Visual detection method for Tomato leaf curl New Delhi virus

By combining RAA isothermal amplification and CRISPR/Cas12a detection technology, the convenient, efficient and low-cost detection of the New Delhi Tomato Leaf Virus has been achieved, solving the problems of complex and high detection in the existing technology, and it has the application prospects of field field detection.

CN119332029BActive Publication Date: 2025-06-27ZHEJIANG UNIV

Patent Information

Application Number
CN202411894548.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-20
Publication Date
2025-06-27
Estimated Expiration
2044-12-20

AI Technical Summary

Technical Problem

The existing technology is difficult to achieve convenient, efficient and low-cost New Delhi Tomato Leaf Virus (ToLCNDV) detection, especially in field detection, where instrument dependence and complex operation problems exist.

Method used

Using a visual detection method based on RAA-CRISPR/Cas12a, the genomic DNA of plant samples is amplified by RAA isothermal, and the product is added to the CRISPR/Cas12a detection system, and the specific crRNA and fluorescent probe are used for detection, and finally the fluorescence signal detection results are interpreted.

Benefits of technology

It realizes fast, sensitive and convenient ToLCNDV detection, reduces the cost requirements for expensive instruments and operators, and can conduct direct inspections in the field.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119332029B_ABST
    Figure CN119332029B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for visual detection of Tomato leaf curl New Delhi virus, belonging to the plant virus detection technology in the field of biotechnology. First, the genomic DNA extracted from the plant sample to be detected is added to the RAA reaction system containing RAA primers and subjected to isothermal amplification; then the isothermal amplification product is added to the CRISPR / Cas12a detection system containing specific crRNA and ssDNA fluorescent probes for reaction; finally, the fluorescence signal of the reaction product is detected. If the fluorescence signal is positive, it indicates that Tomato leaf curl New Delhi virus is detected in the plant sample, otherwise it indicates that the virus is not detected. The present invention has the advantages of good specificity, short detection time, high sensitivity, and does not rely on expensive instruments, etc., and can accurately detect through instruments or directly make a preliminary judgment of the results in the field with limited conditions.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the method for detecting plant viruses in the field of biotechnology, and particularly relates to a method for detecting tomato leaf curl New Delhi virus in plant leaf samples based on RAA-CRISPR / Cas12a visualization technology. Background Art

[0002] Plant viruses are known as "plant cancers". Due to their wide variety, extensive distribution, and the lack of effective control methods, they have caused incalculable huge losses to the yield and quality of global crops. Establishing a convenient and efficient virus detection method is of great significance for curbing the spread of viruses, stabilizing the production quality of crops, and reducing the economic losses caused by viruses. The commonly used virus detection methods can be roughly divided into four types: biological detection method, electron microscope detection method, serological detection method, and molecular biological detection method. Although the biological detection method and the electron microscope detection method are intuitive, they have great limitations, require a long detection time and have large uncertainties, so they are not the mainstream detection methods at present. The serological technology depends on the quality of antibodies, has relatively low detection sensitivity, and is prone to false negatives. Common molecular biological technologies are generally conventional PCR and fluorescence quantitative PCR detection methods, which require expensive instruments such as PCR machines and gel imaging systems, have high requirements for instruments and technical personnel, and are difficult to achieve on-site detection in the field.

[0003] Tomato leaf curl New Delhi virus (ToLCNDV) infects important crops such as Solanaceae and Cucurbitaceae and is widely distributed worldwide. The main symptoms include leaf curling, internode shortening, and plant dwarfing, which seriously affect the growth of crops. In recent years, ToLCNDV has appeared in different regions, causing significant economic losses to the production of crops such as melons and tomatoes, and seriously threatening the planting safety of Cucurbitaceae and Solanaceae crops. Since the current prevention and control measures for virus diseases are limited, it is particularly important to strengthen the early warning and monitoring of ToLCNDV and establish a convenient detection method.

