Construction method of anti-oxidation adhesion type genetically engineered bacterium, engineered bacterium and application of engineered bacterium

Abstract

The invention discloses a construction method of an anti-oxidation adhesion type genetically engineered bacterium, the engineering bacterium and application of the engineering bacterium, and relates to the technical field of construction of the anti-oxidation adhesion type genetically engineered bacterium. According to the invention, superoxide dismutase and catalase are subjected to constitutive overexpression in a probiotic chassis by using a synthetic biological technology, and meanwhile, intestinal trefoil factor peptide fused pilin is subjected to overexpression. According to the present invention, the research results show that the active oxygen scavenging ability of the anti-oxidation adhesion type gene engineering probiotic is significantly improved, the adhesion ability of the anti-oxidation adhesion type gene engineering probiotic in the animal intestinal tract is significantly enhanced, and the radiation enteritis symptom caused by the whole abdomen ionizing radiation irradiation can be effectively relieved; the strain can be used as a potential safe viable bacterium medicine for preventing and treating radiation enteritis and other active oxygen related enteritis. The anti-oxidation adhesion type genetic engineering probiotics can be prepared into viable bacteria preparations such as viable bacteria suspension, dairy products, viable bacteria powder, bacterial tablets or capsules, can be proliferated and colonized in human intestinal tracts after being orally taken, and is applied to prevention and treatment of radiation enteritis.

Description

Technical Field

[0001] The invention relates to the technical field of construction of antioxidant adhesion-type genetic engineering bacteria, and more specifically to a construction method of antioxidant adhesion-type genetic engineering bacteria, the engineering bacteria and applications thereof. Background Art

[0002] An imbalance in intestinal redox homeostasis can lead to an increase in the concentration of reactive oxygen species in intestinal tissues, causing a series of cellular oxidative damage and eventually developing into enteritis, including radiation enteritis (RE), ulcerative colitis (UC), Crohn's disease, and irritable bowel syndrome. The current treatment for this type of enteritis is still mainly symptomatic and supportive treatment, such as anti-infection, nutritional support, protection of the digestive tract mucosa, antidiarrhea, and regulation of intestinal flora. No preventive and therapeutic drugs for this type of enteritis have been approved.

[0003] Clinical studies have shown that oral lactobacillus, Escherichia coli and Bifidobacterium can treat a variety of diseases such as enteritis and diabetes. Seres Therapeutics announced that its intestinal microbiome capsule SER-109 obtained positive top-line results in a Phase III trial of recurrent Clostridium difficile infection and is expected to become the first microbiome drug approved by the FDA. Genetic engineering methods, including synthetic biology and gene editing technology, are used to transform microorganisms and tailor specific engineered bacteria for certain diseases to improve their efficacy and safety, so that they not only have the therapeutic effects of probiotics, but also have effects comparable to or even exceeding other drug therapies. Escherichia coli Nissle 1917 strain (EcN) is a probiotic Escherichia coli first discovered in the intestines of soldiers during World War I. It is used in Europe as the active ingredient of Mutaflor® to treat enteritis and is a good chassis strain.

[0004] The surge of oxygen free radicals is the root cause of enteritis caused by the imbalance of redox homeostasis, so scavenging free radicals from the source is an effective strategy for prevention and treatment. Antioxidant enzymes can efficiently scavenge free radicals, but the catalytic effect of enzymes is unstable in the intestinal environment and proteases are prone to change. Overexpressing the antioxidant enzyme system in probiotics ensures the stability and efficiency of the enzymes. Because the division of probiotics can produce effects continuously, it is a promising solution.

