrophilic salt-activated β-N-acetylglucosaminidase mutant D180S as claimed in claim 1 in the field of biotechnology under low temperature and salty environment requirements.

8. The use according to claim 7, characterized in that: The biotechnology field includes the food, washing, papermaking or sewage treatment industries.

9. The use according to claim 8, characterized in that: The food industry includes brewing.

Images