Pfr gene-based apple snail feeding deterrent and application thereof
By silencing the NPFR gene of *Pomacea canaliculata* using RNAi technology, a feeding deterrent was prepared, solving the toxicity and pollution problems associated with chemical control of *Pomacea canaliculata* and achieving efficient, economical, and environmentally friendly control.
Patent Information
- Application Number
- CN202411457055.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-10-18
- Publication Date
- 2026-03-20
- Estimated Expiration
- 2044-10-18
AI Technical Summary
Existing chemical control methods for golden apple snails suffer from limitations such as limited pesticide selection, high toxicity to non-target organisms, environmental pollution, and the risk of inducing drug resistance. There is a lack of efficient, economical, and environmentally friendly control strategies.
Using RNAi technology, dsRNA based on the NPFR gene was synthesized to silence the expression of the NPFR gene in golden apple snails, thereby preparing a feeding deterrent that inhibits feeding and growth of golden apple snails.
It effectively inhibits the feeding and growth of golden apple snails, reduces the risk of pesticide resistance, protects the ecological balance, is friendly to non-target organisms, and provides a new strategy for RNAi biopesticides.
Smart Images

Figure CN119331869B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of agricultural pest control, in particular to a Pomacea canaliculata repellent based on NPFR gene and application thereof. BACKGROUND
[0002] Pomacea canaliculata (Lamarck, 1819) belongs to Mollusca, Gastropoda, Mesogastropoda, Ampullariidae and Pomacea, and is originally from the Amazon River Basin in South America. It has been in China for 40 years, and has spread to more than 260 counties (districts) in 17 provinces (municipalities) in southern China. Due to its fast growth, high reproductive capacity, strong resistance, large appetite, varied diet, and wide adaptability, it has occurred in river channels, farmland wetlands, and shallow lakes. The Pomacea canaliculata population takes a large amount of aquatic crops and vegetables, competes for ecological niche and resources with local organisms, destroys ecological balance and biodiversity, and seriously threatens agricultural production and aquatic ecosystems. According to statistics in 2011, the area of farmland damaged by Pomacea canaliculata in China is more than 426 million square kilometers. During the population feeding period, the rice seedlings can be severely damaged and die within 1-2 days, and the aquatic crops and vegetables can be under-yield and reduced yield. The occurrence density of Pomacea canaliculata in paddy fields can be as high as 16.95 per square meter, the highest damage rate of rice can reach 64%, and the loss can be 10-40%; the damage rate of water bamboo, cibotium barometz, and Chinese violet can be as high as 10-15%, and the local field can even be more than 30%.
[0003] Previous studies have used chemical drugs, ecological engineering, pathogenic microorganisms, plant-derived ingredients, and releasing natural enemies to kill Pomacea canaliculata, but in practical application, chemical control is still mainly relied on. Although the effect of killing Pomacea canaliculata is good, there are still problems such as single type of pesticide, strong toxicity to non-target organisms, environmental pollution, and risk of inducing drug resistance. Therefore, it is urgent to seek efficient, economical, environmentally friendly, and sustainable control strategies.
[0004] The double-stranded RNA (dsRNA) composed of the sense RNA and the antisense RNA corresponding to the mRNA is introduced into cells, and the mRNA can be specifically degraded, and this highly conserved post-transcriptional gene silencing (PTGS) is called RNA interference (RNAi). RNAi has the advantages of high efficiency, rapidness, simplicity, specificity, etc., and is widely used in reverse verification of gene function, development of new pesticide targets, prevention and control of agricultural pests, etc. Microinjection, food feeding, body surface soaking, transgenic plants, virus-mediated delivery, etc. are usually used to deliver dsRNA. At present, researchers have successfully realized the systemic and specific silencing of the golden apple snail gene by microinjection, but there is no example or report of using RNAi to prevent and control the golden apple snail.
[0005] In invertebrates, after the binding of neuropeptide F (NPF) and its receptor NPFR, NPF signal transduction is activated, and numerous biological processes such as stress response, circadian rhythm, growth and reproduction, feeding metabolism, etc. are regulated. In mollusks, NPF-NPFR signal inhibits the appetite of Aplysia californica and reduces its feeding amount; on the contrary, it significantly induces the feeding of Haliotis discus hannai and Ruditapes philippinarum; and it has no obvious effect on the feeding of Lymnaea stagnalis. In golden apple snails, the physiological function and mechanism of action of NPFR are not clear. The present application first discovers the regulatory role of NPFR gene in the feeding metabolism of golden apple snails, which helps to explore molecular targets and new ways for pest control, and provides a scientific basis for the development of RNAi green pesticides and feeding regulators targeting NPFR. SUMMARY
[0006] The purpose of the present application is to provide a golden apple snail antifeedant based on NPFR gene and its application, to solve the problems existing in the prior art, to significantly reduce the expression of NPFR gene in golden apple snails by RNAi-mediated NPFR gene silencing technology, to inhibit the feeding and growth of golden apple snails, to provide technical support for reducing the ecological, social and economic losses caused by the invasion and spread of golden apple snail populations, and to avoid the "3R" hidden dangers of applying chemical molluscicides.