[0005] However, exogenous probiotics after oral administration are almost unable to colonize in the intestine and cannot function stably. Therefore, improving the intestinal adhesion ability of probiotics can make them divide and reproduce in the intestine and continue to function stably. The trefoil factor family is a group of small molecule proteins with trefoil factor domains. They are specifically synthesized and secreted in the gastrointestinal tract. The proteins in this family are highly conserved and have the characteristics of heat resistance, acid resistance and enzyme resistance. They play an important role in the protection and repair of the gastrointestinal tract. There are three types of trefoil factors found in mammals, namely breast cancer-related peptides, spasmolytic polypeptides and intestinal trefoil factors. Among them, intestinal trefoil factors have significant functions in intestinal mucosal protection, mucin affinity and intestinal adhesion. Fimbriae are short and straight filamentous structures densely distributed on the surface of Gram-negative bacteria. It can be observed under an electron microscope that there are many fimbriae. Each bacterium can have 100-500 fimbriae, which are composed of self-assembled proteins. The protein secretion system is the curli secretion system. EcN fimbriae can be modified with different peptides through synthetic biotechnology, and the intestinal trefoil factor can be fused and expressed on the fimbriae to achieve the strong intestinal adhesion and mucosal repair function of probiotics.

[0006] Therefore, providing genetically engineered probiotics that overexpress antioxidant enzymes and intestinal trefoil factors and developing them into specific live bacterial drugs for treating radiation enteritis are issues that need to be urgently addressed by those skilled in the art. Summary of the invention

[0007] In view of this, the present invention is proposed.

[0008] One of the purposes of the present invention is to provide a method for constructing an antioxidant adhesion-type genetically engineered bacterium.

[0009] The second purpose of the present invention is to provide an antioxidant adhesion-type genetically engineered bacterium.

[0010] The third object of the present invention is to provide the use of the above-mentioned engineered bacteria in the preparation of drugs for intestinal diseases related to redox homeostasis imbalance.

[0011] In order to achieve the above object, the present invention adopts the following technical solution:

[0012] An embodiment of the present invention provides a method for constructing an antioxidant adhesion-type genetically engineered bacterium, the process comprising:

[0013] 1) Knock out the cryptic plasmids pMUT1 and pMUT2 of the probiotic strain, and then knock out the thyA gene and csgA gene to obtain the chassis strain;

[0014] 2) Amplify the donor DNA of superoxide dismutase gene and catalase gene, and transform them into the φ80 region of the genome of the chassis strain to obtain the recombinant strain;

[0015] 3) Amplify the csg operon fragment of the probiotic Escherichia coli and clone it into the downstream of the arabinose-inducible promoter of the pBbB8k plasmid;

[0016] 4) synthesizing the TFF3 coding sequence containing the linker and inserting it into the C-terminus of the csgA gene to obtain pBbB8k-csgA-TFF3; wherein the amino acid sequence of the csgA-TFF3 fusion gene is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6;

[0017] 5) Transform pBbB8k-csgA-TFF3 into the recombinant strain, and obtain the final antioxidant adhesion-type genetically engineered probiotic strain through resistance screening.

[0018] In a preferred embodiment, the superoxide dismutase gene is selected from homologous genes of any species;

[0019] Preferably, selected from manganese-dependent superoxide dismutase;

[0020] More preferably, it is selected from the manganese-dependent superoxide dismutase derived from Deinococcus radiodurans,

[0021] Most preferably, the amino acid sequence of superoxide dismutase is shown as SEQ ID NO.1, and the nucleotide sequence is shown as SEQ ID NO.2.

[0022] In a preferred embodiment, the catalase is selected from homologous genes of any species;

[0023] Preferably, selected from heme-dependent catalase;

[0024] More preferably, the E. coli katE gene is selected;

[0025] Most preferably, the amino acid sequence of catalase is shown as SEQ ID NO.3, and the nucleotide sequence is shown as SEQ ID NO.4.

[0026] In a preferred embodiment, the superoxide dismutase gene and catalase gene fragments are inserted into the same position or different positions of the genome of the competent strain.

[0027] In a preferred embodiment, the probiotic strain is selected from probiotic Escherichia coli, probiotics of the genus Lactobacillus, probiotics of the genus Lactococcus, and yeast;

[0028] Preferably, it is probiotic Escherichia coli.

[0029] The second aspect of the embodiment of the present invention provides an antioxidant adhesion-type genetically engineered bacterium, wherein the engineered bacterium is constructed by the method described above.

