Primer probe combination, reagent or kit for detecting human papilloma virus nucleic acid and application

Abstract

The invention relates to the technical field of human papilloma virus detection, in particular to a primer probe combination, a reagent or kit for human papilloma virus nucleic acid detection and application. The purpose of detecting different types is achieved by adding different specific probes, 18 common human papilloma virus DNAs which are internationally recognized to be closely related to cervical cancer can be detected at a time, and HPV16 and HPV18 types are subjected to typing detection. The application provides 6 universal primers (including 4 target primers and 2 internal standard primers) and 19 specific probes (including 18 target probes and 1 internal standard probe), the 4 target primers can amplify DNA of 18 human papilloma viruses, and the 18 probes are specific probes designed for the 18 human papilloma viruses. And meanwhile, by optimizing the primer probe and the reaction liquid, the purpose of detection is achieved.

Description

Technical Field

[0001] The present invention relates to the technical field of human papillomavirus detection, and in particular to a primer-probe combination, a reagent or a kit for human papillomavirus nucleic acid detection and applications. Background Art

[0002] Cervical cancer is currently the only cancer with a clear cause that can be detected and prevented early. It is mainly caused by human papillomavirus infection, also known as HPV infection.

[0003] At present, about 200 types of HPV have been identified from the human body. The distinction between HPV types is mainly based on a 291bp fragment located on the L1ORF gene. The difference in L1 gene between different HPV types exceeds 10%. According to the main infection site, it is divided into skin type and mucosal type; according to the carcinogenic potential, it is divided into high-risk type and low-risk type. High-risk HPV mainly causes cervical, anal and genital cancer, including: HPV16 / 18 / / 31 / / 33 / 35 / 39 / 45 / 51 / 52 / 56 / 58 / 59 / 68. Low-risk HPV mainly causes genital warts and benign lesions, including HPV6 / 11, etc.

[0004] In 2012, IARC divided HPV into three groups: Group I carcinogens (human carcinogens): HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, Group II Class A carcinogens (substances that are likely to cause human cancer): HPV68, Group II Class B carcinogens (substances that may cause human cancer): HPV26, 30, 34, 53, 66, 67, 69, 70, 73, 82, 85, 97.

[0005] According to the research results of the WHO International Agency for Research on Cancer (IARC) and other international organizations, 13 genotypes including HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, and 68 are listed as high-risk types. Five genotypes including HPV26, 53, 66, 73, and 82 are listed as medium-risk types, and low-risk HPV types include 6, 11, 42, 43, and 44.

[0006] Human papillomavirus (HPV) is a non-enveloped double-stranded circular small DNA virus that is tropic to epithelial tissue. The viral genome is approximately 8kb and can be divided into three regions: early genes (including open reading frames E6, E7, E1, E8, E2, E4, and E5), late genes (including open reading frames L2 and L1), and a non-coding upstream regulatory region (URR), also known as a long control region (LCR).

[0007] There are also many types of specific methods involved in HPV testing, the most common ones are hybridization capture method, membrane hybridization method, fluorescence PCR method, mRNA detection method, etc.

[0008] Table 1 Principles, advantages and disadvantages of HPV detection methods

[0009]

[0010]

[0011] Currently, the human papillomavirus nucleic acid detection kits approved by the National Medical Products Administration (NMPA) - 16 / 18 typing and other non-typing are mainly based on the fluorescence PCR method. Manufacturers that detect 18 types include: Jiangsu Shuo Shi, Xiamen Aide, Hangzhou Aikon and other manufacturers.

[0012] Table 2 Human papillomavirus nucleic acid detection kit

[0013]

[0014] However, there are many problems with the above approved test kits:

[0015] 1) The storage temperature requirement is high. Currently, similar test kits on the market are stored at -20±5℃.

[0016] 2) Long amplification time. The amplification time of the three products shown in Table 3 is all over 80 minutes.

[0017] 3) High sensitivity. Commercially available amplification reagents have low sensitivity.