[0004] Since 1990, dozens of isothermal amplification techniques with different amplification mechanisms have been developed, including loop-mediated isothermal amplification (LAMP), rolling circle amplification (RCA), recombinase-mediated isothermal amplification (RPA / RAA), etc. Both RPA (recombinase polymerase amplification) and RAA (recombinase aided amplification) are techniques that use recombinase, single-stranded DNA-binding protein, and DNA polymerase to act together to rapidly amplify nucleic acids at a constant temperature. The difference between the two lies in the source of the recombinase. The recombinase used in RPA is derived from T4 phage, while that of RAA is from bacteria or fungi. Compared with traditional PCR techniques, isothermal amplification techniques can greatly reduce the dependence on instruments, simplify the detection steps and time, but there are also limitations such as non-specific amplification, aerosol contamination, and false positives. In recent years, the gene editing tool CRISPR / Cas system has been increasingly used in the field of nucleic acid detection. CRISPR / Cas12a can recognize a specific PAM sequence of several nucleotides and, under the guidance of crRNA, cleave double-stranded target DNA. After cleaving the target double-stranded DNA, its activity to cleave non-specific single-stranded DNA is activated. Due to its specific cleavage activity, some people have begun to combine isothermal amplification techniques with gene editing tools. For example, researchers developed a visualization detection technique by coupling LAMP with CRISPR / Cas12a. However, this technique still requires extracting the DNA of the sample in the laboratory and needs endpoint PCR or real-time fluorescence LAMP to determine the final result, and cannot completely break away from the limitations of the laboratory. Summary of the Invention

[0005] The object of the present invention is to overcome the deficiencies in the prior art and provide a visualization detection method for Tomato leaf curl New Delhi virus. This method is rapid, sensitive, and convenient, can complete the detection without complex operations and expensive instruments, has low requirements for operators, the environment, and instrument costs, and has the application prospect of on-site rapid detection.

[0006] To solve the technical problems, the specific technical solutions adopted by the present invention are as follows:

[0007] A method for visual detection of Tomato leaf curl New Delhi virus, which specifically includes the following steps: First, add the genomic DNA extracted from the plant sample to be detected into the RAA reaction system containing RAA primers and perform isothermal amplification; then add the isothermal amplification product into the CRISPR / Cas12a detection system containing specific crRNA and ssDNA fluorescent probe for reaction; finally, detect the fluorescence signal of the reaction product. If the fluorescence signal is positive, it indicates that Tomato leaf curl New Delhi virus is detected in the plant sample, otherwise it indicates that Tomato leaf curl New Delhi virus is not detected; the RAA primers include a forward primer and a reverse primer, the nucleic acid sequence of the forward primer is as shown in SEQ ID NO.1, and the nucleic acid sequence of the reverse primer is as shown in SEQ ID NO.2; the sequence of the specific crRNA is as shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe is 5’-FAM-CCCCCCC-BHQI-3’.

[0008] Based on the above technical solutions, the present invention can further provide one or more of the following preferred solutions. And if there is no conflict, the technical features in the following preferred solutions can be combined with each other.

[0009] As a preferred solution of the present invention, the extraction buffer used for extracting genomic DNA from the plant sample to be detected is an extraction buffer containing PEG and NaOH.

[0010] As a preferred solution of the present invention, the plant sample to be detected is the leaf tissue of the plant to be detected.

[0011] As a preferred solution of the present invention, the RAA reaction system is configured using an RAA nucleic acid amplification kit, and its composition includes: reaction dry powder, A Buffer, the forward primer, the reverse primer, the genomic DNA, B Buffer and RNase-free water.

[0012] As a preferred solution of the present invention, the method for adding the genomic DNA into the RAA reaction system containing RAA primers for isothermal amplification is as follows: First, configure a mixed solution containing RNase-free water, A Buffer, the forward primer, and the reverse primer according to the RAA reaction system, and add the mixed solution into the detection unit tube containing the reaction dry powder; then add the genomic DNA into the detection unit tube, then add the B Buffer, close the tube cap and mix well, and perform isothermal amplification by incubating at a constant temperature after centrifuging the mixture to the bottom of the tube to obtain an isothermal amplification product.

[0013] As a preferred embodiment of the present invention, the components of the CRISPR / Cas12a detection system include: isothermal amplification products, Cas12a protein, the specific crRNA, reaction buffer, the ssDNA fluorescent probe, and RNase-free water.

[0014] As a preferred embodiment of the present invention, the method for detecting the fluorescence signal of the reaction product is as follows: using an instrument with a fluorescence acquisition system, the fluorescence signal intensity of the CRISPR / Cas12a detection system after the reaction is completed is collected in real time. When the fluorescence signal is enhanced relative to the initial fluorescence signal, it indicates that the plant sample to be detected contains Tomato leaf curl New Delhi virus, otherwise it indicates that the plant sample to be detected does not contain Tomato leaf curl New Delhi virus.