[0007] To achieve the above purpose, the present application provides the following solutions:
[0008] The present application provides dsRNA synthesized based on the NPFR gene of golden apple snails, which is a double-stranded RNA composed of the sense strand nucleotide sequence shown in SEQ ID NO: 2 and the antisense strand nucleotide sequence of SEQ ID NO: 2.
[0009] The application also provides a DNA molecule encoding the dsRNA.
[0010] The application also provides a primer pair for synthesizing the dsRNA, the nucleotide sequences of the primer pair are respectively shown in SEQ ID NO: 9 and SEQ ID NO: 10.
[0011] The application also provides a kit containing the primer pair.
[0012] The application also provides the application of the dsRNA or the DNA molecule or the primer pair or the kit in any of the following:
[0013] (1) the application in preventing and treating the apple snail;
[0014] (2) the application in preparing an antifeedant for preventing and treating the apple snail;
[0015] (3) the application in preparing a pharmaceutical preparation for inhibiting the feeding and growth of the apple snail.
[0016] The application also provides the application of the NPFR gene of the apple snail in any of the following:
[0017] (1) the application in preventing and treating the apple snail;
[0018] (2) the application in preparing an antifeedant for preventing and treating the apple snail;
[0019] (3) the application in preparing a pharmaceutical preparation for inhibiting the feeding and growth of the apple snail.
[0020] The gene accession number of the NPFR gene on NCBI is XM_025240645.1.
[0021] Preferably, by providing the apple snail with the dsRNA synthesized based on the NPFR gene, the expression of the NPFR gene is inhibited or silenced, and then the feeding and growth of the apple snail are inhibited; wherein the dsRNA is a double-stranded RNA composed of the sense strand nucleotide sequence shown in SEQ ID NO: 2 and the antisense strand nucleotide sequence of SEQ ID NO: 2.
[0022] The application also provides an antifeedant for inhibiting the feeding and growth of the apple snail, which contains the dsRNA.
[0023] The application also provides a method for preventing and treating the apple snail invasion, which comprises the step of providing the apple snail with the dsRNA.
[0024] Preferably, the dsRNA molecules are provided to the golden apple snails at a dosage of 8 μg per snail, and the golden apple snails are treated for 5 days to inhibit the feeding and growth of the golden apple snails, so as to achieve the purpose of preventing the golden apple snails from causing damage.
[0025] The present application discloses the following technical effects:
[0026] (1) The dsNPFR synthesized in the present application can reduce the risk of drug resistance, reduce the use of chemical pesticides, protect the ecological balance, and is environmentally friendly to non-target organisms.
[0027] (2) After the golden apple snails are injected with the dsNPFR at a dosage of 8 μg and treated for 5 days, the individual mortality is relatively high, the expression of NPFR is relatively low, and the weight gain rate and leaf feeding area are significantly reduced. In addition, the activity of digestive enzymes after silencing NPFR is also significantly reduced compared with the control.
[0028] (3) The antifeedant based on NPFR can effectively inhibit the feeding and growth of the golden apple snails, and provide a new strategy and molecular target for the research and development of RNAi biological pesticides, which has important theoretical and practical value. BRIEF DESCRIPTION OF DRAWINGS
[0029] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without creative labor.