[0018] Therefore, providing a detection kit that can detect 18 types of human papillomavirus and accurately type 16 and 18 has important practical significance. Summary of the invention

[0019] In view of this, the present invention provides a primer-probe combination, a reagent or kit for detecting human papillomavirus nucleic acid, and its application. The present invention achieves the purpose of detecting different types by adding different specific probes, and can detect 18 common human papillomavirus DNAs that are internationally recognized to be closely related to cervical cancer at one time, and perform typing detection on HPV16 and 18 types.

[0020] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0021] The present invention provides a primer-probe combination, including a primer or a combination thereof; and / or a probe or a combination thereof;

[0022] The upstream primer of the primer or the combination thereof has a nucleotide sequence as shown in any of SEQ ID NO: 1 or SEQ ID NO: 2; the downstream primer has a nucleotide sequence as shown in any of SEQ ID NO: 4 or SEQ ID NO: 5;

[0023] The probe or the combination thereof has a nucleotide sequence as shown in any of SEQ ID NOs: 7 to 24;.

[0024] In some specific embodiments of the present invention, the probe or a combination thereof comprises:

[0025] 16 type probes having a nucleotide sequence as shown in any of SEQ ID NOs: 9 to 24; the 16 types include HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82;

[0026] An HPV16 type probe having a nucleotide sequence as shown in SEQ ID NO: 7;

[0027] The HPV18 type probe has the nucleotide sequence shown in SEQ ID NO:8.

[0028] In some specific embodiments of the present invention, the HPV26 type probe has a nucleotide sequence as shown in SEQ ID NO.9;

[0029] An HPV53 type probe having a nucleotide sequence as shown in SEQ ID NO.10;

[0030] An HPV66 type probe having a nucleotide sequence as shown in SEQ ID NO.11;

[0031] An HPV73 type probe having a nucleotide sequence as shown in SEQ ID NO.12;

[0032] An HPV82 type probe having a nucleotide sequence as shown in SEQ ID NO.13;

[0033] An HPV31 type probe having a nucleotide sequence as shown in SEQ ID NO.14;

[0034] An HPV33 type probe having a nucleotide sequence as shown in SEQ ID NO.15;

[0035] An HPV35 type probe having a nucleotide sequence as shown in SEQ ID NO.16;

[0036] An HPV39 type probe having a nucleotide sequence as shown in SEQ ID NO.17;

[0037] An HPV45 type probe having a nucleotide sequence as shown in SEQ ID NO.18;

[0038] An HPV51 type probe having a nucleotide sequence as shown in SEQ ID NO.19;

[0039] An HPV52 type probe having a nucleotide sequence as shown in SEQ ID NO.20;

[0040] An HPV56 type probe having a nucleotide sequence as shown in SEQ ID NO.21;

[0041] An HPV58 type probe having a nucleotide sequence as shown in SEQ ID NO.22;

[0042] An HPV59 type probe having a nucleotide sequence as shown in SEQ ID NO.23;

[0043] The HPV68 type probe has a nucleotide sequence as shown in SEQ ID NO.24.

[0044] In some specific embodiments of the present invention, the 5' end of the probe is modified with a fluorescent group, and the 3' end is modified with a quenching group.

[0045] In some specific embodiments of the present invention, the fluorescent group is one or more of FAM, ROX, JOE, HEX and CY5, and the quenching group is one or more of BHQ-1, BHQ-2 and DABCYL.

[0046] In some specific embodiments of the present invention, the primer-probe combination further comprises an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 3 for detecting an internal standard gene, a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 6, and an internal standard probe having a nucleotide sequence as shown in SEQ ID NO: 25.

[0047] The present invention also provides the use of the primer-probe combination in preparing a reagent or a kit for detecting human papillomavirus and / or typing human papillomavirus.

[0048] In some specific embodiments of the present invention, the human papillomavirus includes one or more of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82.

[0049] The present invention also provides a reagent or kit for detecting human papillomavirus nucleic acid, comprising the primer-probe combination and an acceptable auxiliary agent.