[0015] Furthermore, the instrument with a fluorescence acquisition system is a real-time fluorescence quantitative PCR instrument.

[0016] Furthermore, the duration of the real-time collection of the fluorescence signal intensity is not less than 1 hour, and the interval does not exceed 1 minute.

[0017] As a preferred embodiment of the present invention, the method for detecting the fluorescence signal of the reaction product is as follows: irradiating the CRISPR / Cas12a detection system after the reaction is completed with an ultraviolet flashlight, and visually observing the fluorescence signal; when green fluorescence is observed, it indicates that the plant sample to be detected contains Tomato leaf curl New Delhi virus, otherwise it indicates that the plant sample to be detected does not contain Tomato leaf curl New Delhi virus.

[0018] The beneficial effects of the present invention compared with the prior art are as follows:

[0019] 1. Good specificity: The present invention combines RAA primer amplification and CRISPR / Cas12a detection system, both steps have detection specificity, ensuring the accuracy and reliability of the ToLCNDV detection result;

[0020] 2. Short detection time: In the present invention, it only takes about 5 minutes to extract the DNA of the crude plant leaf sample, the RAA reaction time only takes 25 minutes, and the CRISPR / Cas12a cleavage reaction only takes 20 minutes, which is shorter than the time required for conventional genomic extraction and PCR.

[0021] 3. High sensitivity: The present invention has a very high detection sensitivity for ToLCNDV, and ToLCNDV can still be detected after the genomic crude extract is diluted to 10 -9 times.

[0022] 4. No need to rely on expensive equipment: This detection method only needs to react under constant temperature conditions throughout the process, and the results can be directly judged by a UV flashlight. It is simple to operate and does not rely on expensive real-time fluorescence quantitative PCR instruments or ordinary PCR instruments. It can also be carried out in the field under limited conditions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a flow chart of the visual detection method of ToLCNDV;

[0024] Figure 2 This is a schematic diagram of the principle of the visual detection method of ToLCNDV;

[0025] Figure 3 This is a schematic diagram of the results of visually interpreting the reaction tubes of different field samples under ultraviolet irradiation;

[0026] Figure 4 The sensitivity results of the RAA-CRISPR / Cas12a method for detecting ToLCNDV in crude extracts of plant leaves; A is the result of naked eye judgment; B is a bar graph of the sensitivity fluorescence values ​​of the RAA-CRISPR / Cas12a method for detecting ToLCNDV in crude extracts of plant leaves. DETAILED DESCRIPTION

[0027] In order to make the above-mentioned purpose, features and advantages of the present invention more obvious and easy to understand, the specific implementation mode of the present invention is described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below. The technical features in each embodiment of the present invention can be combined accordingly without conflicting with each other.

[0028] like Figure 1 As shown, the present invention provides a visual detection method for New Delhi Tomato Leaf Curl Virus (ToLCNDV), and the specific method is: first, adding genomic DNA extracted from a plant sample to be detected to an RAA reaction system containing RAA primers and performing isothermal amplification; then adding the isothermal amplification product to a CRISPR / Cas12a detection system containing specific crRNA and an ssDNA fluorescent probe with a fluorescent group for reaction; finally, performing fluorescence signal detection on the reaction product, if the fluorescence signal is positive, it indicates that ToLCNDV is detected in the plant sample, otherwise it indicates that ToLCNDV is not detected.

[0029] In the above visualization detection method of the present invention, the principle of realizing the visualization detection of ToLCNDV can be described as follows: The CRISPR / Cas12a protein is a nuclease that can target and cleave double-stranded DNA under the guidance of single-stranded RNA and activate the non-specific cleavage activity against single-stranded DNA; based on this principle, any single-stranded fluorescent-labeled probe is added to the system. After the Cas12a protein cleaves the target sequence, the trans-cleavage activity is activated, and a fluorescent signal can be detected. Otherwise, there is no fluorescent signal, which allows the detection results of the CRISPR / Cas system to be visually seen by the naked eye. Combining this technology with the isothermal amplification technology can greatly increase the sensitivity of the detection method and double-guarantee the specificity of the detection results. Therefore, the principle of the above detection method can be referred to Figure 2 , for virus-containing samples, a fluorescent signal can finally be detected, while for virus-free samples, no fluorescent signal can be detected.