[0030] The third aspect of the embodiments of the present invention provides the use of antioxidant adhesion-type genetically engineered bacteria in the preparation of drugs for intestinal diseases related to redox homeostasis imbalance;

[0031] Preferably, the intestinal diseases associated with redox homeostasis imbalance include radiation enteritis, ulcerative colitis, Crohn's disease, and irritable bowel syndrome;

[0032] Preferably, the dosage form of the drug includes live bacteria suspension, dairy products, live bacteria powder, bacteria tablets or capsules.

[0033] It can be seen from the above technical solutions that, compared with the prior art, the technical effects achieved by the present invention are as follows:

[0034] (1) The characteristic of the antioxidant enzyme gene in the present invention is that it is integrated into the probiotic genome, ensuring the stability and heritability of the antioxidant capacity.

[0035] (2) The antioxidant adhesion-type genetically engineered probiotics of the present invention integrate both antioxidant and intestinal adhesion functions, thereby improving the therapeutic effect compared to single-function probiotics.

[0036] (3) The antioxidant adhesion-type genetically engineered probiotics in the present invention are nutritionally deficient, thus ensuring biosafety.

[0037] (4) The antioxidant adhesion-type genetically engineered probiotics of the present invention have biological adhesion and can achieve the desired therapeutic effect with only one or a few uses. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0039] Figure 1 The attached figures show the results of hidden plasmid knockout, A: PCR verification of pMUT1 and pMUT2, lane 1 is the pMUT1 PCR result of the wild type, lane 2 is the pMUT1 PCR result of the knockout strain, lane 3 is the pMUT2 PCR result of the wild type, and lane 4 is the pMUT2 PCR result of the knockout strain; B: Nucleic acid electrophoresis of the extracted plasmid, lane 1 is the plasmid extraction result of the wild type, and lane 2 is the plasmid extraction result of the knockout strain; C: Verification of the drug resistance of the chassis strain, from left to right are non-antibiotic plate, streptomycin plate and kanamycin plate respectively.

[0040] Figure 2The attached figures show the knockout and verification of thyA and csg operons, A: thyA knockout results; B: csg knockout results; C: thyA defect verification results; D: Curli fiber yield verification results; E: electron microscopy photo of the csg knockout strain.

[0041] Figure 3 The attached figures show the expression verification of superoxide dismutase and catalase, A: superoxide dismutase Western blotting experiment, i.e. WB result; B: catalase WB result; WT represents wild-type probiotics, and engineered bacteria represents engineered strains that overexpress antioxidant enzymes.

[0042] Figure 4 The attached figure shows the active oxygen scavenging efficiency of engineered probiotics, A: O2- scavenging efficiency of engineered probiotics; B: H2O2 scavenging efficiency of engineered probiotics; WT represents wild-type probiotics, and engineered bacteria represents engineered strains that overexpress antioxidant enzymes.

[0043] Figure 5 The attached figures show the adhesion pili of engineered probiotics, A: WB results of csgA-TFF3 fusion protein of engineered probiotics; B: TFF3 production of engineered probiotics; C: curli nanofiber production of engineered bacteria; WT represents wild-type probiotics, pBbB8k-csgA' represents engineered bacteria with the plasmid transferred, (+) and (−) respectively indicate whether arabinose was used for induction.

[0044] Figure 6 The attached figure is a scanning electron microscope image of the engineered probiotics.

[0045] Figure 7 The attached figure shows the bacterial density of engineered probiotics in different intestinal segments.

[0046] Figure 8 The attached figures show the anti-radiation effect of engineered probiotics, A: weight changes of mice in different groups, B: small intestine length, C: small intestinal villus length, D: number of small intestinal crypts, E: small intestine appearance / HE pathological section / Ki67 section, F: ROS level in small intestinal tissue, G: SOD enzyme activity in small intestinal tissue, H: intestinal permeability, IL: IL-10, IL-1β, TNF-α, IL-6 levels in small intestinal tissue.