[0050] In some specific embodiments of the present invention, the reagent or kit comprises PCR reaction solution 1 and PCR reaction solution 2:

[0051] The PCR reaction solution 1 includes the primers and probes in the primer-probe combination, as well as Tris, KOAc, Tween20, glycerol, NaN3, UDG enzyme, dNTPs, DMSO and water;

[0052] The PCR reaction solution 2 includes magnesium acetate, NaN3 and water.

[0053] In some specific embodiments of the present invention, the concentration of each primer or each probe in the primer-probe combination is 0.05-0.8 μM.

[0054] In some specific embodiments of the present invention, based on a total system volume of 20 μL, the PCR reaction solution 1 includes 0.05-0.2 μM of each probe in the primer-probe combination, 0.2-0.8 μM of each primer in the primer-probe combination, 30-100 mM Tris, 100-150 mM KOAc, 0.005%-0.1% (v / v) Tween20, 0.1%-1% (v / v) glycerol, 0.1%-1% (v / v) NaN3, 0.1%-5% (w / v) UDG enzyme, 5-50 U rTth enzyme, 0.11-0.6 mM dNTPs, 0.5%-2% (v / v) DMSO, and the remainder is water;

[0055] The PCR reaction solution 2 includes 2-10 mM magnesium acetate, 0.01%-0.1% NaN3 (w / v), and the balance is water.

[0056] The present invention also provides a method for typing and detecting human papillomavirus for non-disease diagnosis purposes, comprising: using the reagent or kit to perform real-time fluorescence PCR detection on a sample to be tested, obtaining an amplification curve, and determining the virus type of human papillomavirus according to the amplification curve.

[0057] In some specific embodiments of the present invention, the HPV16 type probe is modified with CY5; the HPV18 type probe is modified with FAM; the HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82 type probes are modified with ROX; and the internal standard probe is modified with HEX.

[0058] In some specific embodiments of the present invention, the determination method comprises:

[0059] Samples with Ct values ​​≤40 in FAM, CY5, and ROX channels and internal standard Ct values ​​≤40 in HEX channel are reported as positive for human papillomavirus;

[0060] For samples with Ct values ​​≤ 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​> 40 or no display in the HEX channel, the samples to be tested should be resampled and tested here. If this phenomenon is repeated, the human papillomavirus is reported as positive;

[0061] For samples with Ct values ​​> 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​≤ 40 in the HEX channel, the report is negative for human papillomavirus;

[0062] For samples with Ct values ​​> 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​> 40 or no display in the HEX channel, the test results are invalid.

[0063] The present invention provides the following beneficial effects:

[0064] 1) Low storage temperature. This kit can be stored at 2-8°C for 1 year.

[0065] 2) Short amplification time: This kit can complete amplification in about 50 minutes.

[0066] 3) High sensitivity. After testing with calibrated reference materials, the sensitivity reaches 200 copies / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0068] Figure 1 16-type amplification curve diagram is shown;

[0069] Figure 2 18-type amplification curve diagram is shown;

[0070] Figure 326 types of amplification curves are shown;

[0071] Figure 4 31-type amplification curve diagram is shown;

[0072] Figure 5 33-type amplification curve diagram is shown;

[0073] Figure 6 The amplification curve of type 35 is shown;

[0074] Figure 7 39-type amplification curve diagram is shown;

[0075] Figure 8 The amplification curve of type 45 is shown;

[0076] Fig. 9 Shown is the amplification curve of type 51;

[0077] Fig.10 The amplification curve of type 53 is shown;

[0078] Fig.11 58-type amplification curve diagram is shown;

[0079] Fig.12 59-type amplification curve diagram is shown;

[0080] Fig.13 The cross pathogen amplification curve is shown. DETAILED DESCRIPTION

[0081] The present invention discloses primer-probe combinations, reagents or kits for human papillomavirus nucleic acid detection, and applications. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the same. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0082] The 18 types of human papillomavirus described in the present invention refer to HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82.