[0030] In the above visualization detection method of the present invention, the plant sample to be detected can be various tissues of the plant to be detected, such as roots, stems, and leaves, and preferably leaf tissues.

[0031] In the embodiments of the present invention, the sources of the biological materials used are as follows:

[0032] The forward primer CP-F and the reverse primer CP-R in the RAA primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd.; the ssDNA fluorescent probe with a fluorescent group and the specific crRNA were both synthesized by Shanghai Sangon Biotech Co., Ltd.; the RAA nucleic acid amplification kit (S001ZC) required for constructing the RAA reaction system was purchased from Shanghai Hangzhou Zhongce Biotechnology Co., Ltd.; the Cas12a required for constructing the CRISPR / Cas12a detection system was purchased from Gene Biotechnology International Trade (Shanghai) Co., Ltd.

[0033] In the embodiments of the present invention, several nucleotide sequences used are as follows:

[0034] The nucleic acid sequence of the forward primer CP-F is as shown in SEQ ID NO.1, and the specific sequence is: ATCATTTCAACGCCCGCATCGAAAGTACGCCGA.

[0035] The nucleic acid sequence of the reverse primer CP-R is as shown in SEQ ID NO.2, and the specific sequence is: TCGTGCCTAGATTCAAAGGACTGCACCTTACAA.

[0036] The nucleic acid sequence of the specific crRNA is as shown in SEQ ID NO.3, and the specific sequence is: UAAUUUCUACUAAGUGUAGAUUGUUCAUCGGCCUGUUGGUC.

[0037] In the nucleic acid sequence of the ssDNA fluorescent probe with a fluorescent group, the 5'-end is attached with a fluorescent reporter group (FAM), and the 3'-end is attached with a quencher BHQI. The specific sequence is: 5’-FAM-CCCCCCC-BHQI-3’.

[0038] In the present invention, the RAA primers and crRNAs used are designed for specific detection purposes and are the key of the present invention. Specifically, the above-mentioned RAA primers and crRNAs are designed according to the conserved fragment in the ToLCNDV coat protein gene. The nucleic acid sequence of this conserved fragment is shown in SEQ ID NO.4, and the specific sequence is:

[0039] CGATGAACAGAAAACCCAGAATGTACAGAATGTATAGAAGTCCCGACGTGCCAAGGGGCTGTGAAGGACCTTGTAAGGTGCAGTCCTTTGAATCTAGGCACGATGTCTCTCATATTGGCAAAGTCATGTGTGTTAGTGATGTTACCCGAGGAACTGGACTCACACATCGCGTAGGGAAGCGATTCTGTGTGAAATCCGTCTATGTGCTGGGAAAGATATGGATGGATGAA.

[0040] In addition, in the embodiments of the present invention, when the above-mentioned visual detection method is specifically implemented, the RAA reaction system used can be configured using an RAA nucleic acid amplification kit. Its composition includes: reaction dry powder, A Buffer, the above-mentioned forward primer, the above-mentioned reverse primer, the above-mentioned genomic DNA, B Buffer, and RNase-free water.

[0041] In addition, when the above-mentioned visual detection method specifically configures the RAA reaction system and performs isothermal amplification, the specific operations can be carried out according to the instruction manual of the RAA nucleic acid amplification kit. In the embodiments of the present invention, the method of adding the above-mentioned genomic DNA to the RAA reaction system containing RAA primers for isothermal amplification can be carried out according to the following process: First, configure a mixed solution containing RNase-free water, A Buffer, the above-mentioned forward primer, and the above-mentioned reverse primer according to the above-mentioned RAA reaction system, and add the mixed solution to the detection unit tube containing the above-mentioned reaction dry powder; then add the above-mentioned genomic DNA to the detection unit tube, then add the above-mentioned B Buffer, close the tube cap and mix well. After centrifugation to make the mixture centrifuged to the bottom of the tube, incubate at a constant temperature for isothermal amplification to obtain an isothermal amplification product. The specific reaction conditions can be designed and optimized with reference to the prior art.

[0042] In addition, in the embodiments of the present invention, when the above-mentioned visualization detection method is specifically implemented, the components of the CRISPR / Cas12a detection system used include: isothermal amplification products, Cas12a protein, the above-mentioned specific crRNA, reaction buffer, the above-mentioned ssDNA fluorescent probe, and RNase-free water. Specific reaction conditions can be designed and optimized with reference to the prior art.