[0030] Figure 1 Figure 1 is a purpose gene amplification electrophoresis map (A) and RNAi microinjection site schematic diagram (B); the first lane M is a standard DNA marker, and the second and third lanes are dsNPFR and dsGFP, respectively;
[0031] Figure 2 Figure 3 is the survival rate (A) and gene expression (B) of individuals after injecting dsNPFR for 1-7 days; * indicates a significant difference from the control, p<0.05;
[0032] Figure 3 Figure 4 is the effect of dsRNA injection on the feeding behavior of golden apple snails (2h after the snails were put in);
[0033] Figure 4 Figure 5 is the effect of dsNPFR treatment on the leaf feeding area (8h after the snails were put in) (A) and weight gain rate (B); * indicates a significant difference from the control, p<0.05;
[0034] Figure 5Effect of treatment with dsNPFR on digestive enzyme activity; * indicates significant difference from control, p < 0.05. DETAILED DESCRIPTION
[0035] Various exemplary embodiments of the present application will now be described in detail, with reference to the figures. The detailed description is merely intended to teach a person of ordinary skill in the art how to make and use the present application and is not intended to limit the scope of the application. The detailed description includes specific details for the purpose of providing a thorough understanding of the present application. However, it will be apparent to those skilled in the art that the present application can be practiced without these specific details. In some instances, well-known structures and functions have not been described in detail in order to avoid obscuring the concept of the present application.
[0036] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of a parameter, unless otherwise indicated, each intervening value by each intervening value, as well as any other stated or intervening value in that stated range is encompassed. In addition, any combination of the above ranges, as well as any other stated or intervening value in that stated range, is encompassed. All ranges are inclusive of the endpoints.
[0037] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although preferred methods and materials are described, any methods and materials similar or equivalent to those described herein can be used in the practice of the present application. All documents mentioned herein are incorporated by reference to disclose and describe the methods and / or materials in connection with which the documents are cited. In case of conflict between the present specification and any document incorporated by reference, the present specification will control.
[0038] Various modifications and changes can be made to the specific embodiments of the present application described herein without departing from the scope or spirit of the application. Other embodiments of the application will be apparent to those of ordinary skill in the art from the description and examples presented herein. The description and examples are illustrative of the application and are not intended to limit the scope of the application.
[0039] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean including, but not limited to.
[0040] Example 1
[0041] 1. Primer design
[0042] The green fluorescent protein gene (GFP, GenBank: MN443913.1) of jellyfish and the full-length sequence of the NPFR gene of Pomacea canaliculata (GenBank: XM_025240645.1) were obtained from the National Center of Biotechnology Information database. The CDS regions were 1-723 and 427-1908, respectively. Specific primers were designed using the NCBI Pick Primers function, which met the following requirements: ① the length of the primers was 17-25 bases; ② the GC content was 40-60%; ③ the Tm values of the two primers were close; ④ the 3' terminal base avoided being T, and the two primers or the internal sequences avoided having more than 3 complementary sequences; and ⑤ the length of the primers for qRT-PCR was 80-200 bp. The design results are shown in Table 1.
[0043] Table 1 Primer information
[0044]
[0045] In the above table, the lower case letters in the dsRNA synthesis primers represent the T7 promoter sequence, β-actin is the qRT-PCR internal reference, and GFP is the control.
[0046] 2. Interference system construction
[0047] 2.1 RNA extraction
[0048] Pomacea canaliculata with strong vitality and uniform size (body weight 4.5 ± 0.3 g, shell height 15-25 mm) were selected, and the SV Total Isolation System Kit with genomic DNA (gDNA) Eraser (Promega, Madison, United States) kit was used to extract total RNA.
[0049] 2.2 cDNA reverse transcription
[0050] The RNA concentration and purity were analyzed using Nanodrop 2000, and samples with OD values (A260 / 280) of 1.8-2.0 were used for reverse transcription. The integrity of the RNA was verified by 1.5% agarose gel electrophoresis. The PrimeScript TM 1st strand cDNA Synthesis Kit (TaKaRa, Tokyo, Japan) kit was used to synthesize the first strand cDNA.
[0051] 2.3 dsRNA synthesis
[0052] T7 RiboMAX TMExpressRNAi System (Promega, Madison, USA) kit, combined with the primers in Table 1, respectively amplified the sense strand ssRNA and the antisense strand ssRNA in PCR instrument (Applied Biosystems, Thermo Fisher Scientific), and finally synthesized dsGFP / dsNPFR through annealing reaction, with the length of 431 bp and 362 bp respectively (see Figure 1 A) in the middle.
[0053] The sense strand of dsGFP is as follows (SEQ ID NO: 1):
[0054] gcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtg.
[0055] The antisense strand of dsGFP is the reverse complement of the sense strand.
[0056] The sense strand of dsNPFR is as follows (SEQ ID NO: 2):
[0057] ttcaacctcctcagcgaattccatctgcagctctttagttccgcggccatcaacaagacagcaggtgaagaacacgtcctggaggggtcagtcaacatcaacctcgcctacgccatctgtcatctgctggttctctgttcagcctgcgtcaacccggtggtctacgggtggttcaacgaca acttcaaggtggagttcctgaagatcctggtctgtccttgctgcacccagctcaaggtggccattaagaggattctgtgttgcaagcgaagcaagccggaagtgccatcgatcacgctaaccaaagcgtccaatggaaacgggtcttacggagctgttggacattgtgatgaaggtgacgg.