[0047] Fig. 9 The attached figures show the effects of engineered probiotics on tight junction proteins and cell apoptosis in small intestinal tissue. A: Occludin, ZO-1, MUC2, and TUNEL immunofluorescence sections of small intestinal tissues of mice in different groups (from top to bottom); BC: Statistics of immunofluorescence intensity of Occludin, ZO-1, and MUC2 in different groups of mice. DETAILED DESCRIPTION

[0048] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0049] Example 1 A base strain of an antioxidant adhesion-type genetically engineered bacterium

[0050] Using gene synthesis and gene recombination technology, CRISPR / Cas9 plasmids for knocking out the probiotic cryptic plasmid, csg operon, and thyA gene were constructed. The plasmid sequences are shown in SEQ ID NO.7, SEQ ID NO.8, and SEQ ID NO.9, respectively. The flanking sequences of csg and thyA genes were amplified by polymerase chain reaction (PCR) technology as donor DNA, i.e., dDNA. Gene knockout of the cryptic plasmid does not require amplification of dDNA. The dDNA sequences of csg and thyA genes are SEQ ID NO.10 and SEQ ID NO.11, respectively, and the amplification primers are shown in Table 1:

[0051] Table 1 Primers for donor DNA construction

[0052]

[0053] The PCR system was as follows: 4 μL of 5×Q5 reaction buffer, 0.4 μL of 10 mM dNTP, 1 μL of each 10 μM upstream and downstream primers, 0.4 μL of EcN gDNA, 0.4 μL of Q5 DNA polymerase, and sterile enzyme-free water was added to 20 μL.

[0054] The PCR program was: 98°C for 30 s; 98°C for 10 s, 64°C for 30 s, 72°C for 20 s, 35 cycles; 72°C for 120 s.

[0055] The plasmid and dDNA were transformed into probiotics by electroporation technology. The transformed probiotics were spread on a double-resistance plate containing 100 μg / mL kanamycin and 100 μg / mL streptomycin, cultured overnight at 37°C, and positive colonies were selected to screen mutants with successful gene knockout. The knockout of the cryptic plasmid was verified by PCR and plasmid extraction experiments. Figure 1 As shown, the cryptic plasmid has been knocked out in probiotic E. coli.

[0056] The knockout of thyA and csg operons was verified by PCR. The PCR system and procedure were the same as above. The primers used in PCR were:

[0057] check_csg-sg-FGAGTGAGCTGATACCGCTCG, SEQ ID NO.29

[0058] check_csg-sg-RCACAATCACATCAACGGCCAG, SEQ ID NO.30

[0059] check_thyA-sg-FGAGTGAGCTGATACCGCTCG, SEQ ID NO.31

[0060] check_thyA-sg-RGTCGCTTGCAAAGACGGTTTAG, SEQ ID NO.32

[0061] like Figure 2 As shown, the PCR band of the knockout strain is shorter than that of the wild type, proving that the knockout is successful, and the knockout strain cannot continue to grow in the medium lacking thymidine, and the production of curli nanofibers is reduced.

[0062] The purpose of knocking out the secret plasmid is to facilitate the subsequent transformation of exogenous plasmids. The purpose of knocking out thyA is to construct a thymine auxotrophic type to limit the uncontrolled proliferation of engineered bacteria. The purpose of knocking out the csg operon is to prevent the natural curli fiber from affecting the subsequent expression of intestinal trefoil factor peptide fused curli fiber.

[0063] Example 2 Antioxidant capacity of an antioxidant adhesion-type genetically engineered bacterium