[0083] (1) The primer or the combination thereof has any one of the following nucleotide sequences:

[0084] A nucleotide sequence having any of SEQ ID No.1 to 6; or a nucleotide sequence having any of SEQ ID No.1 to 6 obtained by modification, substitution, deletion or addition of one or more bases, or a nucleotide sequence having a functionally similar nucleotide sequence to any of SEQ ID No.1 to 6; a sequence having at least 80% homology to any of SEQ ID No.1 to 6, or a nucleotide sequence having a functionally similar nucleotide sequence to any of SEQ ID No.1 to 6;

[0085] (2) The probe or its combination has any one of the following nucleotide sequences:

[0086] A nucleotide sequence having any of SEQ ID No.7 to 25; or a nucleotide sequence having any of SEQ ID No.7 to 25 obtained by modification, substitution, deletion or addition of one or more bases, or a nucleotide sequence having a functionally similar nucleotide sequence to any of SEQ ID No.7 to 25; or a sequence having at least 80% homology to any of SEQ ID No.7 to 25; or

[0087] In some specific embodiments of the present invention, the probe or a combination thereof comprises:

[0088] 16 type probes having a nucleotide sequence shown in any of SEQ ID Nos. 9 to 24;

[0089] Type 16 probe having the nucleotide sequence shown in SEQ ID No. 7;

[0090] Type 18 probe having the nucleotide sequence shown in SEQ ID No. 8;

[0091] The internal standard probe has a nucleotide sequence as shown in SEQ ID No.25.

[0092] The present invention also provides a detection reagent, comprising the primer-probe combination and an acceptable auxiliary agent.

[0093] In some specific embodiments of the present invention, the reagents include a first PCR reaction solution and a second PCR reaction solution;

[0094] Taking the total volume of the system as 20 μL, the first PCR reaction solution includes: the primer concentration as described above is 200-800 nM, the probe content is 50-200 nM; Tris 30-100 mM, KOAc 100-150 mM, Tween 20 0.005%-0.1% (v / v), glycerol 0.1%-1% (v / v), NaN 3 0.1%-5% (w / v), UDG enzyme 0.05-0.3 U, rTth 5-50 U, dNTPs 0.11-0.6 mM, DMSO 0.5%-2% (v / v), and the balance is water;

[0095] Based on a total system volume of 20 μL, the second PCR reaction solution includes: 2-10 mM magnesium ions, 0.01%-0.1% (w / v) NaN3, and the remainder water.

[0096] This kit can cover 18 types in one test, is easy to operate, has a higher detection sensitivity than similar kits, and can be stored at 2-8°C for 1 year. The kit of the present invention has good specificity, and the detection sensitivity is not higher than 200 copies / mL.

[0097] Existing detection kits share probes but not primers, and amplify 14 types with a sensitivity of about 500 to 1000 copies. They use the melting curve method and reverse dot hybridization method, which takes a long time to identify and is prone to contamination. This application uses shared primers but not shared probes, and amplifies 18 types. This application contains many types and has high sensitivity. This application uses fluorescent quantitative PCR for detection, which can be stored at 2 to 8 degrees, with a sensitivity of 200 copies.

[0098] The beneficial effects of the present invention include but are not limited to:

[0099] 1) Low storage temperature. This kit can be stored at 2-8°C for 1 year.

[0100] 2) Short amplification time: This kit can complete amplification in about 50 minutes.

[0101] 3) High sensitivity. After testing with calibrated reference materials, the sensitivity reaches 200 copies / mL.

[0102] Unless otherwise specified, the primer-probe combination, the reagent or kit for detecting human papillomavirus nucleic acid provided by the present invention, and the raw materials and reagents used in their application can all be purchased from the market.

[0103] The present invention will be further described below in conjunction with embodiments:

[0104] The present embodiment provides a detection kit capable of detecting 18 types of human papillomavirus and accurately typing 16 and 18 types, which is composed of at least the following components: ① PCR reaction solution 1: 0.05-0.2 μM of each type of probe, 0.2-0.8 μM of each type of primer, 30-100 mM Tris, 100-150 mM KOAc, 0.005%-0.1% Tween20, 0.1%-1% glycerol, 0.1%-5% NaN3, 0.05-0.3 U UDG enzyme, 5-50 U rTth, 0.11-0.6 mM dNTPs, 0.5%-2% DMSO, water; ② PCR reaction solution 2: 2-10 mM magnesium acetate, 0.01%-0.1% NaN3, water. The system is configured as shown in the following table.