[0058] The antisense chain of dsNPFR is the reverse complementary chain of its justice chain.
[0059] 3. Silent parameter filtering
[0060] Anesthetize golden apple snails (weighing 4.5±0.3g, shell height 15-25mm) on ice for 10-15 minutes. Gently pull open the operculum and inject dsGFP / dsNPFR (2-8μg / snail) into the foot muscle using a microsyringe (Hamilton 701RN). Leave the needle in place for 5-10 seconds and then withdraw it (see...). Figure 1 (See Figure B). Samples were taken at 1, 3, 5, and 7 days after treatment. NPFR gene expression was analyzed using quantitative real-time qRT-PCR, and survival rate was observed and recorded. Considering both the highest gene knockout efficiency and the lowest survival rate, the optimal injection concentration and treatment time were selected as 8 μg / 5 days (NPFR expression decreased by 72.8%, corrected survival rate 64.0%), with the next best being 8 μg / 3 days (NPFR expression decreased by 78.9%, corrected survival rate 74.0%) (see Figure B). Figure 2 ).
[0061] 4. Evaluation of application effectiveness
[0062] Five days after the injection of 8 μg dsNPFR, the following experiment was performed:
[0063] ① Samples were collected and dissected, and the activity of intestinal digestive enzymes was measured using a kit produced by Nanjing Jiancheng Biotechnology Institute.
[0064] ② Put the same amount of lettuce leaves and snails into the water tank, observe the behavior after 2h, and collect the leaves after 8h. The LeafByte software (version 1.3.0) is used to analyze the area of the round leaves that are eaten.
[0065] ③ Provide sufficient amount of lettuce leaves for the growth and development of snails. After 30 days, collect the snail samples in the control and treatment groups, weigh them using an electronic balance (accurate to 0.1 mg), and calculate the weight growth rate (WGR). The formula is as follows:
[0066] WGR (%) = (W2-W1) / W1x100;
[0067] In the formula, W1 and W2 are the initial weight and final weight of each snail, respectively.
[0068] The results show that, compared with the control dsGFP, the foraging and feeding activities of the silencing treatment group are hindered (see Figure 3 ); the food intake and weight growth rate are significantly reduced by 66.8% and 68.3%, respectively (see Figure 4 ); the activities of α-amylase, cellulase, protease and lipase are significantly reduced by 52.2%, 46.8%, 52.4% and 63.4%, respectively (see Figure 5 ). Combined with the screening results in the above "3. Silencing parameter screening", the optimal concentration of dsNPFR is 8μg, and the treatment time is 5 days, which can achieve the effect of inhibiting feeding metabolism and growth and development.
[0069] The above-described embodiments are only preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.
Claims
1. A dsRNA synthesized based on the NPFR gene of *Pomacea canaliculata*, characterized in that, The dsRNA is a double-stranded RNA composed of the sense strand nucleotide sequence shown in SEQ ID NO:2 and the antisense strand nucleotide sequence shown in SEQ ID NO:
2.
2. A DNA molecule encoding the dsRNA of claim 1.
3. A primer pair for synthesizing the dsRNA of claim 1, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO: 9 and SEQ ID NO: 10, respectively.
4. A kit containing the primer pair as described in claim 3.
5. The use of the dsRNA according to claim 1 in any of the following: (1) Application in the prevention and control of golden apple snails; (2) Application in the preparation of antifeedant for the prevention and control of golden apple snails; (3) Application in the preparation of pharmaceutical formulations that inhibit the feeding and growth of golden apple snails.
6. A feeding deterrent against golden apple snails based on the NPFR gene, characterized in that, It contains the dsRNA as described in claim 1.
7. A method for preventing and controlling infestations of golden apple snails, characterized in that, Includes the step of providing the golden apple snail with the dsRNA as described in claim 1.
8. The method as described in claim 7, characterized in that, The dsRNA molecule was administered to each golden apple snail at a dosage of 8 μg for 5 days to inhibit feeding and growth, thereby achieving the purpose of preventing golden apple snail infestation.
Citation Information
Patent Citations
Asiatic corn borer NPFR protein, related biological material and application thereof
CN113527457A
AU7134787A