[0064] The manganese-dependent superoxide dismutase gene of Deinococcus radiadurans (accession number: CGMCC1.3828, accession location: China General Microbiological Culture Collection Center) was amplified by PCR technology, and its amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2. The homologous arm fragments on both sides of the probiotics to be knocked in were amplified, and finally the three fragments were fused by fusion PCR technology to obtain donor DNA, and the sequence is shown in SEQ ID NO.12. A gene editing plasmid based on CRISPR / Cas9 was constructed, and the sequence is shown in SEQ ID NO.13, which was co-transformed into Escherichia coli in Example 1 with the above donor DNA, and the overexpression strain was obtained by resistance screening and PCR verification. The same method was used to construct a constitutive promoter sequence of catalase, as shown in SEQ ID NO.14, the amino acid sequence of overexpressed catalase was shown in SEQ ID NO.3, and the nucleotide sequence was shown in SEQ ID NO.4. The same method was further used to construct a donor DNA for overexpression of catalase, the sequence of which was shown in SEQ ID NO.15, and an overexpression strain was obtained through resistance screening and PCR verification. Figure 3 As shown, Western blotting, ie, WB, experiments verified that superoxide dismutase and catalase were successfully expressed in the engineered strain.

[0065] The test kit method was used to test the effect of engineered probiotics on O2 ·- and H2O2 removal efficiency as follows:

[0066] The engineered bacteria were cultured in LB liquid medium containing 40µg / mL kanamycin at 37°C for 12 h, centrifuged (4000 r / min, 5 min, 4°C) to collect the bacteria, resuspended in PBS buffer, and then spread and counted. The PBS buffer was used for gradient dilution to different orders of magnitude. Among them, part of the bacterial solution was not treated, and the other part of the bacterial solution was ultrasonically disrupted (300 W, ultrasonic 2 s, interval 3 s, 99 times), and the superoxide anion free radical scavenging rate and hydrogen peroxide scavenging rate were determined respectively.

[0067] Determination of superoxide dismutase, i.e. SOD enzyme: proceed according to the instructions of the kit. The substrate application solution and enzyme working solution must be prepared before use. Operate according to the sample addition table 2.

[0068] Table 2 SOD enzyme assay sample addition table

[0069]

[0070] Determination of catalase, i.e. CAT enzyme: Follow the instructions of the kit and operate according to Table 3.

[0071] Table 3 CAT enzyme assay sample addition table

[0072]

[0073] The results are as follows Figure 4 As shown, the engineered probiotics have an effect on O2 ·- The clearance efficiency of engineered probiotics for H2O2 is 3 times that of wild strains, and the clearance efficiency of engineered probiotics for H2O2 is 5 times that of wild strains, indicating that engineered bacteria have stronger antioxidant capacity.

[0074] Example 3 Intestinal Adhesion of an Antioxidant Adhesive Genetically Engineered Bacteria

[0075] The csg operon of the probiotic Escherichia coli was cloned downstream of the arabinose-inducible promoter of the pBbB8k plasmid using PCR technology. The primers used were: csgBACEFG-F (5'-3'): GCGTTATTACTCCTTGCGGCAC, SEQ ID NO.33;

[0076] csgBACEFG-R (5'-3'): GTGCTTCTTCAGTTTGAATCAGTGC, SEQ ID NO.34. The PCR system used was: 2×M5 20 μL, EcN gDNA 1 μL, 1 μL of 10 μM upstream and downstream primers, and sterile enzyme-free water to 40 μL. The PCR program used was: 95 ℃ 180 s; 94 ℃ 25 s, 64 ℃ 25 s, 72 ℃ 21 s, 35 cycles; 72 ℃ 300 s. The DNA sequence of human TFF3 was synthesized, and the TFF3 sequence was spliced ​​to the C-terminus of the csgA gene in the csg operon by Gibson assembly. The two were connected by the linker of GGGS to obtain the pBbB8k-csgA-TFF3 plasmid, i.e., the pBbB8k-csgA' plasmid, wherein the amino acid sequence of the csgA-TFF3 fusion gene is shown in SEQ ID NO.5, the nucleotide sequence is shown in SEQ ID NO.6, and the pBbB8k-csgA' plasmid sequence is shown in SEQ ID NO.16. After the plasmid is transferred to the probiotics, the TFF3 fusion pilus protein can be expressed under the induction of arabinose, and a large number of curli nanofibers with intestinal adhesion are formed on the surface of the bacteria. The plasmid was delivered to the above-mentioned antioxidant engineering probiotics by electrotransformation, and the positive strains were obtained by resistance screening. The expression of the adhesion nanofibers and the intestinal adhesion of the engineering bacteria were investigated by WB, ELISA, Congo red binding analysis, scanning electron microscopy, and real-time fluorescence quantitative PCR.