[0105] Table 3 PCR reaction solution 1

[0106] Element Final concentration Tris 50mM KK 120mM Tween20 0.05％ glycerin 0.5％ <![CDATA[NaN3]]> 0.2％ UDG enzyme 0.2U r 25U dNTPs 0.5mM DMSO 1％ Purified water /

[0107] Table 4 PCR reaction solution 2

[0108] Element Final concentration Mg ion 8mM <![CDATA[NaN3]]> 0.05％ water /

[0109] Example Detection of Human Papillomavirus

[0110] (1) Specimen extraction

[0111] Use nucleic acid extraction or purification reagent (Yuzheng Xiebei 20180037) and process the samples according to the instructions.

[0112] (2) Reagent preparation

[0113] Table 5 PCR reaction system

[0114] Component name Volume per reaction / μL PCR reaction solution 1 20 PCR reaction solution 2 20 Template amount 40

[0115] (3) Amplification and detection

[0116] In the reaction tube containing RT-PCR reaction solution, add the extracted sample and negative quality control (plasmid containing β-globin target gene) and positive quality control (plasmid containing HPV16, HPV18, HPV45 and β-globin target gene) as templates, cover the tube tightly, and place it on the PCR instrument for detection. The amplification procedure is as follows:

[0117] Table 6 Real-time fluorescence PCR amplification program

[0118]

[0119] Detection channel selection: Fluorescence signal collection was set to HPV 16 (CY5 channel), HPV 18 (FAM channel), other types (HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73 and HPV82) (ROX channel), and internal standard (HEX channel).

[0120] (4) Quality Control

[0121] 4.1 Human papillomavirus-negative control: No Ct value was displayed in the FAM, HEX, CY5, and ROX channels.

[0122] 4.2 Human papillomavirus-positive control: There were typical S-shaped amplification curves in the FAM, HEX, CY5, and ROX channels, and the detection Ct values ​​were between 24 and 30.

[0123] 4.3 The above requirements must be met in the same experiment. Otherwise, the experiment will be invalid and must be repeated.

[0124] (5) Result determination

[0125] 5.1 For samples with Ct values ​​of FAM, CY5, and ROX channels ≤40, and internal standard Ct value of HEX channel ≤40, the report is positive for human papillomavirus;

[0126] 5.2 For samples with Ct values ​​of FAM, CY5, and ROX channels ≤ 40, the internal standard Ct value of the HEX channel is > 40 or not displayed, indicating that there are no cervical epithelial cells in the sample, but the patient has recently been exposed to human papillomavirus, and it is uncertain whether the patient is infected with human papillomavirus. It is recommended to resample the sample and conduct the experiment again. If this phenomenon repeats, report that the human papillomavirus is positive.

[0127] 5.3 For samples with Ct values ​​> 40 for FAM, CY5, and ROX channels, and Ct values ​​≤ 40 for the internal standard in the HEX channel, they are reported as negative for human papillomavirus (including when the human papillomavirus DNA content is below the detection limit or below the predetermined positive judgment value).

[0128] 5.4 For samples with Ct values ​​> 40 for FAM, CY5, and ROX channels, and Ct values ​​for the internal standard in the HEX channel > 40 or no display, the test results of the sample are invalid. The cause should be found and eliminated, and the sample should be resampled and tested again.

[0129] For samples that are positive for human papillomavirus, the typing results are determined according to the following table:

[0130] Test result classification judgment:

[0131] Table 7 Type determination of test results

[0132] The sample tested positive in the CY5 channel HPV-16 positive The sample tested positive in the FAM channel HPV-18 positive The sample tested positive in the ROX channel HPV other types positive

[0133] Effect Example 1 Selection of Primers and Probes

[0134] 1.1 Primer and probe design

[0135] The DNA sequences of the L1 regions of human papillomavirus of various subtypes were downloaded from NCBI, and then the L1 region sequences of various subtypes were compared using Bioedit and Megalign software. Primer sequences were designed and synthesized in relatively conservative regions of the sequences. The designed primer sequences are shown in Tables 8 and 9.