[0043] It should be noted that when the present invention specifically detects the fluorescence signal of the reaction product, different detection methods can be designed according to the scenario.

[0044] In a laboratory or other conditional detection scenario, the method for detecting the fluorescence signal of the reaction product can be carried out as follows: Use an instrument with a fluorescence acquisition system to collect the fluorescence signal intensity of the CRISPR / Cas12a detection system at the end of the reaction in real time. When the fluorescence signal increases relative to the initial fluorescence signal, it indicates that the plant sample to be detected contains Tomato leaf curl New Delhi virus, otherwise it indicates that the plant sample to be detected does not contain Tomato leaf curl New Delhi virus. The above-mentioned instrument with a fluorescence acquisition system is a real-time fluorescence quantitative PCR instrument, such as Biorad CFX Opus 96. Generally speaking, the duration of real-time collection of fluorescence signal intensity is preferably not less than 1 hour, and the interval is preferably not more than 1 minute to fully determine the fluorescence reaction result.

[0045] In addition, when conducting on-site determination in the field, the method for detecting the fluorescence signal of the reaction product can be carried out as follows: Use an ultraviolet flashlight to irradiate the CRISPR / Cas12a detection system at the end of the reaction, and visually observe the fluorescence signal; when green fluorescence is observed, it indicates that the plant sample to be detected contains Tomato leaf curl New Delhi virus, otherwise it indicates that the plant sample to be detected does not contain Tomato leaf curl New Delhi virus.

[0046] Next, the technical effects of the present invention are demonstrated through multiple embodiments. In the following embodiments, unless otherwise specified, the reagents and materials used can all be commercially available products. In the following embodiments, where specific conditions are not indicated, specific experiments can be carried out according to the conventional methods and conditions in the art, or in accordance with the product instructions.

[0047] Example 1 Visualization Detection of ToLCNDV

[0048] 1. Design and synthesis of specific RAA primers and crRNA for detecting ToLCNDV in the crude extract of plant leaf genomes based on the RAA-CRISPR / Cas12a technology

[0049] (1)Synthesis of RAA primers: Download the CP gene sequences of different isolates of ToLCNDV from the NCBI website, align them using the Mega-X software, search for the conserved nucleotide sequence of the CP gene of ToLCNDV, select a specific fragment of about 230 bp in length as the target sequence, and its sequence is shown in SEQ ID NO.4. According to the target sequence, design and synthesize the corresponding RAA primers. The forward primer and reverse primer in the RAA primers are named CP-F and CP-R respectively, and their nucleotide sequences are shown in SEQ ID NO.1 and SEQ ID NO.2 respectively. In this example, the CP-F and CP-R primers were synthesized by biological companies such as Beijing Tsingke Biotechnology Co., Ltd.

[0050] (2)Design and synthesis of crRNA: Using the conserved nucleotide sequence of the CP gene of ToLCNDV screened above as the target, select the 20 bp sequence after TTTN in the highly conserved region, analyze the sequence specificity through BLASTn comparison in the NCBI database, and evaluate the efficiency of crRNA through the online website (https: / / ezassay.com / primer), and select the sequence with the best specificity and the highest efficiency. The nucleic acid sequence of the finally obtained specific crRNA is shown in SEQ ID NO.3.

[0051] 2. Method for detecting ToLCNDV in crude extracts of plant leaf genomes based on the RAA-CRISPR / Cas12a technology

[0052] See Figure 1 As shown, this example provides a method for detecting ToLCNDV in crude extracts of plant leaf genomes based on the RAA-CRISPR / Cas12a technology, including the following steps:

[0053] (1)Crude extraction of genomic DNA from the sample to be tested: Prepare an extraction buffer containing 6% PEG and 20 mM NaOH, and filter the extraction buffer with a 0.45 μm bacterial filter; Use a 1.5 ml centrifuge tube cap to cut out a piece of plant leaf of the same size as the cap as the plant sample to be tested, add 50 μl of the extraction buffer, immerse the leaf, and grind the leaf tissue with tools such as a grinding rod, and incubate at room temperature for 3 - 5 min.

[0054] In this example, the plant samples to be tested were collected from Shanghai, Zhejiang and other places, and the detailed information is shown in Table 1.