[0077] like Figure 5As shown in the figure, the expression of csgA-TFF3 fusion protein in the engineered probiotics increased significantly after arabinose induction, and interconnected nanofibers were observed under an electron microscope ( Figure 6 ), proving that pBbB8k-csgA' works normally in the bacteria. 11 The CFU dose was orally administered to mice, and the density of engineered bacteria in the small intestine, cecum, and colon of mice was examined on the 1st, 3rd, and 5th days after oral administration. The results are shown in Figure 7 It was found that the density of engineered bacteria in the colon was significantly higher than that of wild strains at the three detection time points, proving that the engineered bacteria have good intestinal adhesion.

[0078] In summary, the antioxidant adhesion-type genetically engineered probiotics of this embodiment were successfully constructed. The strain can not only efficiently remove reactive oxygen species, but also has abundant surface curli fibers. The protein fibers are fused with TFF3 peptides, have significant intestinal adhesion effects, and increase the intestinal retention time of the engineered probiotics.

[0079] Example 4 Effect of an Antioxidant Adhesive Genetically Engineered Probiotic on Preventing and Treating Intestinal Diseases Related to Redox Homeostasis Imbalance

[0080] Taking radiation enteritis as an example, the role of an antioxidant adhesion-type genetically engineered probiotic in preventing and treating intestinal diseases related to redox homeostasis imbalance was verified, and the model was established and processed according to the following process.

[0081] (1) Experimental groups

[0082] The experiment was divided into 7 groups: normal group (Healthy), model group (Model), amifostine group (Amifostine, positive drug group), wild probiotics group (WT), single antioxidant function engineered bacteria group (SOD / CAT), single adhesion function engineered bacteria group (pBbB8k-csgA'), and dual-functional antioxidant adhesion genetically engineered bacteria group (AAEcN), with 14 C57BL / 6J mice in each group.

[0083] (2) Animal drug administration and establishment of radiation enteritis model

[0084] The experimental animals were adaptively fed for 3 days. Except for the normal group, the other groups were continuously given arabinose (10 g / L), kanamycin (1 g / L) and thymine (1 g / L) through drinking water for 3 days before the experiment.

[0085] The mice in the normal group were not irradiated or treated. The mice in the model group were gavaged with 0.3 mL of saline one day before irradiation. The mice in the amifostine group were intraperitoneally injected with 0.3 mL of amifostine 30 min before irradiation, with an injection dose of 150 mg / kg. The WT and engineered bacteria groups were fasted for 12 h before administration. The bacteria were concentrated with sterile saline and gavaged with 8×10 9 CFU / piece.

[0086] Radiation enteritis modeling method: mice were anesthetized for 10 minutes and then fixed. Lead bricks were used for local shielding and the whole abdomen was irradiated. The irradiated area was from the pubic bone to the xiphoid process. 60 Co γ-ray abdominal irradiation was performed with a single dose of 13 Gy and an irradiation rate of 65.69 cGy / min. The weight changes of mice in each group were recorded daily until the end of the experiment.

[0087] (3) Pathological evaluation of intestinal and spleen tissues

[0088] Five mice in each group were killed after 3.5 days, and the length of the small intestine and colon was calculated. The small intestinal tissue with a length of 1 cm at 5 cm from the lower end of the stomach, the colon tissue with a length of 1 cm at 1 cm below the cecum, and the spleen tissue were fixed in 4% paraformaldehyde solution for 1 day, dehydrated, and paraffin-embedded. The tissue pathological morphology was observed under a microscope using H&E staining, and the number of small intestinal crypts and the length of small intestinal villi were counted and statistically analyzed.

[0089] (4) Evaluation of Ki 67 in intestinal and spleen tissues

[0090] The small intestine, colon and spleen tissues of mice were collected at 3.5 days and Ki 67 staining immunohistochemistry was used to detect the proliferation of cells in the irradiated mice and to determine the recovery of the intestinal tissues and immune organs of the mice after irradiation.