[0136] The DNA sequences of the L1 regions of various subtypes of human papillomavirus were downloaded from NCBI, and then the L1 region sequences of various subtypes were compared using Bioedit and Megalign software. Probes were designed and synthesized in the specific regions of each type of sequence. The probe sequences are shown in Tables 10 and 11.

[0137] Table 8 Primer combination 1

[0138] Primers Sequence number sequence Target upstream primer 1 SEQ ID NO.1 TTTGTTACTGTGGTAGATACTAC Target upstream primer 2 SEQ ID NO.2 GCMCAGGGWCATAAYAATGG Internal standard upstream primer 1 SEQ ID NO.3 GTGAAGGCTCATGGCAAG Target downstream primer 1 SEQ ID NO.4 GAAAAATAAACTGTAAATCATATTC Target downstream primer 2 SEQ ID NO.5 GAAAAACAAACTGTAAATCATAYTC Internal standard downstream primer 1 SEQ ID NO.6 GTCCCATAGACTCACCCTG

[0139] Table 9 Probe combination 1

[0140] Type Sequence number sequence HPV16 SEQ ID NO.7 TGTGCTGCCATATCTACTTCAGAAAC HPV18 SEQ ID NO.8 TACACAGTCTCCTGTACCTGGGCA HPV26 SEQ ID NO.9 CAGATGGTTTAAATGGAGTGGATGCAG HPV53 SEQ ID NO.10 CTTTCYGCAACCACACAGTCTATG HPV66 SEQ ID NO.11 TGATGCACGTGAAATCAATCAATACC HPV73 SEQ ID NO.12 CTCTACTA+CAACGTATGCCAACTC HPV82 SEQ ID NO.13 CACTGCTGCTACTCCATCAGTTGC HPV31 SEQ ID NO.14 ATGTCTGTKTGTGCTGCAATTGC HPV33 SEQ ID NO.15 TGTACTGTCACTAGTTACTTGTGTGC HPV35 SEQ ID NO.16 CTGCTGTGTCTWCTAGTGAC HPV39 SEQ ID NO.17 AGTCTTCCATACCTTCTACATATGATCC HPV45 SEQ ID NO.18 TGTGCCTCTACACAAAMTCCTGTG HPV51 SEQ ID NO.19 CACTGCTGCRGTTTCCCCA HPV52 SEQ ID NO.20 ACYTCAGCACATAAAGTCATGTTAGTG HPV56 SEQ ID NO.21 CAGAACAGTTAAGTAAATATGATGCACG HPV58 SEQ ID NO.22 CTTCAGTGCATAATGTCATATTAGTGCT HPV59 SEQ ID NO.23 CACACCTACCAGTTTTAAAGAATATGCC HPV68 SEQ ID NO.24 CCACTACTACAGACTCTACTGTACC Internal Standard SEQ ID NO.25 TGGCTCACCTGGACAACC

[0141] Table 10 Primer combination 2

[0142] Primers Sequence number sequence Target upstream primer 1 SEQ ID NO.26 GCACAGGGCCACAACAATGG Target upstream primer 2 SEQ ID NO.27 CTCAGGGTCACAATAATG Internal standard upstream primer 1 SEQ ID NO.28 GTGAAGGCTCATGGCAAG Target downstream primer 1 SEQ ID NO.29 AAATTGCAATTCATATTCTTCSCCA Target downstream primer 2 SEQ ID NO.30 AAATTGTAAATCGAATTCCTCRCCA Internal standard downstream primer 1 SEQ ID NO.31 GTCCCATAGACTCACCCTG

[0143] Table 11 Probe combination 2

[0144]

[0145]

[0146] According to the combination of the above primers and probes in the table below, PCR reaction system 1 and PCR reaction system 2 were prepared into a 20uL system. 18 types of plasmids with different concentrations were tested. The high concentration was about 20000 copies / mL, the medium concentration was about 2000 copies / mL, and the low concentration was about 200 copies / mL. The test results are as follows:

[0147] Table 12 Primer probe combination design

[0148] Combination 1 Combination 2 Combination 3 Combination 4 Primer combination 1 Primer combination 1 Primer combination 2 Primer combination 2 Probe Set 1 Probe Set 2 Probe Set 2 Probe Set 1

[0149] Table 13 Human papillomavirus typing test results of different combinations of primers and probes

[0150]

[0151]

[0152]

[0153] From the above test results, it can be seen that the Ct values ​​of different concentrations of combination 1 for detecting various targets are small. Therefore, combination 1 (primer combination 1 + probe combination 1) was used for subsequent tests. Partial amplification curve of human papillomavirus detected by combination 1 Figures 1 to 12 shown.