[0055] (2)Establish the RAA-CRISPR / Cas12a reaction system: In this system, it is necessary to use the pre-designed RAA primers CP-F and CP-R to configure the RAA reaction system in the reaction tube, and add the extracted genomic DNA into the RAA reaction system containing the RAA primers for isothermal amplification in the reaction tube. Add the isothermal amplification fragment into the CRISPR / Cas12a detection system containing the corresponding crRNA and ssDNA fluorescent probe for reaction. The binary complex formed by crRNA and Cas12a specifically recognizes the target dsDNA in the amplification product, thereby activating the fluorescent probe in the Cas12a non-specific cleavage reaction system.

[0056] As described above, the above RAA primers include CP-F and CP-R. The nucleic acid sequence of CP-F is shown in SEQ ID NO.1, and the nucleic acid sequence of CP-R is shown in SEQ ID NO.2; the sequence of the specific crRNA is shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe with a fluorescent group is 5’-FAM-CCCCCCC-BHQI-3’. These RAA primers and crRNA are designed according to the conserved fragment shown in SEQ ID NO.4 in the ToLCNDV coat protein gene.

[0057] In this example, the RAA isothermal amplification reaction conditions are 37 °C for 25 min. The RAA reaction system is configured using the RAA nucleic acid amplification kit (S001ZC, Hangzhou Zhongce Biotechnology Co., Ltd.). Its composition includes 1 tube of reaction dry powder, 25 μl of A Buffer, 2 μl of forward primer CP-F (10 μM), 2 μl of reverse primer CP-R (10 μM), 5 μl of genomic DNA sample, and 2.5 μl of B Buffer. Finally, the system is made up to 50 μl with RNase-free water. The specific operation steps for configuring this RAA reaction system and performing the isothermal amplification reaction are as follows:

[0058] (2.1)According to the number of reactions, prepare a mixed solution containing RNase-free water, A Buffer, forward primer CP-F (shown in SEQ ID NO.1), and reverse primer CP-R (shown in SEQ ID NO.2) according to the composition amounts in the above RAA reaction system. After mixing evenly, add it to the detection unit tube containing the reaction dry powder;

[0059] (2.2)According to the composition amounts in the above RAA reaction system, add the genomic DNA sample extracted from the plant sample to be detected into the detection unit tube;

[0060] (2.3) According to the composition amounts in the above RAA reaction system, add 2.5 μl of B Buffer to the lid of the detection unit tube, cover the tube lid, and invert it several times up and down to fully mix the components in the RAA reaction system. Then, centrifuge at low speed so that the mixed solution is centrifuged to the bottom of the centrifuge tube;

[0061] (2.4) Place the centrifuge tube in a 37°C constant temperature metal bath (or water bath) and incubate for 25 min to achieve isothermal amplification reaction;

[0062] (2.5) After the isothermal amplification reaction ends, the obtained isothermal amplification product can be directly used for the next CRISPR / Cas12a system reaction.

[0063] In this example, the reaction conditions of the CRISPR / Cas12a system are 37°C and 30 min. The reaction system includes: 2 μl of isothermal amplification product, 100 nM Cas12a protein, 100 nM crRNA (as shown in SEQ ID NO.3), 2 μl of NEBuffer2.1 buffer, and 2 μM ssDNA fluorescent probe (sequence 5’-FAM-CCCCCCC-BHQI-3’), and make up to 20 μl with RNase-free water. During the reaction process, the binary complex formed by crRNA and Cas12a specifically recognizes the target dsDNA in the amplification product, and then activates the fluorescent probe in the Cas12a non-specific cleavage reaction system.

[0064] (3) Result interpretation: Detect the fluorescence signal of the reaction product of RAA-CRISPR / Cas12a. If the fluorescence signal is positive, it indicates that ToLCNDV is detected in the plant sample. Otherwise, it indicates that ToLCNDV is not detected. In this example, directly irradiate the CRISPR / Cas12a detection system after the reaction with an ultraviolet flashlight in the field, and visually observe the fluorescence signal with the naked eye; when green fluorescence is observed, it indicates that the plant sample to be detected contains ToLCNDV, otherwise it indicates that the plant sample to be detected does not contain ToLCNDV.