[0091] (5) Immunofluorescence staining of small intestinal tissue

[0092] The small intestinal tissues of mice at 3.5 days were obtained for staining of occludin and ZO-1 tight junction proteins and mucin MUC2. The TUNEL detection kit was used to evaluate the cell apoptosis at 3.5 days and the protective and restorative effects of the engineered bacteria on the intestines of irradiated mice.

[0093] (6) Behavioral experiment - open field test

[0094] On the 5th day after irradiation, behavioral experiments were conducted on mice to measure the movement trajectory, total distance and immobility time of mice in each group in the open field within 5 minutes, mainly to evaluate the free movement ability of mice irradiated with ionizing radiation in an open unfamiliar environment.

[0095] (7) Determination of intestinal mucosal permeability

[0096] On the 6th day after irradiation, 4 mice were selected from each group. They were fasted but not watered for 12 hours in advance, and FITC-dextran was gavaged at a dose of 600 mg / kg. After 4 hours, the eyeballs were removed to collect blood, and the blood was left to stand at 4°C for 12 hours. The blood was centrifuged in a high-speed refrigerated centrifuge at 1000 × g for 15 minutes to obtain serum. 100 μL of serum was taken, and the fluorescence intensity in the serum was measured using a multifunctional microplate reader at an excitation wavelength of 490 nm and an emission wavelength of 520 nm.

[0097] (8) Determination of ROS levels in small intestinal tissue

[0098] The small intestinal tissue of mice on the fifth day was dissected and mashed with an appropriate amount of physiological saline. The supernatant was collected by centrifugation at 3000 r / min for 10 min and the ROS level in the small intestinal tissue was determined using a Mouse ROS ELISA detection kit. The detection method was referred to the instruction manual of the ELISA kit.

[0099] (9) Determination of cytokine and tissue SOD enzyme levels in intestinal tissue

[0100] The small intestine and colon tissues of mice on the fifth day were dissected and ground with physiological saline to obtain the supernatant. The IL-6, IL-10, IL-1β, TNF-α cytokine levels in the small intestine and colon tissues and the SOD level in the tissues were determined using an ELISA kit. The detection method was referred to the ELISA kit manual.

[0101] (10) Effects of engineered bacteria on the intestinal flora of irradiated mice

[0102] On the fifth day, more than three feces from each group of mice were collected, quickly frozen in liquid nitrogen, and sent to Kidio Biotechnology Co., Ltd. for 16S sequencing to analyze the changes and richness of the mouse intestinal flora.

[0103] The results are shown in Figure 8 From the perspective of mouse weight, the weight of mice in the model group continued to decrease, while the weight of mice in the AAEcN engineered bacteria treatment group decreased more slowly, and tended to level off on the 4th day after irradiation, and began to recover on the 6th day ( Figure 8 A); The length of the small intestine in the model group was shortened dramatically ( Figure 8 B) Decreased number of crypts ( Figure 8 D) Shortening of the villi in the small intestine ( Figure 8 C), the small intestine appears shorter / HE pathological sections / Ki67 sections show incomplete ( Figure 8 E), while AAEcN effectively inhibited the above phenomenon, making the small intestine state of this group of mice almost consistent with that of the healthy group.

[0104] The level of reactive oxygen species in the small intestine of irradiated mice increased significantly, while AAEcN effectively removed ROS ( Figure 8 F), reducing oxidative damage and increasing enzyme activity in small intestinal tissue ( Figure 8 G). The small intestinal tissue structure of the irradiated mice was severely damaged, resulting in increased intestinal permeability ( Figure 8 H), the barrier protection function decreased, while AAEcN effectively protected the intestinal barrier function and maintained it at a similar state to the healthy group. The investigation of inflammatory factors in small intestinal tissue showed that after irradiation, the levels of proinflammatory factors IL-1β, TNF-α, and IL-6 increased, while AAEcN effectively inhibited the occurrence and development of inflammation, the levels of proinflammatory factors IL-1β, TNF-α, and IL-6 decreased, and the level of anti-inflammatory cytokine IL-10 increased ( Figure 8 I- Figure 8 L), indicating that AAEcN can effectively inhibit oxidative damage and inhibit the occurrence and development of radiation enteritis.