[0154] Effect Example 2 Cross-reaction Test

[0155] Using the primer probes shown in combination 1 in effect example 1, the PCR reaction solution 1 system and the PCR reaction solution 2 system were prepared into a 20 μL system according to the method in the embodiment, and the low-risk HPV reference material and the HPV negative reference material of the second-generation human papillomavirus L1 genotyping national reference material (370110) were tested, and the results are as follows:

[0156] Table 14 Cross-reactivity test

[0157] Pathogen name FAM ROX CY5 HEX HPV6 NoC NoC NoC 22.44 HPV6b NoC NoC NoC 23.16 HPV11 NoC NoC NoC 23.40 HPV40 NoC NoC NoC 24.24 HPV42 NoC NoC NoC 24.22 HPV44 NoC NoC NoC 21.28 HPV54 NoC NoC NoC 21.01 HPV61 NoC NoC NoC 24.64 HPY67 NoC NoC NoC 24.97 HPV69 NoC NoC NoC 24.99 HPV70 NoC NoC NoC 25.18 HPV71 NoC NoC NoC 21.03 HPV72 NoC NoC NoC 20.86 HPV81 NoC NoC NoC 24.48 HPV83 NoC NoC NoC 24.67 CMV NoC NoC NoC 23.83 HSV-2 NoC NoC NoC 23.81 HSV-1 NoC NoC NoC 20.98 GBS NoC NoC NoC 21.30 UU NoC NoC NoC 25.05

[0158] Detection of 15 low-risk HPV references and 5 HPV-negative references, all target channels are No Ct. No cross-talk with undetected HPV types and other 5 pathogens ( Fig.13 ), indicating that the specificity of this kit meets the requirements.

[0159] Effect Example 3 Sensitivity Test

[0160] According to the second generation human papillomavirus L1 genotyping national reference material, each high-risk and potential high-risk HPV type was diluted to 200 copies / mL with a negative matrix and tested using the method in the embodiment. The results are as follows:

[0161] Table 15 Sensitivity test

[0162]

[0163]

[0164] Detect 19 types of HPV high-risk and potential high-risk reference materials, dilute to 200 copies / mL, and all types of targets can be detected normally.

[0165] Effect Example 4: Sensitivity Comparison Test

[0166] The kit prepared in the preparation example of the present invention was compared with the Shuoshi Human Papillomavirus Nucleic Acid Detection Kit (Fluorescence PCR Method) (National Medical Device Registration No. 20183400059). Clinical negative samples were used to dilute clinical samples of types 16, 18, and 45 (the concentration of type 16 stock solution was 1.92*10^5copies / mL, the concentration of type 18 stock solution was 1.89*10^5copies / mL, and the concentration of type 45 stock solution was 2.03*10^5copies / mL), and parallel comparisons were performed, with 2 replicate wells tested for each concentration.

[0167] Table 16 Sensitivity comparison test

[0168]

[0169] Effect Example 5 Clinical Sample Test

[0170] Using the 18 types of human papillomavirus nucleic acid detection kits prepared in the preparation examples of the present invention, 100 clinical samples that have been confirmed by the ShuoShi Biotechnology Human Papillomavirus Nucleic Acid Detection Kit (Fluorescence PCR Method) (National Medical Device Registration No. 20183400059) were tested, including 20 cases of human papillomavirus type 16, 20 cases of human papillomavirus type 18, 30 cases of other types of human papillomavirus, and 30 negative clinical samples. The results showed that the results of the 100 samples tested by this kit were completely consistent with those of the ShuoShi kit, with both the positive and negative coincidence rates being 100%. The comparison results of the reagents are shown below.