[0065] The visualization result of this example is as Figure 3As shown, the reaction product of RAA-CRISPR / Cas12a was irradiated with an ultraviolet flashlight. The detection results are shown in Table 1. Among the 126 field melon samples, the samples starting with SH and ZJ were collected from two different places, Shanghai and Zhejiang respectively. Obvious green fluorescence could be observed in the reaction tubes of SHHG-1, SHXG-1, SHXG-2, SHXG-3, SHXG-4, SHXG-5, SHXG-6, SHXG-7, ZJHG-1, ZJHG-2, ZJHG-3, ZJHG-4, ZJHG-5, ZJHG-6, ZJHG-6, ZJHG-7, ZJHG-8, ZJHG-9, ZJWWG-1, indicating the presence of ToLCNDV in the samples. However, no green fluorescence was observed in the reaction tubes of SHCK1, SHCK2, SHCK3, FJCK-1, FJCK-2, FJCK-3, FJCK-4 and FJCK-5, indicating the absence of ToLCNDV in the samples. The above detection results are completely consistent with the results of PCR detection of 26 field melon samples after genomic extraction using a DNA kit.

[0066] Table 1 Information of field samples detected by RAA-CRISPR / Cas12a

[0067] Sample Number Host Plant Test Result SHHG-1 Cucumber + SHXG-1 Watermelon + SHXG-2 Watermelon + SHXG-3 Watermelon + SHXG-4 Watermelon + SHXG-5 Watermelon + SHXG-6 Watermelon + SHXG-7 Watermelon + SHCK-1 Cucumber - SHCK-2 Pumpkin - SHCK-3 Cucumber - ZJHG-1 Cucumber + ZJHG-2 Cucumber + ZJHG-3 Cucumber + ZJHG-4 Cucumber + ZJHG-5 Cucumber + ZJHG-6 Cucumber + ZJHG-7 Cucumber + ZJHG-8 Cucumber + ZJHG-9 Cucumber + ZJWWG-1 Honeydew Melon + ZJCK-1 Watermelon - ZJCK-2 Watermelon - ZJCK-3 Watermelon - ZJCK-4 Watermelon - ZJCK-5 Watermelon -

[0068] In the table: "+" and "-" represent positive and negative detection results respectively.

[0069] Example 2. Sensitivity evaluation of the visual detection method for ToLCNDV

[0070] In this example, the sensitivity of the ToLNDV detection method demonstrated in Example 1 above was evaluated. The specific steps are as follows:

[0071] (1) Using the kit Ultra-Universal TOPO Cloning Kit (C603) from Vazyme, the RAA amplification fragment of ToLCNDV was constructed onto the pCE3 vector as a positive plasmid. The specific operation was as follows: Add 2 μl of 5×Ultra-Universal TOPO Cloning Mix, 1 μl of RAA amplification purified product and 7 μl of ddH2O into the reaction tube, and react at 25 °C for 30 min in a PCR instrument to ligate the vector and the amplification fragment. After the reaction, add the ligation product into 100 μl of DH5α chemically competent cells, perform heat shock transformation at 42 °C, plate, screen plaques and sequence, and then extract the positive plasmid.

[0072] (2) Dilute the positive plasmid of the ToLCNDV CP fragment 10-fold successively to obtain 10 10 ~101 The detection sample of [[[number of copies]]] / μl was used as the template for RAA isothermal amplification. Then, 1 μl was added to the same system respectively, and ddH2O was used as the negative control for the RAA-CRISPR / Cas12a reaction. In this example, the construction of each reaction system can refer to the content of Example 1 and will not be elaborated here.

[0073] In this example, the results of the visual interpretation and the bar chart of the fluorescence values of the sensitivity evaluation of the ToLCNDV visual detection method are as Figure 4 shown, and the results show that the sensitivity of this method is 10 1 copies / μl.

[0074] The above-described embodiments are only a preferred solution of the present invention, which is convenient for those skilled in the relevant art to understand and use. Without departing from the spirit and principle of the present invention, those skilled in the relevant art can make various reasonable changes, modifications and improvements without creative labor. Therefore, the above examples are not limitations on the present invention, and all technical solutions obtained by means of equivalent replacement or equivalent transformation fall within the protection scope of the present invention.