[0105] Immunofluorescence section examination of the small intestinal tissues of each group of mice ( Fig. 9 ). First, the expression of three important tight junction proteins was studied, namely Occludin, ZO-1, and MUC2. The three tight junction proteins of the irradiated mice were all low in expression, indicating that the intestine was severely damaged, while the three tight junction proteins in the intestine of the AAEcN group of mice were expressed vigorously, almost the same as those in the healthy group, indicating that this engineered probiotic significantly increased the expression of tight junction proteins and maintained normal intestinal function. At the same time, the TUNEL immunofluorescence results of small intestinal cells were examined to reflect the apoptosis of small intestinal tissue cells. After irradiation, the apoptosis of small intestinal cells increased significantly, while AAEcN effectively avoided cell apoptosis and promoted tissue regeneration.

[0106] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0107] The above description of the disclosed embodiments enables one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A method for constructing an antioxidant adhesion-type genetically engineered bacterium, characterized in that the process include: 1) Knock out the cryptic plasmids pMUT1 and pMUT2 of the probiotic strain, and then knock out the thyA gene and csgA gene to obtain the chassis strain; 2) Amplify the donor DNA that overexpresses the superoxide dismutase gene and the catalase gene, and knock the two genes into the φ80 region of the genome of the chassis strain to obtain a recombinant strain; 3) Amplify the csg operon fragment of the probiotic Escherichia coli and clone it into the downstream of the arabinose-inducible promoter of the pBbB8k plasmid; 4) synthesizing the TFF3 coding sequence containing the linker and inserting it into the C-terminus of the csgA gene to obtain pBbB8k-csgA-TFF3, i.e., pBbB8k-csgA'; wherein the amino acid sequence of the csgA-TFF3 fusion gene is shown in SEQ ID NO.5, and the nucleotide sequence is shown in SEQ ID NO.6; 5) Transform pBbB8k-csgA' into the recombinant strain, and obtain the final antioxidant adhesion-type genetically engineered probiotic strain through resistance screening.

2. The method for constructing an antioxidant adhesion-type genetically engineered bacterium according to claim 1, characterized in that: The superoxide dismutase gene is selected from homologous genes of any species; the amino acid sequence of superoxide dismutase is shown in SEQ ID NO.1, and the nucleotide sequence is shown in SEQ ID NO.

2.

3. The method for constructing an antioxidant adhesion-type genetically engineered bacterium according to claim 1, characterized in that: The catalase is selected from homologous genes of any species; the amino acid sequence of the catalase is shown in SEQ ID NO.3, and the nucleotide sequence is shown in SEQ ID NO.

4.

4. The method for constructing an antioxidant adhesion-type genetically engineered bacterium according to claim 1, characterized in that: The superoxide dismutase gene and catalase gene overexpression fragments are inserted into the same position or different positions of the genome of the chassis strain.

5. The method for constructing an antioxidant adhesion-type genetically engineered bacterium according to claim 1, characterized in that: The probiotic strain is selected from probiotic Escherichia coli, probiotics of the genus Lactobacillus, probiotics of the genus Lactococcus, and yeast.

6. Antioxidant adhesion genetically engineered bacteria, characterized in that: The engineered bacteria are constructed by the method described in any one of claims 1-5.

7. Use of the antioxidant adhesion-type genetically engineered bacteria according to claim 6 in the preparation of drugs for intestinal diseases related to redox homeostasis imbalance; The intestinal diseases associated with redox homeostasis imbalance include radiation enteritis, ulcerative colitis, Crohn's disease, and irritable bowel syndrome; The dosage form of the medicine includes live bacteria suspension, dairy products, live bacteria powder, bacteria tablets or capsules.

Images