[0171] Table 17 Clinical sample testing

[0172]

[0173]

[0174]

[0175] Effect Example 6 Real-time Stability Test

[0176] The 18 human papillomavirus nucleic acid detection kits prepared in the preparation examples of the present invention were used, the reagents were prepared and placed at 2 to 8 degrees, and placed for 0 months, 1 month, 3 months, 6 months, 9 months, and 12 months, and the detection limit reference was tested. The results showed that the reagents were placed at 2 to 8 degrees and met the requirements for 12 months. The comparison results of the reagents are shown below.

[0177] Table 18 Real-time stability test

[0178]

[0179]

[0180] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination, characterized in that: comprising primers or combinations thereof; and / or probes or combinations thereof; The upstream primer of the primer or the combination thereof has a nucleotide sequence as shown in any of SEQ ID NO: 1 or SEQ ID NO: 2; the downstream primer has a nucleotide sequence as shown in any of SEQ ID NO: 4 or SEQ ID NO: 5; The probe or a combination thereof has a nucleotide sequence as shown in any of SEQ ID NOs: 7-24.

2. The primer-probe combination according to claim 1, characterized in that: The probe or a combination thereof comprises: 16 type probes having a nucleotide sequence as shown in any of SEQ ID NOs: 9 to 24; the 16 types include HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82; An HPV16 type probe having a nucleotide sequence as shown in SEQ ID NO: 7; The HPV18 type probe has the nucleotide sequence shown in SEQ ID NO:

8.

3. The primer-probe combination according to claim 1 or 2, characterized in that: It also includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO: 3, a downstream primer having a nucleotide sequence as shown in SEQ ID NO: 6, and an internal standard probe having a nucleotide sequence as shown in SEQ ID NO: 25 for detecting an internal standard gene.

4. Use of the primer-probe combination according to any one of claims 1 to 3 in the preparation of a reagent or kit for detecting human papillomavirus and / or typing human papillomavirus.

5. The use according to claim 4, characterized in that The human papillomavirus includes one or more of HPV16, HPV18, HPV26, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV53, HPV56, HPV58, HPV59, HPV66, HPV68, HPV73, and HPV82.

6. A reagent or kit for detecting human papillomavirus nucleic acid, characterized in that: The method comprises the primer-probe combination according to any one of claims 1 to 3 and an acceptable auxiliary agent.

7. The reagent or kit according to claim 6, characterized in that Including PCR reaction solution 1 and PCR reaction solution 2: The PCR reaction solution 1 comprises the primers and probes in the primer-probe combination according to any one of claims 1 to 3, as well as Trinice, KOAc, Tween20, glycerol, NaN3, UDG enzyme, dNTPs, DMSO and water; The PCR reaction solution 2 includes manganese acetate, magnesium acetate, NaN3 and water.

8. The reagent or kit according to claim 6 or 7, characterized in that The concentration of each primer or each probe in the primer-probe combination is 0.1-0.5 μM.

9. A method for detecting human papillomavirus by typing for non-disease diagnosis purposes, characterized in that: include: Using the reagent or kit as described in any one of claims 6 to 8, real-time fluorescence PCR detection is performed on the sample to be tested to obtain an amplification curve, and the virus type of human papillomavirus is determined according to the amplification curve.

10. The method according to claim 9, characterized in that The determination method includes: Samples with Ct values ​​≤40 in FAM, CY5, and ROX channels and internal standard Ct values ​​≤40 in HEX channel are reported as positive for human papillomavirus; For samples with Ct values ​​≤ 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​> 40 or no display in the HEX channel, the samples to be tested should be resampled and tested here. If this phenomenon is repeated, the human papillomavirus is reported as positive; For samples with Ct values ​​> 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​≤ 40 in the HEX channel, the report is negative for human papillomavirus; For samples with Ct values ​​> 40 in FAM, CY5, and ROX channels, and internal standard Ct values ​​> 40 or no display in the HEX channel, the test results are invalid.

Images