Claims

1. A visual detection method for New Delhi Tomato Leaf Curl Virus, characterized in that: First, the genomic DNA extracted from the plant sample to be tested is added to the RAA reaction system containing RAA primers and isothermally amplified; then the isothermally amplified product is added to the CRISPR / Cas12a detection system containing specific crRNA and ssDNA fluorescent probes for reaction; finally, the reaction product is subjected to fluorescent signal detection. If the fluorescent signal is positive, it indicates that the New Delhi Tomato Leaf Curl Virus has been detected in the plant sample; otherwise, it indicates that the New Delhi Tomato Leaf Curl Virus has not been detected; The RAA primer includes a forward primer and a reverse primer, the nucleic acid sequence of the forward primer is shown in SEQ ID NO.1, and the nucleic acid sequence of the reverse primer is shown in SEQ ID NO.2; the sequence of the specific crRNA is shown in SEQ ID NO.3; the nucleic acid sequence of the ssDNA fluorescent probe is 5'-FAM-CCCCCCC-BHQI-3'.

2. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The extraction buffer used to extract genomic DNA from the plant sample to be tested is an extraction buffer containing PEG and NaOH.

3. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The plant sample to be detected is leaf tissue of the plant to be detected.

4. The method for visual detection of New Delhi Tomato Leaf Curl Virus according to claim 1, wherein: The RAA reaction system is configured using the RAA nucleic acid amplification kit model S001ZC produced by Hangzhou Zhongce Biotechnology Co., Ltd., and its components include: 1 tube of reaction dry powder, 25 μl A Buffer, 2 μl of the forward primer at a concentration of 10 μM, 2 μl of the reverse primer at a concentration of 10 μM, 5 μl of the genomic DNA, 2.5 μl B Buffer, and finally the system is filled to 50 μl with RNase-free water.

5. The method for visual detection of New Delhi Tomato Leaf Curl Virus according to claim 4, characterized in that: The method for adding the genomic DNA to the RAA reaction system containing the RAA primer for isothermal amplification is as follows: first preparing a mixed solution containing RNase-free water, A Buffer, the forward primer, and the reverse primer according to the RAA reaction system, and adding the mixed solution to a detection unit tube containing the reaction dry powder; then adding the genomic DNA to the detection unit tube, and then adding the B Buffer and sealing the tube cover to mix well, centrifuging the mixed solution to the bottom of the tube, and then incubating at a constant temperature for isothermal amplification to obtain an isothermal amplification product.

6. The method for visual detection of New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The reaction conditions of the CRISPR / Cas12a detection system are 37°C for 30 min, and the system components include: 2 μl of isothermal amplification product, 100 nM Cas12a protein, 100 nM of the specific crRNA, 2 μl of NEBuffer 2.1 reaction buffer, 2 μM of the ssDNA fluorescent probe, and filled to 20 μl with RNase-free water.

7. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The method for detecting the fluorescence signal of the reaction product is: using an instrument with a fluorescence collection system to collect the fluorescence signal intensity of the CRISPR / Cas12a detection system at the end of the reaction in real time, when the fluorescence signal is enhanced relative to the initial fluorescence signal, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

8. The visual detection method of New Delhi Tomato Leaf Curl Virus according to claim 7, characterized in that: The instrument with the fluorescence collection system is a real-time fluorescence quantitative PCR instrument.

9. The method for visual detection of New Delhi Tomato Leaf Curl Virus according to claim 7, characterized in that: The duration of real-time acquisition of the fluorescence signal intensity is not less than 1 hour, and the interval is not more than 1 minute.

10. The visual detection method for New Delhi Tomato Leaf Curl Virus according to claim 1, characterized in that: The method for detecting the fluorescent signal of the reaction product is: using an ultraviolet flashlight to illuminate the CRISPR / Cas12a detection system after the reaction is completed, and visually observing the fluorescent signal; when green fluorescence is observed, it indicates that the plant sample to be detected contains the New Delhi Tomato Leaf Curl Virus, otherwise it indicates that the plant sample to be detected does not contain the New Delhi Tomato Leaf Curl Virus.

Citation Information

Patent Citations

  • Probe, primer and kit for detecting tobacco brown spot and application of gene segment

    CN117721236A

  • CrRNA for detecting trichomonad of poultry based on RAA combined with CRISPR-Cas12a system, kit and detection method thereof

    CN118834979A

  • Reagent, kit and method for performing RPA-LFD visual rapid detection on New Delhi tomato leaf curl virus

    CN118910331A

Cited By

  • New Delhi tomato leaf curl virus specific sequence, LAMP detection primer and application

    CN122466146A